Previous Article | Next Article 
Journal of Virology, January 1999, p. 198-204, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
Spatial Perturbations within an RNA Promoter Specifically
Recognized by a Viral RNA-Dependent RNA Polymerase (RdRp) Reveal
That RdRp Can Adjust Its Promoter Binding Sites
Scott Stevenson
Stawicki and
C. Cheng
Kao*
Department of Biology, Indiana University,
Bloomington, Indiana 47405
Received 24 July 1998/Accepted 22 September 1998
 |
ABSTRACT |
RNA synthesis during viral replication requires specific
recognition of RNA promoters by the viral RNA-dependent RNA polymerase (RdRp). Four nucleotides (
17,
14,
13, and
11) within the brome mosaic virus (BMV) subgenomic core promoter are required for RNA synthesis by the BMV RdRp (R. W. Siegel et al., Proc. Natl. Acad. Sci. USA 94:11238-11243, 1997). The spatial requirements for these four nucleotides and the initiation (+1) cytidylate were examined in
RNAs containing nucleotide insertions and deletions within the BMV
subgenomic core promoter. Spatial perturbations between nucleotides
17 and
11 resulted in decreased RNA synthesis in vitro. However,
synthesis was still dependent on the key nucleotides identified in the
wild-type core promoter and the initiation cytidylate. In contrast,
changes between nucleotides
11 and +1 had a less severe effect on RNA
synthesis but resulted in RNA products initiated at alternative
locations in addition to the +1 cytidylate. The results suggest a
degree of flexibility in the recognition of the subgenomic promoter by
the BMV RdRp and are compared with functional regions in other DNA and
RNA promoters.
 |
INTRODUCTION |
Accurate and efficient RNA synthesis
during replication is a key feature of viral pathogenesis. Viral RNA
replication is mediated by RNA-dependent RNA polymerases (RdRps) which
direct synthesis from RNA templates without DNA intermediates. Unlike
the well-studied DNA-dependent polymerases (DdRps), the mechanism by
which RdRps direct RNA synthesis is only now being elucidated, and
little is known about how RdRps recognize RNA promoters. Discerning the mechanism by which RdRps interact with their cognate RNAs will allow a
comparison of the mechanisms of RNA synthesis by different polymerases
and contribute to understanding of the features of protein-RNA interaction.
Brome mosaic virus (BMV) is a model well suited to studies of the
mechanisms of RNA synthesis. BMV is a single-stranded, positive-sense RNA virus that belongs to the bromovirus group of plant viruses in the
alphavirus-like virus superfamily (10). The tripartite BMV
genome is composed of RNAs designated RNA1 (3.2 kb), RNA2 (2.8 kb), and
RNA3 (2.1 kb) (3). A subgenomic RNA4 (0.9 kb) is synthesized
during infection to direct translation of the viral capsid
(3). There are three classes of promoters found within the
BMV genome (Fig. 1). A tRNA-like
structure found on the 3' end of all positive-sense BMV RNAs directs
the synthesis of the complementary minus-strand RNA (5, 18,
21). A second promoter located at the 3' end of the newly
synthesized minus-strand RNA directs genomic plus-strand RNA synthesis
(22). The third, subgenomic promoter is located within the
minus-strand RNA3 (1, 17, 28). The BMV RdRp utilizes all
three distinct promoters in vitro, initiating RNA synthesis at the
nucleotides used in vivo (2, 13, 17, 31).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 1.
BMV RdRp utilizes three RNA promoters during RNA
replication. The viral RNA replication process is illustrated with BMV
RNA3. The replicase complex and the direction of RNA synthesis are
denoted by an oval and the enclosed arrow. Replication begins with
recognition of the minus [( )]-strand promoter (solid box) located
at the 3' tRNA-like (cloverleaf) end of the plus [(+)]-strand genomic
RNA. The newly synthesized, complementary minus-strand RNA is depicted
in black. Minus-strand RNA is then used as template for both
full-length, genomic plus-strand synthesis and subgenomic plus-strand
synthesis. The approximate location of the genomic plus-strand promoter
is indicated with a dashed box. The subgenomic promoter is located
internal to RNA3 and is responsible for RNA4 synthesis. The four
domains of the BMV subgenomic promoter characterized by Marsh et al.
(16) are illustrated as an expansion within the minus-strand
RNA. The nucleotides spanning each domain are listed as well.
|
|
The subgenomic promoter has been previously characterized as containing
four components: an upstream A-U rich sequence, a polyuridylate tract,
the core promoter, and the downstream A-U rich sequence (16)
(Fig. 1). Work from our lab has determined that only the core promoter
is required and sufficient for accurate and efficient synthesis of
runoff RNA products in vitro (1, 28). These RNAs are named
proscripts since they contain both promoter and template sequences.
Mutational analysis of the subgenomic core promoter revealed that four
essential nucleotides at positions
17,
14,
13, and
11 relative
to the initiation cytidylate (+1) are recognized by the RdRp in a
sequence-specific manner (28). The base moieties of these
key nucleotides and riboses responsible for RdRp recognition were
predicted by mutational analysis (28) and subsequently
identified by using RNAs containing chemically synthesized nucleotide
analogs (29).
The present investigation examines the spatial requirements in the BMV
core promoter. Insertions and deletions that perturb the spacing within
the nucleotides required for recognition by RdRp, and between the
required nucleotides and the initiation site, were engineered and
examined in a quantitative in vitro RNA synthesis assay. The results of
these assays give insights to the mechanisms by which the BMV RdRp
recognizes the subgenomic promoter.
 |
MATERIALS AND METHODS |
Synthesis of proscripts.
Oligonucleotides (Operon
Technologies Inc.) containing the sequence of the BMV subgenomic
promoter which contain various insertion or deletions were annealed to
a second partially complementary oligonucleotide containing the T7
promoter (5' TAATACGACTCACTATAGGATTATTAATACGCTG 3'). The
single-stranded portions of the annealed oligonucleotides were
extended by Taq polymerase and deoxynucleoside
triphosphates, creating double-stranded DNA products. RNA
proscripts used in RdRp assays were generated from the PCR products by
using T7 polymerase (Ampliscribe kit; Epicenter Technologies).
Proscript RNAs were purified from nucleoside triphosphates and proteins
from the T7 reaction by 20% denaturing polyacrylamide gel
electrophoresis (PAGE). RNAs were excised from the crushed gels, eluted
with 0.3 M ammonium acetate overnight, extracted with
phenol-chloroform, ethanol precipitated, and resuspended in water. RNAs
were quantified by spectrophotometry and visualized by toluidine blue
staining following denaturing PAGE.
RdRp activity assay and product analysis.
BMV RdRp was
prepared from infected barley as previously described (33).
Standard RdRp activity assays consisted of a 43-µl reaction mixture
containing 1 pmol of proscript template, 10 µl of BMV RdRp, 20 mM
sodium glutamate (pH 8.2), 4 mM MgCl2, 12 mM dithiothreitol, 0.5% Triton X-100, 2 mM MnCl2, 200 µM
ATP, 200 µM UTP, 500 µM GTP, and 242 nM [
-32P]CTP
(400 Ci/mmol, 10 mC/ml; Amersham). The addition of MnCl2 to
the reaction has been found to stimulate product synthesis but does not
affect the specificity of the BMV RdRp for its promoter (12a). After incubation for 90 min at 30°C, reactions were
terminated by phenol-chloroform extraction followed by ethanol
precipitation using 10 µg of glycogen and 0.4 M ammonium acetate.
Products were suspended in 1× denaturing loading buffer (45%
[vol/vol] deionized formamide, 1.5% [vol/vol] glycerol, 0.04%
[vol/vol] bromophenol blue, 0.04% [wt/vol] xylene cyanol), heated
for 3 min at 60°C, and separated by 20% denaturing (8 M urea) PAGE
(19:1 acrylamide-bisacrylamide gel). Gels were wrapped in plastic and
exposed to film at
80°C. RdRp products were quantified with a
PhosphorImager (Molecular Dynamics), and amounts of synthesis were
quantified relative to the wild-type (WT) proscript level. Each value
represents a mean of at least three independent experiments with at
least two replicates for each proscript. All trends observed per
experiment were consistent with those of independent assays.
 |
RESULTS |
Effects of nucleotide insertions and deletions within the core
promoter.
The correct positioning of the RdRp on the promoter is
important to establish efficient initiation of subgenomic RNA
synthesis. To facilitate analysis of the RdRp-promoter recognition, we
decided to treat the core promoter as four regions delineated by the
nucleotides recognized by RdRp:
17 to
14,
14 to
13,
13 to
11, and
11 to +1. Proscripts containing insertions and deletions
within each of the four regions were assayed for the synthesis of a
13-nucleotide (nt) RNA product. The first 11 nt in the product
correspond to the complement of the 5'-most sequence of the BMV
subgenomic RNA. The last two guanylates of the product allows for
incorporation of radiolabeled CTPs by the BMV RdRp.
The first region to be examined was between nt

17 and

14.
Insertions of an adenylate, cytidylate, or uridylate between nt

17
and

16 as well as insertions of two adenylates and the removal
of nt

16, were tested (Fig.
2A). The products
of the RdRp assay
were resolved on a gel as two bands of 13 and 14 nt
(Fig.
2B).
The 14-nt RNA is the result of a nontemplated nucleotide
addition
to the 13-nt product (
28). Terminal nucleotide
addition is an
activity of the RdRp preparation and is observed with
other polymerases
(
4,
20). A terminal nucleotide is also
inefficiently placed
on the input proscripts, as seen by the faint
bands running above
the major products. The amount of synthesis from
the WT proscript
was normalized to 100% (Fig.
2B, lanes 1 to 3).
Proscripts containing
either insertions of one or two nucleotides or
the deletion of
one nucleotide suffered severe reductions in the
efficiency of
synthesis in comparison to a WT subgenomic promoter (Fig.
2B,
lanes 4 to 18). However, all of the mutations between nt

17 and

14 gave rise to products of 13 and 14 nt, indicating that the
accuracy of the initiation was unaffected.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 2.
Nucleotide insertions and deletions within the 17/ 14
region. (A) Sequence of the WT subgenomic core promoter. The four
nucleotides required to interact with RdRp are in a larger font; the
initiation cytidylate is marked with an arrow pointed in the direction
of RNA synthesis. Proscripts are named for the changes from the WT
sequence. Nucleotides which are changed from WT are denoted in the gap
in the WT sequence between nt 17 and 16. The empty box denotes the
removal of nt 16. Nucleotides which are not changed from WT are not
shown. The RdRp products generated by each proscript and the values for
1 standard deviation from the mean are listed at the right. All values
represent at least three independent assays. The column on the left
provides the key for the lanes in the autoradiograph below. (B)
Autoradiograph of RdRp products synthesized from proscripts containing
insertions and deletions within the 17/ 14 region of the subgenomic
promoter analyzed by 20% denaturing PAGE. Terminal nucleotide addition
to the input proscript is denoted with an asterisk. Three independent
reactions are shown for each proscript. The positions of the 14- and
13-nt products are indicated on the left. Here and in Fig. 3 and 4,
lanes represent products of control reactions without added
templates.
|
|
The spatial requirements between nt

14 and

13 and nt

13 and

11
were examined next. A summary of the data along with the
sequences and
activities of the proscripts relative to WT is shown
in Table
1. Insertions of an adenylate or a
uridylate within
the

14/

13 region reduced RNA synthesis to less
than 25% of the
WT level. Insertions of two adenylates further
decreased synthesis
in comparison with the insertion of one adenylate.
Proscripts
containing single insertions and deletions within the

13/

11
region retained 10 to 40% of WT activity. Again, the
insertions
of two nucleotides within this region had a more detrimental
effect
(11 and 15% of WT activity) than the insertion of one
nucleotide
(36 and 41% of WT activity). These results are similar to
those
from changes within the

17/

14 region in regard to the
qualitative
effect on RNA synthesis. Furthermore, even though
insertions and
deletions in either the

14/

13 or

13/

11 region
reduced RNA
synthesis, all products synthesized were 13 and 14 nt in
length,
reflecting that RNA synthesis initiated at the authentic +1
cytidylate.
The
13/
11 region.
The observation that single nucleotide
insertions within the
13/
11 region retained a moderate level of
activity suggests two possibilities by which synthesis is maintained:
(i) despite the insertions, RdRp maintains some recognition with the
original
13 cytidylate and
11 guanylate residues. (ii) RdRp
recognizes the presence of nucleotides at the correct spatial positions
despite the changes in identities of these nucleotides. The latter
possibility is less likely since substitutions at the key contact sites
resulted in little or no RNA synthesis (28). To address
these two possibilities, proscripts containing an insertion of a
uridylate between positions
13 and
12 (U-INS
13/
12) were
engineered to contain a second change at either nt
13 or nt
11
(Fig. 3A). The proscripts were subsequently assayed for the relative ability to direct RNA synthesis. Proscript U-INS
13/
12 showed 41% of WT activity (Fig. 3B, lanes 3 and 4). An additional change of the authentic
11 guanylate to a
cytidylate resulted in 7% relative RNA synthesis (lanes 5 and 6). This
level of synthesis is similar to a proscript which has only a
11
guanylate-to-adenylate substitution (lanes 9 and 10). Proscript U-INS
13/12, with a transversion of the authentic
13 cytidylate to a
cytidylate, reduced RNA synthesis to 2% (lanes 7 and 8). Taken
together, the data suggest that RdRp maintains recognition of the
13
cytidylate as well as of the
11 guanylate even in proscripts with
single nucleotide insertions between positions
13 and
12. The
moderate levels of activity displayed by these proscripts in comparison
to WT may be a result of difficulty in maintaining recognition in the
presence of a nucleotide insertion.

View larger version (79K):
[in this window]
[in a new window]
|
FIG. 3.
RdRp recognition of key nucleotides is required even in
the presence of a nucleotide insertion. (A) The sequence of the WT
proscript is presented as described in the legend to Fig. 2A. The
identities of the insertions between nt 13 and 12 are shown in the
area below the gap in the WT sequence. Additional changes at specific
positions are indicated by the letters in the dashed lines. (B)
Autoradiograph of RdRp products synthesized from proscripts containing
insertions and substitutions within the 13/ 11 region of the
subgenomic promoter analyzed by 20% denaturing PAGE. Duplicate
independent reactions are shown. Positions of the 14- and 13-nt
products are indicated on the left.
|
|
A similar mechanism would explain the activity of proscripts with
single nucleotide insertions within the region between nt

17 and

14
(Table
1). In this case, the 10% activity observed
with proscripts
A-INS

17/

16 and C-INS

17/

16 may be due to
RdRp retaining a
limited recognition of the

17 guanylate. To
test this hypothesis,
proscript A-INS

17/

16, which also changed
the

17 guanylate to an
uridylate, was assayed. It resulted in
a decrease in RNA synthesis to
1% activity (Table
1), further
suggesting that RdRp maintains some
recognition with the

17 guanylate
within the single insertion
proscripts.
Insertions and deletions within nt
11 to +1.
Over a dozen
mutant proscripts were engineered to examine the spatial requirements
for the large region between the nt
11 and +1. Single or multiple
insertions or deletions positioned along the length of the sequence
between nt
11 and +1 were assayed (Table
2). In contrast to results from the
17/
14,
14/
13, and
13/12 regions, changes between nt
11 and
+1 had generally less severe effects on the efficiency of RNA synthesis
(Fig. 4A; Table 2). Constructs with
insertions and deletions of one nucleotide between
11 and +1 all
retained more than 40% of WT activity. In contrast to results from
region between
17 and
11, insertion of two nucleotides between
11
and +1 all retained more than 15% of WT activity. In fact, a proscript
that contained an insertion of four uridylates between nt
4 and
3
(Fig. 4, lanes 15 and 16) retained 26% of WT activity. The most severe
perturbation within this region was a deletion of nt
4 and
3, which
resulted in only 5% of WT activity (Table 2; Fig. 4B, lanes 11 and
12). This mutation may be more severe in comparison to other multiple deletions within the
11/+1 region due to the removal of the
4 residue, a change that had a moderate affect on RNA synthesis (28). While changes between
11 and +1 had only moderate
effects on the efficiency of RNA synthesis, products of anomalous size were observed with several of the mutant proscripts (Fig. 4B, lanes 7, 8, 15, and 16). These products may be the result of initiation of RNA
synthesis from sites other than the authentic cytidylate.

View larger version (80K):
[in this window]
[in a new window]
|
FIG. 4.
Nucleotide insertions and deletions within the 11/+1
region. (A) The sequence of the WT proscript is presented as described
in the legend to Fig. 2A. Changes from the WT sequence between nt 4
and 3 are illustrated in the area below the gap in the sequence. An
empty box indicate that a nucleotide has been deleted. The RdRp
products generated by each proscript and the values for 1 standard
deviation from the mean are listed on the right. All values represent
at least six independent assays. Quantified values in reactions with
multiple products represent the sum of all products made. (B)
Autoradiograph of RdRp products synthesized from proscripts containing
insertions and deletions within the 11/+1 region of the subgenomic
promoter. Duplicate independent reactions are shown, and positions of
the 14- and 13-nt products are indicated on the left. Anomalous-size
products are clearly visible as bands of greater than 14 nt in lanes 7, 8, 15, and 16.
|
|
Insertions and deletions between
11 and +1 alter initiation
specificity.
Initiation of subgenomic BMV RNA synthesis takes
place at the complement of the cytidylate at nt 1242 in plus-strand RNA
3 both in vivo and in vitro. The potential misinitiation of RNA synthesis is of interest since it could reveal the mechanisms underlying promoter recognition and initiation during RNA synthesis. Therefore, a more careful examination of the products from proscripts DEL
8,
7 and AA-INS
4/
3 was undertaken, since both of these proscripts produced RNAs that deviated from the expected sizes of 14 and 13 nt. The most abundant products of proscript DEL
8,
7 are 11 and 12 nt, in length as determined by comparison to RdRp products of
corresponding sizes (data not shown), and were present at a combined
15% of WT activity; DEL
8,
7 also synthesized the 14/13-nt products
at 8% of the WT level, presumably by initiating synthesis from the
authentic cytidylate (Fig. 5, lanes 3 and
4). The 12/11-nt products most likely initiated at the +3 uridylate. Previous work has shown that RdRp is able to initiate RNA synthesis from a cytidylate moved one position away from the initiation cytidylate and inefficiently from a uridylate residue (28). To examine the initiation nucleotide used to generate the 12/11-nt products, a DEL
8,
7 proscript which also contains a change of the +3
uridylate to a cytidylate was constructed with the rationale that a
change to a preferred initiation cytidylate would increase the
synthesis of the 12/11-nt product. Indeed, proscript DEL
8,
7, U+3/C synthesized the 12/11-nt product at 117% of the
level from the WT proscript, an approximately 10-fold increase from DEL
8,
7 proscript (Fig. 5B, lanes 5 and 6; Fig. 5C). In addition, DEL
8,
7 with a substitution of the +4 adenylate to a potential initiation cytidylate may direct synthesis of a 11/10-nt product (Fig.
5B, lanes 7 and 8). A 10-nt product unique to this proscript was
clearly observed (Fig. 5B, arrow), but the 11-nt product was obscured
by comigration with the product that likely initiated at the +3
position.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 5.
Nucleotide insertions and deletions within the 11/+1
region can alter the site for initiation. (A) The sequence of the WT
proscript is presented as described in the legend to Fig. 2A.
Nucleotides inserted in mutant proscripts are denoted in the gap in the
WT sequence. Empty boxes denote deletions of specific nucleotides.
Changes of nucleotides in the template sequence are indicated by
letters at the ends of the dashed lines. (B) Autoradiograph of RdRp
products synthesized from proscripts containing insertions and
deletions within the 11/+1 region of the subgenomic promoter.
Duplicate independent reactions are shown, and the sizes of the
products are indicated on the left. The arrow points to a 10-nt product
visible in lanes 7 and 8. Lane 8 is marked with an asterisk because the
level of products in this lane is lower due to loss of sample during
the assay. (C) Quantitation of the 13/14-nt, 11/12-nt, and 15/16-nt
products initiated from nt +1, +3, and 2. Products are quantitated
relative to synthesis from WT. The column on the right represents the
value of the total amount of all products synthesized. Values for 1 standard deviation from the mean are listed and represent at least
three independent assays.
|
|
Proscript AA-INS

4/

3, containing insertions of two nucleotides
within the

11/+1 region, predominantly produced 14/13-nt
RNAs which
likely initiated from the authentic cytidylate. In
addition, products
of 16 or 15 nt were also observed at 10% of
the WT level (Fig.
5B,
lanes 9 and 10). The 16/15-nt products
were likely generated by
initiation at the cytidylate at the authentic
nt

2. To test this
hypothesis, proscript AA-INS

4/

3 was modified
to contain a
guanylate at either the

2 or +1 cytidylate position.
A guanylate
present at position +1 had been previously demonstrated
to decrease RNA
synthesis to 4% (
28). Proscript AA-INS

4/

3,
with a
guanylate at the

2 position, abolished synthesis of the
16/15-nt
products, demonstrating that the 16/15-nt products were
the result of
inefficient initiation taking place at the original

2 position (Fig.
5B, lanes 11 and 12). Furthermore, preventing
initiation from the

2
position increased synthesis of the 14/13-nt
products from 60 to 150%
of the WT level. Proscript AA-INS

4/

3,
which also has the authentic
+1 cytidylate changed to a guanylate,
reduced synthesis of the
correctly initiated 14/13-nt product
from 60 to 2% while reducing
synthesis of the 16/15-nt product
from 10 to 2% (Fig.
5C). The
reduction of the amount of the 16/15-nt
product may be due to a
guanylate being present at both the +2
and +3 positions relative to the
initiation of the 16/15-nt product
(
2).
 |
DISCUSSION |
Using the BMV RdRp as a model system, we are attempting to
elucidate the mechanism of RNA synthesis by RdRp (2, 13,
33-35), including how RdRp recognizes the viral RNA promoters.
The short length (<33 nt) of the subgenomic promoter required for
specific and accurate initiation of RNA synthesis in vitro allows easy manipulation of the BMV subgenomic promoter for biochemical analyses (1, 28). Previous work demonstrated that the BMV RdRp
recognizes the subgenomic core promoter in a sequence-specific manner
(28). Moieties in the nucleotide bases and in the riboses
required for efficient RNA synthesis have also been recently identified
(29). In this work, we used proscripts which are affected in
the normal spacing of the key nucleotides recognized by RdRp to
elucidate the requirements of RdRp-RNA promoter interaction. We have
determined that spacing in the regions spanning nt
17 to
13 are
important for efficient RNA synthesis by RdRp, while nt
11 to +1 are
less important for directing efficient RNA synthesis but can affect the
selection of the initiation site. This and previous work suggest that
the BMV subgenomic core promoter can be functionally divided into three
domains: the specificity domain which is presumed to be contacted by
the RdRp, a spacer sequence which is more tolerant of changes in
nucleotide identity and length, and the initiation site (Fig.
6A). These three functional domains will
be discussed in turn along with comparisons to the T7 DNA promoter and
the influenza virus RNA promoter.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
Schematics summarizing features in DNA and RNA
promoters. (A) The BMV subgenomic core promoter and initiation site.
Nucleotides required for recognition by the BMV RdRp are boxed; the
base moieties important for the recognition by RdRp (28) are
shown above and below the boxes. The arrow denotes the initiation
nucleotide. (B) Consensus promoter recognized by the T7 RNA polymerase
(24) and the influenza virus promoter for minus-strand RNA
synthesis (6). The nucleotides important for polymerase
specificity are boxed, and the nucleotides determined to be contacted
by the respective polymerases are in boldface. An arrow is placed over
the initiation nucleotide to denote the direction of RNA synthesis.
|
|
Specificity determinants.
Nucleotides
17 and
11 of the BMV
subgenomic promoter contains the domain which confers specific binding
by RdRp. Nucleotide substitutions and changes in the relative spatial
distances within this region will severely decrease RNA synthesis
without affecting the site of RNA initiation (Table 1). In template
competition assays for RdRp-RNA binding, substitutions at positions
17,
14,
13, and
11 abolished binding to RdRp (29).
For recognition by the influenza virus RdRp, key specificity
nucleotides include
9,
10, and
11 relative to the initiation site
at the 3' end of the viral minus strand (6, 26) (Fig. 6B).
However, the 5' end of the influenza virus RNA is needed to interact
with this region to form a double-stranded region recognized by the
influenza virus RdRp (7, 36). Changes in the nucleotides
important for the influenza virus promoter all resulted in severe
reductions in RNA synthesis (7, 36). The best-characterized
specificity region are bp
10 to
12 of the consensus T7 and T3 DNA
promoters (11, 14, 24, 25). Changes of one or more of these
base pairs may abolish its use by the homologous polymerase and also confer recognition by the heterologous polymerase (14, 23, 26).
Spacer.
The sequence between nt
10 and
2 may represent a
molecular spacer needed to maintain an optimal distance between the
specificity and initiation regions. Sequences within the spacer affect
interaction with RdRp, as evidenced by the observation that some
nucleotide substitutions in this region decreased RNA synthesis,
although the effects were less severe than those in the specificity
region (Table 2 and reference 28). Perhaps the most
intriguing result with the putative spacer region is that insertions
and deletions in this region, but not in the specificity region, will
affect the choice of the initiation site by RdRp.
The spacer region may need to adapt conformations acceptable to the
polymerase. The 17-nt spacer sequence in the
Escherichia coli sigma 70 promoter which lies between the

35 and

10
specificity
domains has been demonstrated to not specifically bind the
E. coli holoenzyme in DNA footprinting (
27). Also
an acceptable
B-form DNA structure in this spacer must be maintained or
else
polymerase-promoter interaction would be adversely affected
(
31,
37). In the corresponding domain of the T7 promoter,
insertion
of flexible polyanionic spacers in place of nucleotide
positions

2 or

4 had little detrimental effect on the fidelity or
overall
amount of RNA synthesis. However, replacing the

1 nt with a
polyanionic
spacer or an abasic residue increased the frequency of
products
initiated from the +2 nt (
38).
The role of local RNA structure in the RNA promoters remains to be
determined experimentally. However, in both the BMV and
influenza virus
RNA promoters, insertions and deletions in the
putative spacer region
had similar effects. One or two nucleotide
insertions only weakly
inhibited influenza virus RNA synthesis
in vitro, while a deletion of
one nucleotide or the insertion
of three or more nucleotides in the
influenza virus promoter caused
significant decrease in RNA synthesis
(
26). Nucleotides

8 to

3 of the influenza virus promoter
and nt

10 to

1 of the BMV
subgenomic core promoter may be present
to keep the proper distance
between the specificity and
initiation.
Initiation site.
In addition to the specificity domain in the
BMV core promoter, the initiation site spanning nucleotides
1 to +2
is another domain specifically recognized by RdRp (Fig. 6)
(29). We speculated that the recognition of the initiation
site by the BMV RdRp requires a trimolecular interaction between RdRp,
the template RNA, and the primer nucleotide, GTP. The base pairing
between the initiation template nucleotide and the GTP may be
responsible for enhancing the stability of RdRp-RNA interaction. The +2
nucleotide, usually an adenylate in the promoters directing plus-strand
RNA synthesis, is required for efficient initiation of RNA synthesis
(2). The requirement for an appropriate initiation and +2
nucleotide may explain the preference for the authentic initiation site
of the subgenomic promoter over other cytidylates which may act as the
initiation site (Fig. 5).
Flexibility in RdRp recognition sites.
An unexpected result
from this work is that RdRp interaction with the preferred recognition
nucleotides in the subgenomic core promoter can take place even when
the spacing between the nucleotides is altered. In contrast,
observations from analyses of the T7 and T3 DdRps indicate that changes
in the specificity domain will abolish recognition by the homologous
polymerase (14, 24). Our data suggest that RdRp has the
ability to adjust its RNA binding in a manner analogous to having
independent suspension in the wheels of an all-terrain automobile. This
flexibility is demonstrated in two sets of changes in the specificity
domain. (i) In the presence of an insertion between
17 and
16, the
contact between RdRp and the
17 guanylate occurs, resulting in
approximately 10% synthesis (Fig. 2). Mutation of the authentic
17
guanylate in the presence of the insertion will abolish RNA synthesis
(Table 1). (ii) The recognition between RdRp and key nt
13 and
11 is required in the presence of an insertion, resulting in RNA synthesis
at approximately 40% of the WT promoter level. Changes of the
11
cytidylate and the
13 guanylate to their Watson-Crick transversions
in addition to the insertion will drastically decrease RNA synthesis,
demonstrating that sequences required in the context of the WT spacing
are also required in the presence of an insertion.
A third demonstration of flexibility in RdRp may be the selection of
the initiation sites when the length of the spacer has
been altered.
Deletions of nt

8 and

7 and double insertions
between nt

4 and

3 preferentially retained the use of the authentic
initiation site
(Fig.
5). This result is consistent with our previous
observation that
RdRp could use a cytidylate as the initiation
nucleotide when it was
one nucleotide to either side of the authentic
position
(
28). In this case, it is difficult to rule out the
possibility that the length of the spacer allows the RNA to alter
its
conformation rather than induce an adjustment by the RdRp.
It is also
possible that both RdRp and the RNA must adjust to
each other during
their initial recognition. Examples of similar
changes in protein-RNA
interaction (generally called induced fit)
have recently been reviewed
by Frankel and Smith (
8). Similar
interpretations for the
flexibility of the influenza virus RdRp
can be made from the mutations
in the spacer of the influenza
virus promoter (
26).
The ability of RdRp to adjust to the required recognition sites
provides a testable hypothesis for how one enzyme complex
can direct
RNA synthesis from all three classes of RNA promoters
found in the BMV
genome BMV RNAs (Fig.
1). The three BMV promoters
are very different in
sequence and predicted RNA secondary structures,
with no obvious
features in common except that the initiation
nucleotide is always a
cytidylate. We hypothesize that RdRp recognition
of the core promoter
takes place through only a few nucleotides
placed at acceptable spatial
positions. This flexible RdRp is
then able to adjust its promoter
contact sites or alter the local
structure of the promoter as dictated
by key nucleotides in the
promoter. Alternatively, this mode of
RdRp-promoter interaction
would permit species-specific RNA synthesis
while allowing the
individual sequences to gain, through evolutionary
selection,
other features desirable for viral infection such as RNA
stability
and efficiency of translation. We note that this model does
not
preclude the contributions of the local RNA structure which may
exist in this region. However, previous results from our lab indicates
that the primary mode of recognition of the core promoter in vitro
is
through a sequence-specific mechanism (
28,
29).
In addition to similarities in the promoters recognized by DdRps and
RdRps, evidence is also rapidly accumulating on the similarities
in
other processes of RNA synthesis, including the recent realizations
that RNA syntheses by DdRp and by RdRps both go through a highly
ordered and parallel series of steps (reference
2
and references
therein) and that host factors associated with viral RNA
replication
are functionally analogous to the factors which direct
basal and
activated eukaryotic transcription (
15). Recent
work by Siegel
et al. (
29a) suggests that RdRp has at least
two RNA binding
domains. This finding is consistent with the current
models for
DdRps where both upstream and downstream template binding
sites
have been demonstrated (
9,
19). Other similarities of
the
different polymerases, including the overall similar in tertiary
structure and mechanism of nucleotidyl transfer, have been recently
emphasized by Steitz (
32) and Joyce (
12). These
developments
suggest that future studies in viral RNA replication would
directly
benefit from the lessons learned from the better-characterized
polymerases.
 |
ACKNOWLEDGMENTS |
We thank members of the IU Cereal Killer group for helpful
discussions during the course of this work, especially Scott Adkins and
Matt Chapman for editing the manuscript.
Funding was provided by U.S. Department of Agriculture grant 9702126. Scott Stevenson Stawicki also acknowledges support from a plant biology
Floyd summer fellowship.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Biology, Indiana University, Jordan Hall, Bloomington, IN 47405. Phone: (812) 855-7959. Fax: (812) 855-6705. E-mail:
ckao{at}sunflower.bio.indiana.edu.
 |
REFERENCES |
| 1.
|
Adkins, S.,
R. W. Siegel,
J. H. Sun, and C. C. Kao.
1997.
Minimal templates directing accurate initiation of subgenomic RNA synthesis in vitro by the brome mosaic virus RNA-dependent RNA polymerase.
RNA
3:634-647[Abstract].
|
| 2.
|
Adkins, S.,
S. S. Stawicki,
G. Faurote,
R. Siegel, and C. C. Kao.
1998.
Mechanistic analysis of RNA synthesis by RNA-dependent RNA polymerase from two promoters reveals similarities to DNA-dependent RNA polymerases.
RNA
4:455-470[Abstract].
|
| 3.
|
Ahlquist, P.
1992.
Bromovirus RNA replication and transcription.
Curr. Opin. Genet. Dev.
2:271-276.
|
| 4.
|
Bausch, J.,
F. Kramer,
E. Miale,
C. Dobkin, and D. Mills.
1983.
Terminal adenylation in the synthesis of RNA by Q replicase.
J. Biol. Chem.
258:1978-1984[Abstract/Free Full Text].
|
| 5.
|
Dreher, T. W., and T. C. Hall.
1988.
Mutational analysis of the sequence and structural requirements in brome mosaic virus RNA for minus strand promoter activity.
J. Mol. Biol.
201:31-40[Medline].
|
| 6.
|
Fodor, E.,
B. L. Seong, and G. G. Brownlee.
1993.
Photochemical crosslinking of influenza A polymerase to its virion RNA promoter defines a polymerase binding site at residues 9 to 12 of the promoter.
J. Gen. Virol.
74:1327-1333[Abstract/Free Full Text].
|
| 7.
|
Fodor, E.,
D. C. Pritlove, and G. G. Brownlee.
1995.
Characterization of the RNA-fork model of virion RNA in the initiation of transcription in influenza A virus.
J. Virol.
69:4012-4019[Abstract].
|
| 8.
|
Frankel, A., and A. Smith.
1998.
Induced folding in RNA-protein recognition: more than a simple molecular handshake.
Cell
92:149-151[Medline].
|
| 9.
|
Gelles, J., and R. Landick.
1998.
RNA polymerase as a molecular motor.
Cell
93:13-16[Medline].
|
| 10.
|
Goldbach, R.,
O. LeGall, and J. Wellink.
1991.
Alpha-like viruses in plants.
Semin. Virol.
2:19-25.
|
| 11.
|
Ikeda, R.,
L. L. Chang, and G. S. Warshamana.
1993.
Selection and characterization of a mutant T7 RNA polymerase that recognizes an expanded range of T7 promoter-like sequences.
Biochemistry
32:9115-9124[Medline].
|
| 12.
|
Joyce, C. M.
1997.
Choosing the right sugar: how polymerases select a nucleotide substrate.
Proc. Natl. Acad. Sci. USA
94:1619-1622[Free Full Text].
|
| 12a.
| Kao, C. C. Unpublished data.
|
| 13.
|
Kao, C. C., and J. H. Sun.
1996.
Initiation of minus-strand RNA synthesis by the brome mosaic virus RNA-dependent RNA polymerase: use of oligoribonucleotide primers.
J. Virol.
70:6826-6830[Abstract/Free Full Text].
|
| 14.
|
Klement, J. F.,
M. B. Moorefield,
E. Jorgensen,
J. E. Brown,
S. Risman, and W. T. McAllister.
1990.
Discrimination between bacteriophage T3 and T7 promoters by the T3 and T7 RNA polymerases depend primarily upon a three base-pair region located 10-12 base-pairs upstream from the start site.
J. Mol. Biol.
215:21-29[Medline].
|
| 15.
|
Lai, M. M.
1998.
Cellular factors in the transcription and replication of viral RNA genomes. A parallel to DNA-dependent RNA transcription.
Virology
244:1-12[Medline].
|
| 16.
|
Marsh, L. E.,
T. W. Dreher, and T. C. Hall.
1988.
Mutational analysis of the core and modulator sequences of the BMV RNA3 subgenomic promoter.
Nucleic Acids Res.
16:981-995[Abstract/Free Full Text].
|
| 17.
|
Miller, W. A.,
T. W. Dreher, and T. C. Hall.
1985.
Synthesis of brome mosaic virus subgenomic RNA in vitro by internal initiation on ( )-sense genomic RNA.
Nature
313:68-70[Medline].
|
| 18.
|
Miller, W. A.,
J. J. Bujarski,
T. W. Dreher, and T. C. Hall.
1986.
Minus-strand initiation by brome mosaic virus replicase within the 3' tRNA-like structure of native and modified RNA templates.
J. Mol. Biol.
187:537-546[Medline].
|
| 19.
|
Nudler, E.,
E. Avetissova,
V. Markovtsov, and A. Goldfarb.
1996.
Transcription processivity: protein-DNA interaction holding together the elongation complex.
Science
273:211-214[Abstract].
|
| 20.
|
Nuefeld, K.,
J. Galarza,
O. Richards,
D. Summers, and E. Ehrenfeld.
1994.
Identification of terminal adenyl transferase activity of the poliovirus polymerase 3Dpol.
J. Virol.
68:5811-5818[Abstract/Free Full Text].
|
| 21.
|
Perret, V.,
C. Florentz,
T. Dreher, and R. Giege.
1989.
Structural analogies between the 3' tRNA-like structure of the brome mosaic virus RNA and yeast tRNAtyr revealed by protection studies with yeast tyrosyl tRNA synthase.
Eur. J. Biochem.
185:331-339[Medline].
|
| 22.
|
Pogue, G., and T. Hall.
1992.
The requirement for a 5' stem-loop structure in the brome mosaic virus replication supports a new model for viral positive-strand RNA synthesis.
J. Virol.
66:674-684[Abstract/Free Full Text].
|
| 23.
|
Raskin, C. A.,
G. Diaz,
K. Joho, and W. T. McAllister.
1992.
Substitution of a single bacteriophage T3 residue in bacteriophage T7 RNA polymerase at position 748 results in a switch in promoter specificity.
J. Mol. Biol.
228:506-515[Medline].
|
| 24.
|
Schick, C., and C. T. Martin.
1993.
Identification of specific contacts in T3 RNA polymerase-promoter interactions: kinetic analysis using small synthetic promoters.
Biochemistry
32:4275-4280[Medline].
|
| 25.
|
Schick, C., and C. T. Martin.
1995.
Tests of a model of specific contacts in T7 RNA polymerase-promoter interactions.
Biochemistry
34:666-672[Medline].
|
| 26.
|
Seong, B. L., and G. G. Brownlee.
1992.
Nucleotides 9 to 11 of the influenza A virion RNA promoter are crucial for activity in vitro.
J. Gen. Virol.
73:3115-3124[Abstract/Free Full Text].
|
| 27.
|
Siebenlist, U.,
R. B. Simpson, and W. Gilbert.
1980.
E. coli RNA polymerase interacts homologously with two different promoters.
Cell
20:269-281[Medline].
|
| 28.
|
Siegel, R. W.,
S. Adkins, and C. C. Kao.
1997.
Sequence-specific recognition of a subgenomic promoter by a viral RNA polymerase.
Proc. Natl. Acad. Sci. USA
94:11238-11243[Abstract/Free Full Text].
|
| 29.
|
Siegel, R. W.,
L. Bellon,
L. Beigelman, and C. C. Kao.
1998.
Moieties in an RNA promoter specifically recognized by a viral RNA-dependent RNA polymerase.
Proc. Natl. Acad. Sci. USA
95:11613-11618[Abstract/Free Full Text].
|
| 29a.
| Siegel, R. W., et al. Unpublished data.
|
| 30.
| Sivakumaran, K., and C. C. Kao. Unpublished
data.
|
| 31.
|
Stefano, J. E., and J. D. Gralla.
1982.
Spacer mutations in the lacPs promoter.
Proc. Natl. Acad. Sci. USA
79:1069-1072[Abstract/Free Full Text].
|
| 32.
|
Steitz, T.
1998.
A mechanism for all polymerases.
Nature
391:231-232[Medline].
|
| 33.
|
Sun, J. H.,
S. Adkins,
G. Faurote, and C. C. Kao.
1996.
Initiation of ( )-strand RNA synthesis catalyzed by the BMV RNA-dependent RNA polymerase: synthesis of oligoribonucleotides.
Virology
225:1-12[Medline].
|
| 34.
|
Sun, J. H., and C. C. Kao.
1997a.
RNA synthesis by the brome mosaic virus RNA-dependent RNA polymerase: transition from initiation to elongation.
Virology
233:63-73[Medline].
|
| 35.
|
Sun, J. H., and C. C. Kao.
1997b.
Characterization of RNA products associated with or aborted by a viral RNA-dependent RNA polymerase.
Virology
236:348-353[Medline].
|
| 36.
|
Tiley, L. S.,
M. Hagan,
J. T. Mathews, and M. Krystal.
1994.
Sequence specific binding of the influenza RNA polymerase to sequences located at the 5' end of the viral RNAs.
J. Virol.
68:5108-5116[Abstract/Free Full Text].
|
| 37.
|
Warner, S., and P. L. DeHaseth.
1993.
Promoter recognition by Escherichia coli RNA polymerase. Effects of single basepair deletions and insertions in the spacer DNA separating the 10 and 35 region are dependent on spacer DNA sequence.
Biochemistry
32:6134-6140[Medline].
|
| 38.
|
Weston, B. F.,
I. Kuzmine, and C. T. Martin.
1997.
Position of the start site of initiation of transcription by bacteriophage T7 RNA polymerase.
J. Mol. Biol.
272:21-30[Medline].
|
Journal of Virology, January 1999, p. 198-204, Vol. 73, No. 1
0022-538X/99/$04.00+0
Copyright © 1999, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Hu, B., Pillai-Nair, N., Hemenway, C.
(2007). Long-distance RNA-RNA interactions between terminal elements and the same subset of internal elements on the potato virus X genome mediate minus- and plus-strand RNA synthesis. RNA
13: 267-280
[Abstract]
[Full Text]
-
Wierzchoslawski, R., Urbanowicz, A., Dzianott, A., Figlerowicz, M., Bujarski, J. J.
(2006). Characterization of a Novel 5' Subgenomic RNA3a Derived from RNA3 of Brome Mosaic Bromovirus. J. Virol.
80: 12357-12366
[Abstract]
[Full Text]
-
Pasternak, A. O., Spaan, W. J. M., Snijder, E. J.
(2006). Nidovirus transcription: how to make sense...?. J. Gen. Virol.
87: 1403-1421
[Abstract]
[Full Text]
-
Grdzelishvili, V. Z., Garcia-Ruiz, H., Watanabe, T., Ahlquist, P.
(2005). Mutual Interference between Genomic RNA Replication and Subgenomic mRNA Transcription in Brome Mosaic Virus. J. Virol.
79: 1438-1451
[Abstract]
[Full Text]
-
McCormack, J. C., Simon, A. E.
(2004). Biased Hypermutagenesis Associated with Mutations in an Untranslated Hairpin of an RNA Virus. J. Virol.
78: 7813-7817
[Abstract]
[Full Text]
-
Ayllon, M. A., Gowda, S., Satyanarayana, T., Karasev, A. V., Adkins, S., Mawassi, M., Guerri, J., Moreno, P., Dawson, W. O.
(2003). Effects of Modification of the Transcription Initiation Site Context on Citrus Tristeza Virus Subgenomic RNA Synthesis. J. Virol.
77: 9232-9243
[Abstract]
[Full Text]
-
Ranjith-Kumar, C. T., Zhang, X., Kao, C. C.
(2003). Enhancer-Like Activity of a Brome Mosaic Virus RNA Promoter. J. Virol.
77: 1830-1839
[Abstract]
[Full Text]
-
Tayon, R. Jr, Kim, M.-J., Kao, C. C.
(2001). Completion of RNA synthesis by viral RNA replicases. Nucleic Acids Res
29: 3576-3582
[Abstract]
[Full Text]
-
Chen, M.-H., Roossinck, M. J., Kao, C. C.
(2000). Efficient and Specific Initiation of Subgenomic RNA Synthesis by Cucumber Mosaic Virus Replicase In Vitro Requires an Upstream RNA Stem-Loop. J. Virol.
74: 11201-11209
[Abstract]
[Full Text]
-
Sivakumaran, K., Bao, Y., Roossinck, M. J., Kao, C. C.
(2000). Recognition of the Core RNA Promoter for Minus-Strand RNA Synthesis by the Replicases of Brome Mosaic Virus and Cucumber Mosaic Virus. J. Virol.
74: 10323-10331
[Abstract]
[Full Text]
-
Sivakumaran, K., Kao, C. C.
(1999). Initiation of Genomic Plus-Strand RNA Synthesis from DNA and RNA Templates by a Viral RNA-Dependent RNA Polymerase. J. Virol.
73: 6415-6423
[Abstract]
[Full Text]