Previous Article | Next Article 
Journal of Virology, September 1998, p. 7494-7500, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Shortening of the Symptom-Free Period in Rhesus
Macaques Is Associated with Decreasing Nonsynonymous Variation in the
env Variable Regions of Simian Immunodeficiency Virus
SIVsm during Passage
P. J. Spencer
Valli,1,*
Vladimir V.
Lukashov,1
Jonathan L.
Heeney,2 and
Jaap
Goudsmit1
Department of Human Retrovirology, Academic
Medical Centre, Amsterdam,1 and
Biomedical
Primate Research Centre, Rijswijk,2 The
Netherlands
Received 2 February 1998/Accepted 4 June 1998
 |
ABSTRACT |
During six blood passages of simian immunodeficiency virus SIVsm in
rhesus macaques, the asymptomatic period shortened from 18 months to 1 month. To study SIVsm envelope gene (env) evolution during
passage in rhesus macaques, the C1 to CD4 binding regions of multiple
clones were sequenced at seroconversion and again at death. The
env variation found during adaptation was almost completely
confined to the variable regions. Intrasample sequence variation among
clones at seroconversion was lower than the variation among clones at
death. Intrasample variation among clones from a single time point as
well as intersample variation decreased during the passage. In the
variable regions, the mean number of intrasample nonsynonymous
nucleotide substitutions decreased from the first passage (5.26 × 10
2 ± 0.6 × 10
2 per site) to the
fifth passage (2.24 × 10
2 ± 0.4 × 10
2 per site), whereas in the constant regions, the mean
number of intrasample nonsynonymous nucleotide substitutions differed
less between the first and fifth passages (1.14 × 10
2 ± 0.27 × 10
2 and 0.80 × 10
2 ± 0.24 × 10
2 per site).
Shortening of the asymptomatic period coincided with a rise in the
Ks/Ka ratio (ratio between the number of synonymous [Ks] and the number of nonsynonymous [Ka]
substitutions) from 1.080 in passage one to 1.428 in passage five and
mimicked the difference seen in the intrahost evolution between
asymptomatic and fast-progressing individuals infected with human
immunodeficiency virus type 1. The distribution of nonsynonymous
substitutions was biphasic, with most of the adaptation of
env variable regions occurring in the first three passages.
This phase, in which the symptom-free period fell to 4 months, was
followed by a plateau phase of apparently reduced adaptation. Analysis
of codon usage revealed decreased codon redundancy in the variable
regions. Overall, the results suggested a biphasic pattern of
adaptation and evolution, with extremely rapid selection in the first
three passages followed by an equilibrium or stabilization of the
variation between env clones at different time points in
passages four to six.
 |
INTRODUCTION |
The discovery of lymphomas in
macaques previously housed with sooty mangabeys or African green
monkeys (7, 16, 18, 22) led to the isolation of the first
simian immunodeficiency virus (SIV) isolates and characterization of
the wasting diseases that they caused in macaques. Later, it was found
that African feral monkeys were commonly SIV infected (22%) (14,
24, 30) and that SIV infection was endemic in sooty mangabeys
housed at some centers. At the Tulane Regional Primate Research Center, tissue-derived inoculum from a sooty mangabey was used to inoculate several macaques intravenously; one died of a wasting syndrome 18 months later (rhesus macaque B670) (7). The transmission of
this mangabey virus (SIVsm) to Asian macaques resulted in an infection
characterized by a loss of CD4+ T cells, persistent serum
antigenemia, and trapping of virions in the follicular dendritic cell
foot processes (6), all hallmarks of human immunodeficiency
virus (HIV) infections.
Studies with molecular clones have shown that single nucleotide
substitutions in env of HIV and SIV can cause changes in the biological phenotype, neutralizing antibody escape, and growth kinetics
(1, 15, 25). The env nucleotide substitutions seen during HIV infection are concentrated in the variable regions. The
predominance of nonsynonymous over synonymous substitutions is believed
to be due to immune pressure (5, 11) on various viral
proteins as well as on env. During cross-species
transmission of a lentivirus, adaptation occurs for accommodation to
the newly encountered nonhost environment. This process allows the
viral proteins needed in the infective processes to adapt to the
cellular composition of the new host.
The sequencing of multiple env clones at a particular time
point in infection gives an approximation of the quasispecies present in the blood at that time. A comparison of the variation within these
sequences gives an idea of the relative intrasample variation taking
place at that time in the gene sequenced (env). An inverse correlation between virus variation and length of the immunocompetent period has been shown for asymptomatic carriers of HIV and for individuals progressing to AIDS (31). Progression to AIDS
following HIV infection is known to be load dependent, with the more
rapidly replicating and syncytium-inducing phenotypes being the most
efficient in the pathway of events leading to immunodeficiency
(26, 39).
To study the relationship between viral variation and
length of the asymptomatic period, we passaged SIVsm in Asian macaques. The cross-species transmission was carried out with the Delta B670 SIV
strain (7) as the primary inoculum followed by four serial
intravenous inoculations with peripheral blood mononuclear cells (PBMC)
taken from animals at the symptomatic stage of infection. The viral
quasispecies present in the monkeys at seroconversion and death
were sampled, and multiple env clones were sequenced. We
report here on the shortening of the asymptomatic period from 18 months
to a few weeks and the concomitant reduction of intrasample and
intersample variations. Finally, we observed that the rate of
nonsynonymous nucleotide substitutions during env adaptation of SIVsm in rhesus macaques was variable and that the changes seen
occurred almost entirely in the env variable regions, where limited codon usage was found.
 |
MATERIALS AND METHODS |
Virus.
The Delta B670 SIV strain (3, 6, 7, 9, 31a, 33,
41) is an SIV originally found in a sooty mangabey presenting with a cutaneous lepromatous lesion. When tissue from this animal was
used to infect rhesus macaques, it closely reproduced AIDS in humans
(33). The virus inoculum was proven to be free of type D
retrovirus, which can cause such symptoms as well (28).
Passage.
A full history of the passage is currently being
prepared (unpublished data). Briefly, six Asian rhesus macaques, all 2 years of age, were used for the purpose of experimental infection with an SIVsm strain. The first virus sampled (P1) was the Delta B670 SIV
stock from the macaque inoculated with the sooty mangabey virus
(33). The second monkey (P2) was infected intravenously with
5 × 102 infectious doses of the Delta B670 SIV
strain. The monkeys then were intravenously inoculated in a serial
fashion with 2 × 106 PBMC taken at the symptomatic
stage. Passage five symptomatic-stage PBMC were used to infect two
monkeys (passages six A and six B). The time to death postinfection
(tdpi) and moment of sampling (ms) for the animals were as follows:
P1
tdpi, 18 months, and ms, 18 months; P2
tdpi, 12 months, and ms, 3 and 7 months; P3
tdpi, 9 months, and ms, 2 and 4.1 months; P4
tdpi, 4 months, and ms, 1 and 1.8 months; P5
tdpi, 2 months, and ms, not done,
as no sample was available; P6A
tdpi, 2 months, and ms, 2 months; and
P6B
tdpi, 2 months, and ms, 2 months. Animals were euthanatized upon
evidence of undue suffering. PBMC used for serial passages were not
cultured or cocultivated.
RNA isolation and RT-PCR.
Viral RNA was harvested with
silica in the presence of a chaotropic agent (10) from the
sera of experimentally infected Asian macaques and was used as a
template in a reverse transcriptase (RT) PCR (RT-PCR). Viral RNA was
isolated from 20-µl volumes of sera, resuspended in 20 µl of
RNasin-containing H2O (1 U/µl), and used in an RT
reaction consisting of a mixture of 5 µl of viral RNA, 250 µM each
deoxynucleoside triphosphate (dNTP), 2 ng of 3' RT-PCR primer
(SIV4Not1: TTATATGCGGCCGCCTACTTTGTGCCACGTGTTG) per µl, 2.5 mM Mg2+, 1 U of RNasin (Promega) per µl, 10 U of Super
Script I (Gibco-BRL), and 1× reaction buffer (37) in a
20-µl volume. The components were assembled at 37°C and incubated
at that temperature for 90 min. The PCR mixture consisted of 250 µM
each dNTP, 2 ng of 3' and 5' (SIV1HIII:
GTAGACAAGCTTGGGATAATACAGTCACAGAAC) PCR primers per µl, 1×
reaction buffer, 2.25 mM Mg2+, and 1.5 U of
Taq polymerase (Perkin-Elmer Cetus) in a final volume of 100 µl including 5 µl of RT reaction mixture. The PCR mixture was overlaid with paraffin and heated to 95°C for 5 min followed by 35 cycles of 1 min at 95°C, 1 min at 55°C followed by 1 min at 72°C, and finally 10 min at 72°C in a Perkin-Elmer Cetus DNA
Thermocycler. RT reactions and PCRs were carried out in duplicate for
each sample to prevent mispriming and to preserve the fidelity of the
virus genotypes sampled.
Samples were combined after PCR and size selected on 0.8% agarose gels
followed by excision of the 1,151-bp band. The excised band was
isolated from the gel slice and digested with NotI and HindIII, followed by agarose gel and silica gel fragment
isolation (10). The size-selected, digested, purified RT-PCR
product was ligated overnight into plasmid pSP64 (Promega) containing a
NotI site. The ligated product was electroporated into
electrocompetent Escherichia coli C600, and plasmid DNA from
sequencing was isolated with Qiagen columns.
Sequencing and analysis.
Double-stranded plasmid DNA was
sequenced with custom labelled dye primers (ABI, Foster City, Calif.)
by use of an ABI model 373A automated sequencer and version 1.2.0 software. Clones were assembled and aligned with the Sequence Navigator
program (ABI). Nucleotide sequences were aligned with Sequence
Navigator and Clustal V (21), with final adjustments being
carried out visually. All positions with an alignment gap in at least
one sequence were excluded from any pairwise sequence comparisons.
p distances, defined as the number of synonymous or
nonsynonymous substitutions divided by the total number of synonymous
or nonsynonymous sites (34), were used to measure the
relative genetic variation between clones. Synonymous and nonsynonymous
nucleotide p distances (Ks and Ka,
respectively) were calculated with the MEGA program (27). Intrasample calculations are the result of comparisons of clones from
the same time point or quasispecies (within a sample); intersample calculations are the result of comparisons of clones one by one from
two different time points or quasispecies (between two samples). Samples were named for their passage (P) position (from 1 to 6) and for
the time of sampling, either at seroconversion (S) or death (D); e.g.,
P2S is the passage two seroconversion sample. P6A and P6B were
considered one sample (P6) in the data calculations since there was no
significant difference between them.
 |
RESULTS |
Intrasample genetic variation at seroconversion was lower than that
at death.
Declining genetic variation, as measured by p
distances, was observed during the first three passages, coincident
with a decrease in the sequence variation within the quasispecies (Fig.
1B). The values for the last three
passages were not significantly different (0.0155 ± 0.0090, 0.0140 ± 0.0065, and 0.0154 ± 0.0092) and indicated that
further adaptation to the host did not occur. The intrasample variation
was higher at death than at seroconversion in all passages (Fig. 1A).
The intersample variation decreased gradually from 0.0423 ± 0.015 to 0.0185 ± 0.0110 during the first three passages and then
stabilized. The number of intrasample variations was one half the
number of intersample variations, suggesting continuing replacement
of genotypes (high interpassage p distances). Although the
intersample variations decreased gradually during the first three
passages, they remained higher than the intrasample variations.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 1.
Intrasample and intersample variations. Intrasample (A)
and intersample (B) p distances are shown. Groups of five
clones per sample were compared to each other (intrasample) or to the
five clones in another sample (intersample). The resulting numbers are
plotted against the position of the sample along the passage, from one
to six, at seroconversion (S) and death (D). Samples without letters
were at death. The symbols ( and ) denote the means of all
values, and the variance is shown by the vertical bars.
|
|
Nonsynonymous variations decreased during the first three passages
and subsequently stabilized.
Synonymous and nonsynonymous
substitutions in passage one were almost equal in number, suggestive of
a heterogeneous founder population adapting during the introduction of
SIVsm to rhesus macaques (Fig. 2A and B).
The intrasample nonsynonymous variation decreased threefold in the
first three passages (from 0.0325 ± 0.0065 to 0.0110 ± 0.0004). In passages three to six, the synonymous variation was twice
the nonsynonymous variation. The intrasample variation was lower at
seroconversion than at death during the first two passages and to a
lesser extent during the last two passages. The lowest values for
synonymous and nonsynonymous variations were at seroconversion in the
third passage, with the rate of adaptation leveling off in the
following passages. Intersample nonsynonymous and synonymous variations
were higher than intrasample variations (Fig. 3A and
B), reflecting the adaptation that
occurred over time during the infection (intrahost) and between the
successive passages (interhost).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 2.
Intrasample synonymous and nonsynonymous variations.
Intrasample nonsynonymous (A) and synonymous (B) p
differences are shown. The five clones of a sample were compared to one
another individually, and the synonymous and nonsynonymous p
distances were calculated. The symbols ( and ) denote the means
of all values, and the variance is shown by the vertical bars.
|
|

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Intersample synonymous and nonsynonymous variations.
Intersample nonsynonymous (A) and synonymous (B) p
differences are shown. The five clones of a sample were compared to
those of the next sample individually, and the synonymous and
nonsynonymous p distances were calculated. The symbols ( and ) denote the means of all values, and the variance is shown by
the vertical bars.
|
|
The Ks and Ka values for the
env variable and constant regions followed dissimilar
trends.
Figure 4 shows the
Ks and Ka values for the variable and constant
regions. The Ka values for the variable (Fig. 4A) and the constant (Fig. 4B) regions decreased rapidly from P1 to P3S, when the
Ks values increased. The Ks values for the
variable and constant regions were similar from P1 to P3S, when the
Ka values were more than fourfold higher for the variable
regions than for the constant regions. At seroconversion in passage
three, there was almost no nonsynonymous variation in the constant
regions, when the Ks values were similar (variable, 0.0144;
constant, 0.0133) and the Ka values for the variable regions
were 13 times the Ka values for the constant regions (0.0187 and 0.0014). Variable-region Ka values from P3S onward
remained fourfold those for the constant regions. The Ks
values for the variable regions rose while those for the constant
regions remained level in the last two passages. The Ks/Ka
ratios for the constant regions were always greater than one, while
those for the variable regions were less than one in five of the eight
samples (Fig. 4A and B).

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
Intrasample variations of constant and variable regions.
Ks (synonymous) and Ka (nonsynonymous)
substitutions per synonymous or nonsynonymous site were calculated by
dividing the C1 to CD4 binding region clones into variable (A) and
constant (B) regions and comparing these selected regions one at a time
among the clones of each sample.
|
|
The variable regions of the envelope gene had a decreased codon
redundancy.
The alterations in Ks and Ka
values led us to examine the nature of the substitutions and changes in
nucleotide concentrations of the variable and constant regions of
env (Fig. 5A to C).
Differences found in the envelope sequences of SIVsm were
compared to SIVmac251 (29) and to 55 HIV type 1 (HIV-1)
subtype B gp120 sequences (Los Alamos Sequence Database). Figure
5 shows that env was rich in adenine (A), with increased
concentrations in the variable regions compared to the constant
regions. The ratios of the four nucleotides remained constant
throughout the passages and within the HIV sequences. It has been
reported that nucleotide composition affects the evolution of RNA
viruses (12) and that individual genes of retroviruses have
characteristic base compositions (8). We found that
individual regions within retroviral genes, at least env,
had characteristic base compositions. The A concentration in the
variable regions was higher than that in the constant regions, except
at the first nucleotide of SIVmac251 and the third nucleotide of HIV-1
subtype B (Fig. 5A and C). The greatest difference seen in nucleotide
concentration was in HIV env, with its 20% discordance between the variable and constant regions. Nucleotides in position 1 of
the SIV strains were almost equal between the two regions. In the SIV
strains, the mostly synonymous third nucleotide showed higher A levels
in the variable regions; HIV-1 subtype B displayed the opposite
pattern.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 5.
Envelope nucleotide concentrations and envelope codon
usage. Nucleotide concentrations of the variable and constant regions
were calculated for the three positions of each codon (A, B, and C) in
env. The numbers indicate the average for the sums of all
clones (SIVmac251 [29] and HIV-1 subtype B data were
from the Los Alamos Sequence Database). Variation among clones was less
than 0.2%. (D) By use of the MEGA program, the numbers of codons used
to represent amino acids in the variable and constant regions were
calculated for the above-mentioned sequences. The percentage of 61 codons is the number of codons used divided by 61 (the total number of
codons, not including those that represent stop signals).
|
|
The effects of the nucleotide concentrations found were examined with
regard to codon usage within the two
env domains, constant
and variable. Although the nucleotide concentrations varied between
viruses, the codon usage frequencies were similar (Fig.
5D). Of
the 61 possible codons (there are 64 possible codons with three
encoding stop
messages not found within the envelope gene), the
number used was 11%
lower (on average) in the variable regions.
 |
DISCUSSION |
The endemic infection of feral monkeys with SIV has no known
associated pathology, apparently due to the historic genetic accommodation (13) of the virus. The host adaptation of the virus, or host-pathogen coevolution, leads to asymptomatic infection of
most African primate species with their own host-adapted strains (2, 23). No natural SIV infection has been found in Asian primates, and cross-species transmission (e.g., African SIV in Asian
macaques) leads to the development of AIDS presenting the common
markers of HIV-1 infection (20, 36). A cross-species population passage may cause initially rapid genomic evolution during
adaptation to the new immune environment. Large numbers of
nonsynonymous changes are due to the env alterations needed to avoid immune attack and/or to maximize the affinity of the viral
env protein for efficient binding to and infection of the cells of the new host species. Since natural cross-species transmission occurs via blood contact, rather than by mucosal contact, intravenous serial passage was carried out. Parenteral transmission is one of the
major routes of infections with HIV-1 and HIV-2, which is closely
related to SIVsm. Recently, it was shown that the route of transmission
(mucosal versus blood) does affect virus heterogeneity (4, 34a,
38a), both routes resulting in the transmission of a more
homogeneous selection of variants. Similar observations were made by
Amadee et al. (using the same strain, Delta B670 SIV, as was used here
[3, 4]), who also showed that intravenous, oral, and
transplacental transmissions limit virus heterogeneity and select for
macrophage tropism, as we found for intravenous passage
(39a).
The decrease in the Ka values after the first three passages
suggests that the adaptation of SIVsm to rhesus macaques is rapid and
punctuated. The decreases in the times to death postinfection and
env adaptation follow similar patterns, with the intrasample sequence variation levelling off once the time to death postinfection is less than 4 months (passages four to six A and six B) (Fig. 4A). The
decreased intrasample variation remains stable after the third passage,
indicating that env variation is restricted, most likely
because of the adaptive equilibrium reached. The nearly 50% decrease
in env variation indicates that the total adaptation rate is
decreasing and that there is positive or purifying selection of a
narrow assortment of env genotypes. The lowest Ks
value is that for P3S, with almost zero variation of the constant
regions and a Ka of 10.0 for the variable regions, since an
almost clonal population was present.
The low variation in seroconversion samples compared to death
samples is evidence of a strong founder effect, since this outgrowth of
a dominant homogeneous viral population emerges prior to
detectable immune responses. This finding is in accord with the
variation seen in env of HIV-infected individuals
progressing to AIDS, in whom homogeneity at seroconversion is higher
than that at death (40). The hypothesis that quasispecies
homogeneity in HIV infections is caused by single-particle
transmissions is not confirmed here, since even after the passage of
millions of virus particles, we saw the same patterns of homogeneity at
seroconversion and heterogeneity at death. The effect is thus caused by
the selective amplification and eventual outgrowth of a dominant viral
genome that then diversifies into a quasispecies under the influences
of replication competence during adaptation, the immune system, and
cell availability.
The fourfold higher Ka values for the variable regions than
for the constant regions indicate positive selection (32).
Similarity in Ks values and discontinuity in Ka
values underscore the difference in the functions of the constant and
variable regions and the system governing nucleotide substitutions. If
the rate of nucleotide substitutions caused by RT errors is constant
over all the nucleotides of a retroviral gene, then there should be
equal amounts of variation in all regions. The distinct variations in
Ka values reported here are presumably the effects of immune
pressure, variations in receptor and coreceptor binding sites on the
variable regions, and purifying selection on the constant regions. The
similarity of the Ks values for the constant and variable
regions reflects the effects of purifying selection on nucleotide
substitutions in conserved regions.
Increasing the concentration of a single nucleotide may affect the
number of possible codons that can encode amino acids. Amino acids with
more than four representative codons (leucine, serine, and arginine
have six) can be represented by codons with various nucleotide
concentrations, as opposed to methionine and tryptophan, which have
single codons. Thus, the result of an increased concentration of one
nucleotide is that fewer codons can encode these amino acids when they
are present in the variable regions, where the highest adenine (A)
concentrations are found (Fig. 5D). Although this concentration effect
is only possible with these three amino acids, there is a resulting
reduction in the number of codons used in encoding the other amino
acids as well. As shown in Fig. 5, the redundancy in the codons used in
the variable regions is decreased up to 12% compared to that in the
constant regions. Reduced codon usage will lower the redundancy of the
encoded amino acids. Presumably, the net effect is greater amino acid
variation from a given nucleotide substitution in the variable regions
than in the constant regions, which are more buffered by increased codon redundancy. This strategy of reduced redundancy would cause more
amino acid substitutions in the variable regions as a selective advantage against humoral and cell-mediated immunities while allowing the constant regions to remain stable during the adaptation reported here.
Reaching a plateau in the evolutionary pace in passages three to six
suggests that sufficient env adaptation has occurred for
optimal fitness. Exponential gains in the growth kinetics of RNA
viruses (35) occur in vitro during a more prolonged series of passages. The short adaptation phase seen here could result from
immune system-driven positive selection, since the previous experiments
were performed with tissue culture under no such selection. This short
adaptation phase could also be and probably is just as likely caused by
selection for viruses with greater replication competence in the new
species, and not immune selection alone. With the increase in
pathogenicity, the shortening of the asymptomatic period falls below
the response time for humoral immunity. This effect may lead to
decreased adaptation, or evolutionary stasis, of env in the
plateau phase from passages four to six. If so, it appears that
env gene substitution is selected for by immunocompetence; thereafter, selective amplification and purifying selection control the
breadth and direction of variation. Because env is the
target for neutralizing antibodies and cell-mediated immunity, this
finding is significant because env contains determinants for
cell tropism and replication, thus playing a putative role in
virulence.
In the first passage, nonsynonymous variations are almost equal to
synonymous variations. Since these adaptive variations are not
selective, they must be occurring in a very large and heterogeneous
quantity of virus to produce the variations in noncoding nucleotides.
Decreasing adaptation then continues to the seroconversion in passage
three, at which point the lowest nonsynonymous and synonymous
variations are seen. According to the competition exclusion principle
(17, 19), equilibrium and competition lead to the outgrowth
of a very homogeneous population, which we saw at seroconversion in
passage three. The P3S quasispecies is dominated by a virus or viruses
with a narrowed selection of genomes compared to that seen at passage
one. The drop in evolution rate thus signals the end of the adaptation
phase and allows competition among the viruses then present, which are
of reasonably equal fitnesses. Their competition to achieve the
greatest replication competence decides the dominance of the next
progeny, not adaptation or immune evasion. This point marks the end of
rapid env evolution and of large virulence increases as
well.
Shpaer and Mullins have shown that immunogenicity and pathogenicity are
presumably linked (38) by the correlation of high rates of
amino acid change with increased virulence. The cross-species transmission of SIVsm into rhesus macaques would require the adaptation to the new host of the proteins that are involved in cell binding, entry, replication, immune evasion, and escape. The burst of evolution seen in the first three passages is evidence of this positive selection
and its enforcement by the immune response to a foreign pathogen
(32), as well as the cell-dependent changes needed for
entry. The increased intrasample genetic variation seen between seroconversion and death confirms the notion that competent immune responses drive viral evolution to a certain extent. That nonsynonymous variations are greater than synonymous variations represents positive selection, and not drift, and the adaptation phase of the first three
passages is exemplary evidence of this fact. The plateau phase of the
later passages is illustrative of the purifying selection that takes
place during lentiviral infections. In the absence of an antibody
response, the evolutionary rate of the adapted replication-competent
virus is close to stasis. The results reported here present suggestive
evidence for the relationship of particular env sequences to
virulence in rhesus macaques following inoculation with SIVsm.
 |
ACKNOWLEDGMENTS |
We thank H. Niphuis (Biomedical Primate Research Centre) for
providing the passage monkey serum. P. J. Spencer Valli thanks his
father for encouragement, support, and wisdom. We thank Carla Kuiken
(Los Alamos National Laboratory) for crucial discussions; Lucy Phillips
for much needed editorial assistance; Debbie Hauer, J. Clements, and C. Zink (Johns Hopkins University School of Medicine) for cloning advice;
Chris Contag (Stanford University School of Medicine) for help with the
sequence primer design; and Howard S. Fox (Scripps Research Institute)
for the SIVmac sequences.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Human Retrovirology, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: (31-20) 5664853. Fax: (31-20) 6916531. E-mail:
p.j.valli{at}amc.uva.nl.
 |
REFERENCES |
| 1.
|
Allan, J. S.,
P. Ray,
S. Broussard,
E. Whitehead,
G. Hubbard,
T. Butler,
K. Brasky,
P. Luciw,
C. Cheng-Mayer,
J. A. Levy, et al.
1995.
Infection of baboons with simian/human immunodeficiency viruses.
J. Acquired Immune Defic. Syndr. Hum. Retrovirol.
9:429-441[Medline].
|
| 2.
|
Allan, J. S.,
M. Short,
M. E. Taylor,
S. Su,
V. M. Hirsch,
P. R. Johnson,
G. M. Shaw, and B. H. Hahn.
1991.
Species-specific diversity among simian immunodeficiency viruses from African green monkeys.
J. Virol.
65:2816-2828[Abstract/Free Full Text].
|
| 3.
|
Amedee, A. M.,
N. Lacour,
J. L. Gierman,
L. N. Martin,
J. E. Clements,
R. Bohm, Jr.,
R. M. Harrison, and M. Murphey-Corb.
1995.
Genotypic selection of simian immunodeficiency virus in macaque infants infected transplacentally.
J. Virol.
69:7982-7990[Abstract].
|
| 4.
|
Amedee, A. M.,
N. Lacour,
L. N. Martin,
J. E. Clements,
R. B. Bohm, Jr.,
B. Davison,
R. Harrison, and M. Murphey-Corb.
1996.
Genotypic analysis of infant macaques infected transplacentally and orally.
J. Med. Primatol.
25:225-235[Medline].
|
| 5.
|
Back, N. K.,
L. Smit,
M. Schutten,
P. L. Nara,
M. Tersmette, and J. Goudsmit.
1993.
Mutations in human immunodeficiency virus type 1 gp41 affect sensitivity to neutralization by gp120 antibodies.
J. Virol.
67:6897-6902[Abstract/Free Full Text].
|
| 6.
|
Baskin, G. B.,
L. N. Martin,
M. Murphey-Corb,
F. S. Hu,
D. Kuebler, and B. Davison.
1995.
Distribution of SIV in lymph nodes of serially sacrificed rhesus monkeys.
AIDS Res. Hum. Retroviruses
11:273-285[Medline].
|
| 7.
|
Baskin, G. B.,
L. N. Martin,
S. R. Rangan,
B. J. Gormus,
M. Murphey-Corb,
R. H. Wolf, and K. F. Soike.
1986.
Transmissible lymphoma and simian acquired immunodeficiency syndrome in rhesus monkeys.
JNCI
77:127-139.
|
| 8.
|
Berkhout, B., and F. J. van Hemert.
1994.
The unusual nucleotide content of the HIV RNA genome results in a biased amino acid composition of HIV proteins.
Nucleic Acids Res.
22:1705-1711[Abstract/Free Full Text].
|
| 9.
|
Bohm, R. P., Jr.,
L. N. Martin,
B. Davison-Fairburn,
G. B. Baskin, and M. Murphey-Corb.
1993.
Neonatal disease induced by SIV infection of the rhesus monkey (Macaca mulatta).
AIDS Res. Hum. Retroviruses
9:1131-1137[Medline].
|
| 10.
|
Boom, R.,
C. J. Sol,
M. M. Salimans,
C. L. Jansen,
P. M. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 11.
|
Bou-Habib, D. C.,
G. Roderiquez,
T. Oravecz,
P. W. Berman,
P. Lusso, and M. A. Norcross.
1994.
Cryptic nature of envelope V3 region epitopes protects primary monocytotropic human immunodeficiency virus type 1 from antibody neutralization.
J. Virol.
68:6006-6013[Abstract/Free Full Text].
|
| 12.
|
Bronson, E. C., and J. N. Anderson.
1994.
Nucleotide composition as a driving force in the evolution of retroviruses.
J. Mol. Evol.
38:506-532[Medline].
|
| 13.
|
Brown, E. W.,
N. Yuhki,
C. Packer, and S. J. O'Brien.
1994.
A lion lentivirus related to feline immunodeficiency virus: epidemiologic and phylogenetic aspects.
J. Virol.
68:5953-5968[Abstract/Free Full Text].
|
| 14.
|
Chen, Z.,
P. Telfer,
A. Gettie,
P. Reed,
L. Zhang,
D. D. Ho, and P. A. Marx.
1996.
Genetic characterization of new West African simian immunodeficiency virus (SIV) SIVsm: geographic clustering of household-derived SIV strains with human immunodeficiency virus type 2 subtypes and genetically diverse viruses from a single feral sooty mangabey troop.
J. Virol.
70:3617-3627[Abstract].
|
| 15.
|
Chesebro, B.,
K. Wehrly,
J. Nishio, and S. Perryman.
1992.
Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: definition of critical amino acids involved in cell tropism.
J. Virol.
66:6547-6554[Abstract/Free Full Text].
|
| 16.
| Cichutek, K., and S. Norley. 1993. Lack of immune
suppression in SIV-infected natural hosts. AIDS 7(Suppl
1.):S25-S35.
|
| 17.
|
Clarke, D. K.,
E. A. Duarte,
S. F. Elena,
A. Moya,
E. Domingo, and J. Holland.
1994.
The red queen reigns in the kingdom of RNA viruses.
Proc. Natl. Acad. Sci. USA
91:4821-4824[Abstract/Free Full Text].
|
| 18.
|
Daniel, M. D.,
N. L. Letvin,
N. W. King,
M. Kannagi,
P. K. Sehgal,
R. D. Hunt,
P. J. Kanki,
M. Essex, and R. C. Desrosiers.
1985.
Isolation of T-cell tropic HTLV-III-like retrovirus from macaques.
Science
228:1201-1204[Abstract/Free Full Text].
|
| 19.
|
Drake, J. W.
1993.
Rates of spontaneous mutation among RNA viruses.
Proc. Natl. Acad. Sci. USA
90:4171-4175[Abstract/Free Full Text].
|
| 20.
|
Gao, F.,
L. Yue,
A. T. White,
P. G. Pappas,
J. Barchue,
A. P. Hanson,
B. M. Greene,
P. M. Sharp,
G. M. Shaw, and B. H. Hahn.
1992.
Human infection by genetically diverse SIVSM-related HIV-2 in West Africa.
Nature
358:495-499[Medline].
|
| 21.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[Medline].
|
| 22.
|
Hirsch, V. M., and P. R. Johnson.
1994.
Pathogenic diversity of simian immunodeficiency viruses.
Virus Res.
32:183-203[Medline].
|
| 23.
|
Hirsch, V. M.,
R. A. Olmsted,
M. Murphey-Corb,
R. H. Purcell, and P. R. Johnson.
1989.
An African primate lentivirus (SIVsm) closely related to HIV-2.
Nature
339:389-392[Medline].
|
| 24.
|
Huet, T.,
R. Cheynier,
A. Meyerhans,
G. Roelants, and S. Wain-Hobson.
1990.
Genetic organization of a chimpanzee lentivirus related to HIV-1.
Nature
345:356-359[Medline].
|
| 25.
|
Joag, S. V.,
E. B. Stephens,
R. J. Adams,
L. Foresman, and O. Narayan.
1994.
Pathogenesis of SIVmac infection in Chinese and Indian rhesus macaques: effects of splenectomy on virus burden.
Virology
200:436-446[Medline].
|
| 26.
|
Jurriaans, S.,
B. van Gemen,
G. J. Weverling,
D. Van Strijp,
P. Nara,
R. Coutinho,
M. Koot,
H. Schuitemaker, and J. Goudsmit.
1994.
The natural history of HIV-1 infection: virus load and virus phenotype independent determinants of clinical course?
Virology
204:223-233[Medline].
|
| 27.
|
Kumar, S.,
K. Tamura, and M. Nei.
1994.
MEGA: Molecular Evolutionary Genetics Analysis software for microcomputers.
Comput. Appl. Biosci.
10:189-191[Abstract/Free Full Text].
|
| 28.
|
Lackner, A. A.,
P. F. Moore,
P. A. Marx,
R. J. Munn,
M. B. Gardner, and L. J. Lowenstine.
1990.
Immunohistochemical localization of type D retrovirus serotype 1 in the digestive tract of rhesus monkeys with simian AIDS.
J. Med. Primatol.
19:339-349[Medline].
|
| 29.
|
Lane, T. E.,
M. J. Buchmeier,
D. D. Watry,
D. B. Jakubowski, and H. S. Fox.
1995.
Serial passage of microglial SIV results in selection of homogeneous env quasispecies in the brain.
Virology
212:458-465[Medline].
|
| 30.
|
Lowenstine, L. J.,
N. C. Pedersen,
J. Higgins,
K. C. Pallis,
A. Uyeda,
P. Marx,
N. W. Lerche,
R. J. Munn, and M. B. Gardner.
1986.
Seroepidemiologic survey of captive Old-World primates for antibodies to human and simian retroviruses, and isolation of a lentivirus from sooty mangabeys (Cercocebus atys).
Int. J. Cancer
38:563-574[Medline].
|
| 31.
|
Lukashov, V. V.,
C. L. Kuiken, and J. Goudsmit.
1995.
Intrahost human immunodeficiency virus type 1 evolution is related to length of the immunocompetent period.
J. Virol.
69:6911-6916[Abstract].
|
| 31a.
|
Miller, M. A.,
M. Murphey-Corb, and R. C. Montelaro.
1992.
Identification of broadly reactive continuous antigenic determinants of simian immunodeficiency virus glycoproteins.
AIDS Res. Hum. Retroviruses
8:1153-1164[Medline].
|
| 32.
|
Mindell, D. P.
1996.
Positive selection and rates of evolution in immunodeficiency viruses from humans and chimpanzees.
Proc. Natl. Acad. Sci. USA
93:3284-3288[Abstract/Free Full Text].
|
| 33.
|
Murphey-Corb, M.,
L. N. Martin,
S. R. Rangan,
G. B. Baskin,
B. J. Gormus,
R. H. Wolf,
W. A. Andes,
M. West, and R. C. Montelaro.
1986.
Isolation of an HTLV-III-related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys.
Nature
321:435-437[Medline].
|
| 34.
|
Nei, M., and T. Gojobori.
1986.
Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions.
Mol. Biol. Evol.
3:418-426[Abstract].
|
| 34a.
|
Neildez, O.,
R. Le Grand,
P. Caufour,
B. Vaslin,
A. Cheret,
F. Matheux,
F. Theodoro,
P. Roques, and D. Dormont.
1998.
Selective quasispecies transmission after systemic or mucosal exposure of macaques to simian immunodeficiency virus.
Virology
243:12-20[Medline].
|
| 35.
|
Novella, I. S.,
E. A. Duarte,
S. F. Elena,
A. Moya,
E. Domingo, and J. J. Holland.
1995.
Exponential increases of RNA virus fitness during large population transmissions.
Proc. Natl. Acad. Sci. USA
92:5841-5844[Abstract/Free Full Text].
|
| 36.
|
Reimann, K. A.,
K. Tenner-Racz,
P. Racz,
D. C. Montefiori,
Y. Yasutomi,
W. Lin,
B. J. Ransil, and N. L. Letvin.
1994.
Immunopathogenic events in acute infection of rhesus monkeys with simian immunodeficiency virus of macaques.
J. Virol.
68:2362-2370[Abstract/Free Full Text].
|
| 37.
|
Sellner, L. N.,
R. J. Coelen, and J. S. Mackenzie.
1994.
Sensitive detection of Ross River virus a one-tube nested RT-PCR.
J. Virol. Methods
49:47-58[Medline].
|
| 38.
|
Shpaer, E. G., and J. I. Mullins.
1993.
Rates of amino acid change in the envelope protein correlate with pathogenicity of primate lentiviruses.
J. Mol. Evol.
37:57-65[Medline].
|
| 38a.
|
Sodora, D. L.,
F. Lee,
P. J. Dailey, and P. A. Marx.
1998.
A genetic and viral load analysis of the simian immunodeficiency virus during the acute phase in macaques inoculated by the vaginal route.
AIDS Res. Hum. Retroviruses
14:171-181[Medline].
|
| 39.
|
Tersmette, M.,
J. M. Lange,
R. E. de Goede,
F. de Wolf,
J. K. Eeftink-Schattenkerk,
P. T. Schellekens,
R. A. Coutinho,
J. G. Huisman,
J. Goudsmit, and F. Miedema.
1989.
Association between biological properties of human immunodeficiency virus variants and risk for AIDS and AIDS mortality.
Lancet
i:983-985.
|
| 39a.
| Valli, P. J. S., J. Heeney, and J. Goudsmit. Selection for macrophage tropism during serial passage
of SIVsm in rhesus macaques concomitant with increased virulence.
Submitted for publication.
|
| 40.
|
Wolfs, T. F.,
G. Zwart,
M. Bakker, and J. Goudsmit.
1992.
HIV-1 genomic RNA diversification following sexual and parenteral virus transmission.
Virology
189:103-110[Medline].
|
| 41.
|
Zhang, J. Y.,
L. N. Martin,
E. A. Watson,
R. C. Montelaro,
M. West,
L. Epstein, and M. Murphey-Corb.
1988.
Simian immunodeficiency virus/delta-induced immunodeficiency disease in rhesus monkeys: relation of antibody response and antigenemia.
J. Infect. Dis.
158:1277-1286[Medline].
|
Journal of Virology, September 1998, p. 7494-7500, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Franklin, S. P., Troyer, J. L., Terwee, J. A., Lyren, L. M., Boyce, W. M., Riley, S. P. D., Roelke, M. E., Crooks, K. R., VandeWoude, S.
(2007). Frequent Transmission of Immunodeficiency Viruses among Bobcats and Pumas. J. Virol.
81: 10961-10969
[Abstract]
[Full Text]
-
Rychert, J., Lacour, N., Amedee, A. M.
(2006). Genetic Analysis of Simian Immunodeficiency Virus Expressed in Milk and Selectively Transmitted through Breastfeeding.. J. Virol.
80: 3721-3731
[Abstract]
[Full Text]
-
Holterman, L., Dubbes, R., Mullins, J., Learn, G., Niphuis, H., Koornstra, W., Koopman, G., Kuhn, E.-M., Wade-Evans, A., Rosenwirth, B., Haaijman, J., Heeney, J.
(2001). Characteristics of a Pathogenic Molecular Clone of an End-Stage Serum-Derived Variant of Simian Immunodeficiency Virus (SIVF359). J. Virol.
75: 9328-9338
[Abstract]
[Full Text]
-
Holterman, L., Niphuis, H., ten Haaft, P. J. F., Goudsmit, J., Baskin, G., Heeney, J. L.
(1999). Specific passage of simian immunodeficiency virus fromend-stage disease results in accelerated progression to AIDS in rhesus macaques. J. Gen. Virol.
80: 3089-3097
[Abstract]
[Full Text]
-
Staprans, S. I., Dailey, P. J., Rosenthal, A., Horton, C., Grant, R. M., Lerche, N., Feinberg, M. B.
(1999). Simian Immunodeficiency Virus Disease Course Is Predicted by the Extent of Virus Replication during Primary Infection. J. Virol.
73: 4829-4839
[Abstract]
[Full Text]