Previous Article | Next Article 
Journal of Virology, September 1998, p. 7310-7319, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
DNA Vaccination Affords Significant Protection
against Feline Immunodeficiency Virus Infection without Inducing
Detectable Antiviral Antibodies
Margaret J.
Hosie,*
J. Norman
Flynn,
Mark A.
Rigby,
Celia
Cannon,
Thomas
Dunsford,
Nancy A.
Mackay,
David
Argyle,
Brian J.
Willett,
Takayuki
Miyazawa,
David E.
Onions,
Oswald
Jarrett, and
James C.
Neil
Retrovirus Research Laboratory, Department of
Veterinary Pathology, University of Glasgow, Bearsden, Glasgow G61
1QH, United Kingdom
Received 18 February 1998/Accepted 19 May 1998
 |
ABSTRACT |
To test the potential of a multigene DNA vaccine against lentivirus
infection, we generated a defective mutant provirus of feline
immunodeficiency virus (FIV) with an in-frame deletion in
pol (FIV
RT). In a first experiment, FIV
RT DNA was
administered intramuscularly to 10 animals, half of which also received
feline gamma interferon (IFN-
) DNA. The DNA was
administered in four 100-µg doses at 0, 10, and 23 weeks.
Immunization with FIV
RT elicited cytotoxic T-cell (CTL)
responses to FIV Gag and Env in the absence of a serological
response. After challenge with homologous virus at week 26, all 10 of
the control animals became seropositive and viremic but 4 of
the 10 vaccinates remained seronegative and virus free. Furthermore,
quantitative virus isolation and quantitative PCR analysis of viral DNA
in peripheral blood mononuclear cells revealed significantly lower
virus loads in the FIV
RT vaccinates than in the controls.
Immunization with FIV
RT in conjunction with IFN-
gave the highest
proportion of protected cats, with only two of five vaccinates
showing evidence of infection following challenge. In a second
experiment involving two groups (FIV
RT plus IFN-
and IFN-
alone), the immunization schedule was reduced to 0, 4, and 8 weeks.
Once again, CTL responses were seen prior to challenge in the absence
of detectable antibodies. Two of five cats receiving the proviral DNA
vaccine were protected against infection, with an overall reduction in
virus load compared to the five infected controls. These findings
demonstrate that DNA vaccination can elicit protection against
lentivirus infection in the absence of a serological response and
suggest the need to reconsider efficacy criteria for lentivirus
vaccines.
 |
INTRODUCTION |
The continued spread of human
immunodeficiency virus (HIV) worldwide makes the development of an
effective vaccine an urgent priority for world health. However, HIV and
its animal lentivirus counterparts present formidable challenges for
vaccine development because they cause persistent infection and induce
disease despite a vigorous host immune response (8). Among
the available animal analogs of HIV, feline immunodeficiency virus
(FIV) has unique value as a widespread naturally occurring infectious
agent in its natural host (45). Conventional approaches to
vaccine development have been pursued extensively for FIV and simian
immunodeficiency virus (SIV) but have yielded only qualified successes.
Whole inactivated virus vaccines have proved effective in the FIV
model, and protection is virus specific (48) but limited to
the homologous virus and may depend on a fortuitous vaccine strain of
virus which elicits strong neutralizing-antibody responses
(16). Subunit vaccines based on purified or recombinant Env
glycoproteins have given some evidence of protection against HIV in a
small number of chimpanzees, but similar SIV or FIV vaccines have led
at best to reduced virus loads after challenge and in some instances to
enhancement of infection (17, 22, 40). More robust
resistance has been observed to SIV after infection with attenuated
strains lacking regulatory genes such as nef (6),
but safety fears make the use of this approach in humans controversial
(3, 46).
DNA-mediated immunization has emerged recently as a promising
alternative approach to the development of viral vaccines, with protective immunity against viral infections such as avian influenza (33), Newcastle disease (36), and Aujeszky's
disease (13), as well as a wide range of nonviral pathogens
(reviewed in reference 42), being generated
following in vivo administration of naked DNA to muscle or skin. Given
that antiretroviral therapy is unlikely to be economically viable in
developing countries, a further attraction of DNA-mediated immunization
is the prospect of stable and affordable vaccines.
Several HIV-1 DNA constructs induce immune responses in mice and
primates (25, 38, 43), and forthcoming phase I trials will
assess the safety and immunogenicity of HIV-1 env DNA in human subjects. Encouraging evidence for the use of DNA vaccines was
described recently when an HIV-1 DNA vaccine containing env, rev, and gag/pol induced protective immunity in
the chimpanzee model (4). However, since HIV-1 is
apathogenic in the chimpanzee model system, the question arises whether
similar approaches will be effective in inducing protection against
lentivirus infection in the natural host species that are susceptible
to virus-induced disease, such as FIV in the domestic cat.
In this study, we generated an FIV DNA vaccine construct based on a
replication-defective but essentially full-length proviral genome which
should express both structural and regulatory proteins in vivo. We
investigated the efficacy of this FIV DNA vaccine and demonstrated that
a significant proportion of the cats vaccinated with this DNA were
protected from subsequent challenge with the homologous virus.
Furthermore, the protective effect was retained in a second trial
involving a much shorter immunization schedule. This study provides the
first evidence that DNA-mediated immunization can prevent lentivirus
infection in its natural host species.
 |
MATERIALS AND METHODS |
Cells and viruses.
Cell culture media and supplements were
obtained from Life Technologies Inc., Paisley, United Kingdom. Crandell
feline kidney (CrFK) cells (5) were maintained in
Dulbecco's modification of minimal essential medium Eagle supplemented
with 10% heat-inactivated fetal bovine serum, 2 mM glutamine, 0.11 mg
of sodium pyruvate per ml, 100 µg of streptomycin per ml, and 100 IU
of penicillin per ml. MYA-1 cells (27) were maintained in
RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine
serum, 2 mM glutamine, 100 IU of penicillin per ml, 100 µg of
streptomycin per ml, 5 × 10
5 M 2-mercaptoethanol
(complete RPMI 1640 medium), and 2% culture supernatant from the
Ltk
IL2.23 cell line, a murine cell line stably
transfected with the human interleukin-2 (IL-2) gene and which produces
high levels of human IL-2 (addition of 2% supernatant was found to be
equivalent to addition of approximately 100 IU of recombinant human
IL-2). The Ltk
IL2.23 cell line was a kind gift of M. Hattori, University of Tokyo. The FIV-PET challenge virus was prepared
as described previously (32) by transfection of the murine
fibroblast cell line NIH 3T3 with the F14 molecular clone of FIV-PET
(28) and recovery into the IL-2-dependent feline T-cell line
Q201 (44).
Preparation of DNA immunogens.
The reverse transcriptase
(RT) deletion mutant FIV
RT was prepared from the F-14 molecular
clone of FIV-PET (28). Cloning and characterization of
feline gamma interferon (IFN-
) have been described previously
(1). For use as an adjuvant gene, the IFN-
cDNA was
subcloned into the pRC-RSV vector (Invitrogen B.V., De Schelp, The
Netherlands) as a HindIII-NotI fragment.
Plasmid DNAs were purified by cesium chloride-ethidium bromide gradient
centrifugation followed by butanol extraction and ethanol
precipitation. Following resuspension in 10 mM Tris plus 1 mM EDTA, the
plasmids were dialyzed extensively against phosphate-buffered saline
(PBS). Endotoxin levels were quantified commercially by Q1 Biotech,
Glasgow, United Kingdom, by the Limulus amebocyte lysate
technique and were found to be <5 EU/ml.
DNA immunization and virus challenge.
Kittens (12 weeks old)
were randomized into groups of five for immunization. DNA was
administered at four sites in the gastrocnemius and quadriceps muscles
(100 µg of each DNA in a total of 200 µl of PBS at each site). The
cats were challenged with the homologous F-14 molecular clone of the
FIV-PET isolate that had been subjected to titer determination by
intraperitoneal inoculation of age-matched cats to calculate the 50%
infectious dose.
Detection of FIV-specific CTL.
Lymphocytes were collected
from peripheral blood as described previously (10) and
assayed directly for cytotoxic T-lymphocyte (CTL) activity. Target
cells were autologous or allogeneic skin fibroblasts derived from
biopsy material collected prior to vaccination (9). The
target cells were labelled with 51Cr and infected with
recombinant vaccinia viruses expressing FIV Gag (10) or Env
(41) or wild-type vaccinia virus as a control. Effector
cells (>99% viable) were added at an effector-to-target-cell (E/T)
ratio of 50:1, and lytic activity was measured by monitoring isotope
release as described previously (10).
Serological tests.
Plasma samples were tested for the
presence of anti-FIV antibodies by immunoblot analysis as described
previously (19). Peptide-based enzyme-linked immunosorbent
assays (ELISA) were used to determine titers of antibodies recognizing
an immunodominant epitope in the transmembrane glycoprotein (TM;
CNQNQFFCK) (12, 30) by methods described previously (2,
39). Assays for virus-neutralizing antibodies were performed, by
a method described previously (29), on plasma samples taken
on the day of challenge.
Immunoblotting.
CrFK cells were transfected with the F-14
molecular clone, the FIV
RT construct, or no DNA (mock transfected)
by using LipofectAMINE (Life Technologies) as specified by the
manufacturer. The medium was changed 24 h posttransfection, and
supernatants from the transfected cells were harvested 48 h later.
These supernatants were clarified by centrifugation at 10,000 × g for 10 min before virions were pelleted by
ultracentrifugation at 200,000 × g for 1 h. The
virions thus purified from 1 ml of culture fluid were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis and
immunoblotting as described elsewhere (19). Monoclonal
antibody 43/1B9, recognizing FIV p24 (kindly provided by N. Pedersen),
was used for immunoblotting.
Isolation of FIV.
On the day of challenge and at intervals
of 3 weeks thereafter, peripheral blood mononuclear cells (PBMC) were
isolated from heparinized venous peripheral blood by centrifugation
over Ficoll-Hypaque (Pharmacia LKB Biotechnology Inc., Piscataway,
N.J.) and then either cultured directly or cocultured with the
IL-2-dependent feline T-cell line MYA-1 (27) in complete
RPMI 1640 medium supplemented with 2% culture supernatant from the
Ltk
IL2.23 cell line. Cultures were tested for the
production of FIV p24 by ELISA (FIV antigen test kit; IDEXX
Laboratories, Portland, Maine) and were maintained for 21 days before
being scored as negative.
Quantitative virus isolation.
The infectious virus burden
was measured 7 and 12 weeks after challenge. PBMC were isolated as
described above, and decreasing numbers of cells (2 × 106, 2 × 105, 2 × 104,
2 × 103, 2 × 102, 20, 2, or 0.2 cells) were cocultivated, in duplicate, in 48-well plates with
106 MYA-1 cells in a total volume of 1.5 ml of complete
RPMI medium. Samples of culture supernatant were tested on day 14 for
the presence of FIV p24 by ELISA.
Statistical analyses.
The proportions of infected cats in
the four groups of cats were compared by Fisher's exact test. The
statistical modelling of the initial number of infected cells per
2 × 106 PBMC for each cat followed the classic
dilution assay analysis (26). For the first trial, the
maximum-likelihood estimates of the initial concentrations of infected
cells were compared among the four groups by a one-way analysis of
variance. These estimates were log transformed, after addition of a
constant of 1, to better meet the "normality with equal variance"
assumptions. Pairwise contrasts between groups were analyzed by two
sample t tests. Groups 1 (FIV
RT) and 2 (FIV
RT plus
IFN-
) were then aggregated and compared with the two control groups
via a two-sample t test. These analyses were performed for
each of the two periods separately, ignoring the repeated-measures
aspect. The P values cited for the two-sample t
tests are adjusted for multiple comparisons via permutation and should
be regarded as descriptive, reflecting the exploratory nature of the
analyses. For the second trial, similar methods were applied to compare
estimates of the initial concentrations of infected cells in the two
groups of cats.
Proviral load measurement.
DNA was prepared from PBMC and
tested for the presence of FIV sequences by quantitative nested PCR
with primers from the env gene as described previously
(32). Duplicate assays were performed with pol
primers (outer, GAAGATAAATTACAGGAAGAACC and
CTCATTTCCTGGAATACCTTTA; inner, GATGGGTTATGAATTACATCCA
and GGACCCAATCTATAAATTGC) under identical conditions.
Each PCR was validated with a set of dilutions of DNA derived from the
FL4 cell line (47). Assays were performed on aliquots of DNA
prepared from PBMC at inputs of 250, 500, and 1,000 ng. Positive scores
were assigned to denote the amplification in one or more aliquots.
 |
RESULTS |
Generation of a replication-defective FIV vaccine construct
(FIV
RT).
The F-14 molecular clone of FIV-PET has previously
been shown to be infectious for cats following intramuscular injection of plasmid DNA (32). To render the FIV provirus
noninfectious while leaving as much as possible of the coding potential
intact, deletions were generated around a PacI restriction
site located within the RT coding sequence at the hinge between the RT
and RNase H domains (28). From a library of clones generated
by sequential PacI and Bal 31 digestion and
religation, we selected a recombinant which had sustained a 33-codon
deletion. The precise boundaries of this deletion are shown in Fig.
1 below a partial restriction map of the
F-14 proviral clone (28). Characterization of this deletion
mutant has shown that it is completely defective with respect to virion
infectivity and RT activity. However, transfection studies showed that
FIV
RT is essentially normal in Env-mediated cell fusion and viral
antigen release (data not shown). As shown in Fig.
2, CrFK cells transfected with FIV
RT
and the parental F-14 clone release similar levels of viral proteins.
The FIV
RT-derived virions showed a consistent reduction in the
extent of Gag protein processing, suggesting some impairment of Gag-Pol
precursor transport or function, but since authentic processing was
clearly occurring, this proviral construct was adopted as the basis of
the FIV
RT DNA vaccine.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Partial restriction map of the FIV-PET F-14 molecular
clone which was received as a subclone in plasmid pGEM7Zf+. The
location of the major open reading frames (stippled boxes) and long
terminal repeats (solid boxes) is shown underneath. The unique
PacI site (P) used in mutagenesis and an adjacent
XbaI site (X) are boxed in the diagram and underlined in the
primary sequence below. The extent of the Bal 31-generated
deletion in FIV RT is indicated by dots above the sequence. Numbering
is relative to the published sequence (GenBank accession no. M25381
[28]). Other restriction sites: S, SacI; R,
EcoRI; N, NcoI; K, KpnI; B,
BglII.
|
|

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 2.
Sodium dodecyl sulfate-polyacrylamide gel
electrophoresis of sedimented virus particles released from FL4 cells
persistently infected with FIV-PET (lane1), mock-transfected CrFK cells
(lane 2), CrFK cells transfected with the F-14 molecular clone (lane
3), and CrFK cells transfected with the FIV RT construct (lane 4).
|
|
DNA vaccination with FIV
RT induces a virus-specific CTL
response.
In the first vaccine trial of FIV
RT, three
groups of five cats were immunized with DNA comprising
either FIV
RT, FIV
RT in conjunction with IFN-
, or IFN-
alone. A fourth control group received no DNA. A line diagram depicting
the schedule is shown in Fig. 3.
Virus-specific CTL responses were first detected in unstimulated
peripheral blood three weeks following the first immunization. Gag- and
Env-specific CTL responses were observed in all cats immunized with
FIV
RT (Fig. 4a), although the
magnitude of the response varied between individual animals, as might
be expected given the outbred nature of the study population, with higher levels of 51Cr release observed in cats A481 to A483
than in cats A484 and A485. However, in all cats the observed lysis
exceeded 10% at an E/T ratio of 50:1. The CTL activity was not
observed when allogeneic target cells were used in the assay,
suggesting that the observed activity was major histocompatibility
complex restricted. There was also no recognition of autologous target
cells infected with wild-type vaccinia virus, confirming the
specificity of the response.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 3.
Design of the two trials. Timings of immunizations and
challenges (in weeks) are represented by small and large arrows,
respectively. CTL and serological assays were performed at the
intervals denoted by the triangles and symbols representing antibodies,
respectively.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
FIV Gag- and Env-specific effector CTL responses were
measured directly on the fresh PBMC collected from vaccinated (FIV RT
[a]; FIV RT plus IFN- [b]) and control (IFN- [c]; PBS
alone [d]) cats in trial 1, 3 weeks after the first immunization.
Autologous or allogeneic skin fibroblasts infected with recombinant
vaccinia viruses expressing either FIV Gag (10) ( and
) or FIV Env (41) ( and ) or wild-type vaccinia
virus ( ) were labelled with 51Cr and used as targets in
the assay. The release of 51Cr into the culture supernatant
was detected after 4 h of incubation at 37°C. The results shown
represent the mean values for triplicate cultures at an E/T ratio of
50:1.
|
|
Coimmunization with FIV
RT and IFN-
DNA also elicited FIV Gag- and
Env-specific CTL responses in the unstimulated PBMC of all cats, and in
some of these animals higher levels of 51Cr release were
detected than in cats inoculated with FIV
RT alone (Fig. 4b).
However, these responses were not entirely major histocompatibility complex restricted since lysis of allogeneic target cells was also
observed. The nonspecific nature of the cytolytic responses observed
following IFN-
DNA immunization was also indicated by the
recognition of autologous target cells infected with wild-type vaccinia
virus. Furthermore, immunization with IFN-
DNA alone resulted in the
induction of CTL responses recognizing either autologous or allogeneic
target cells or target cells infected with wild-type vaccinia virus
(Fig. 4c), suggesting that in vivo delivery of the feline IFN-
plasmid may have stimulated a nonspecific cellular immune response. No
FIV-specific CTL activity was observed in control cats inoculated with
PBS alone (Fig. 4d).
Analysis of the CTL response 6 weeks after the initial immunization
revealed a general decline in activity (Fig.
5). This was most marked in the
group coimmunized with FIV
RT and IFN-
, in which no CTL
activity could be detected. In the FIV
RT-immunized group, although
Gag- and Env-specific CTL responses were still detectable in four of
five cats, the levels of lysis were lower than those observed
at week 3. In two of five cats (A481 and A482) in the FIV
RT group
and three of five cats (A487, A488, and A489) in the
FIV
RT-plus-IFN-
-coimmunized group, this activity remained at
background levels despite repeat inoculations of DNA. In contrast, a
transient boosting of FIV Gag-specific CTL activity was observed in the
remaining five cats at week 12, 2 weeks after the repeat DNA
inoculation administered at week 10, and in one animal (A490) a
transient increase in Env-specific CTL activity was observed before the
level declined to background levels (Fig.
6). Further boosting at week 23 had a
negligible effect on the FIV-specific effector CTL responses
detected in the peripheral blood (data not shown), and all cats
were challenged at week 26.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 5.
Detection of FIV Gag- and Env-specific CTL responses
directly in fresh PBMC collected from vaccinated (FIV RT [a];
FIV RT plus IFN- [b]) and control (IFN- [c]; PBS alone
[d]) cats in trial 1, 6 weeks after the first immunization.
Autologous or allogeneic target cell express either FIV Gag ( and
) or FIV Env ( and ) or no FIV proteins (infected with
wild-type vaccinia virus [ ]). The results shown represent the mean
51Cr release after a 4-h incubation at 37°C for
triplicate cultures at an E/T ratio of 50:1.
|
|

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
Detection of FIV Gag- and Env-specific CTL responses
directly in fresh PBMC collected from vaccinated (FIV RT [a];
FIV RT plus IFN- [b]) and control (IFN- [c]; PBS alone
[d]) cats in trial 1, 1 week after the second immunization.
Autologous or allogeneic target cells express either FIV Gag ( and
) or FIV Env ( and ) or no FIV proteins (infected with
wild-type vaccinia virus [ ]). The results shown represent the mean
51Cr release after a 4-h incubation at 37°C for
triplicate cultures at an E/T ratio of 50:1. ND, not done.
|
|
DNA immunization does not induce antiviral antibodies.
In
contrast to the CTL responses, FIV-specific antibodies were not
detected by any available test, including ELISA for the immunodominant
TM peptide and immunoblot analysis with a lysate of FIV-PET-infected
cells (Table 1). Previous studies by us
and others have demonstrated these assays to be reliable and sensitive measures of FIV-specific serological responses in naturally infected cats (19, 39). Similarly, no virus-neutralizing antibodies were detected in plasma samples taken on the day of challenge.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Titers of antibody responses to FIV TM peptide,
reactivity of plasma samples by immunoblotting, and results of
virus isolation on the day of challenge and at intervals
following challenge
|
|
FIV
RT vaccine affords protection against challenge with
infectious FIV.
In view of the apparent refractory immune state of
the vaccinated cats, we decided to test their ability to resist viral
infection. All 20 cats were challenged at week 26 with the homologous
FIV-PET isolate by intraperitoneal inoculation of 25 50% infectious
doses. The cats were monitored following challenge for the presence of infectious FIV and viral DNA and for evidence of seroconversion.
Virus isolation was attempted at 0, 3, 6, 9, and 12 weeks following
challenge. Virus was isolated from 5 of 10 control cats by week 3 postchallenge, as well as from 2 of 5 cats inoculated with FIV
RT. In
contrast, all of the cats inoculated with FIV
RT plus IFN-
remained virus free at this time, indicating that either their viral
loads were below the detection limit of the assay or infection was
delayed in this group (Table 1). At 6, 9, and 12 weeks postchallenge,
one of five FIV
RT vaccinates and three of five FIV
RT-plus-IFN-
vaccinates remained virus free. In contrast, virus was isolated
consistently from all of the control cats (IFN-
alone and no-DNA
control groups) at 6, 9, and 12 weeks postchallenge.
Since all of the cats were seronegative on the day of challenge,
positive immunoblot results and titers of antibodies recognizing the TM
peptide indicated infection. The results of serological tests confirmed
previous observations that immunoblot analysis is the more sensitive
indicator of infection in cats infected with FIV-PET (18,
32), since not all of the infected and immunoblot-positive cats developed detectable titers of anti-FIV TM peptide
antibodies by week 12 postchallenge (Table 1). Furthermore, the
immunoblot results correlated closely with virus isolation results.
Plasma from the four cats which were virus isolation negative remained negative throughout the experiment (Fig.
7). In contrast, the control groups which
received IFN-
alone or PBS all became seropositive by 6 weeks
postchallenge (Table 1).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 7.
Immunoblot analysis performed as described previously
(19) on plasma samples taken from cats 12 weeks after
challenge. (a) Trial 1 (numbered lanes) and plasma from an FIV-infected
and an unvaccinated, uninfected cat as controls (lanes + and ,
respectively). One cat in the group immunized with RT (lane 4) and
three cats in the group immunized with RT and IFN- (lanes 1, 3, and 5) remained antibody negative after challenge. (b) Trial 2 (numbered lanes) and control lanes as in panel a. Two cats (lanes 2 and
4) immunized with RT and IFN- remained antibody negative after
challenge.
|
|
A total of five FIV
RT-vaccinated cats from which virus had been
isolated at both 6 and 9 weeks postchallenge became negative at 12 weeks postchallenge, including two cats coinoculated with IFN-
DNA.
These cats remained consistently seropositive, confirming their
infected status.
Reduced levels of virus and proviral DNA in peripheral blood of
FIV
RT vaccinates.
Since there was evidence of lower viral loads
in the FIV
RT vaccinates, with inconsistent virus isolation results
and delayed seroconversion in some cats, we measured the
infectious-virus burdens in peripheral blood at 7 and 12 weeks
postchallenge. Analysis of the results (Fig.
8a) demonstrated that at week 7 there was a statistically significant difference between the groups overall (F
test, P = 0.025). However, none of the groups was
statistically significantly different pairwise (two-sample t
test, adjusted for multiple comparisons by permutation). When
aggregated to the two groups immunized with FIV
RT compared with the
two control groups, the FIV
RT vaccinates had a statistically
significantly lower log initial number of infected cells per 2 × 106 PBMC than did the controls (Fig. 8a). At week 12, pairwise contrasts between vaccinated and control groups were all
statistically significant, with P < 0.02 (i.e.,
FIV
RT compared to IFN-
, FIV
RT compared to no DNA,
FIV
RT plus IFN-
compared to IFN-
, and FIV
RT plus IFN-
compared to no DNA).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 8.
Viral loads in trial 1 at 7 weeks postchallenge (a) and
in trial 2 at 6 weeks postchallenge (b), expressed as the mean ± 2 standard errors of the mean of the log-transformed maximum-likelihood
estimates of the initial number of infected cells present in 2 × 106 PBMC.
|
|
Similar conclusions emerged from quantitative PCR analysis of
proviral DNA in PBMC. The results shown in Table
2 represent the results obtained
with the env primers, and these correlated closely with
parallel assays involving pol primers (data not shown). Although the levels of proviral DNA were low in the control cats following challenge with the F-14 molecular clone, these findings were
broadly consistent with our earlier study of cats infected with a low
dose of the FIV-PET isolate (32). Despite the low overall
levels of DNA and evidence of declining load from weeks 6 to 12, clear
differences among the four vaccine groups were evident. All of the
control cats immunized with either IFN-
or no DNA scored positive in
PCRs with 250 ng of DNA at 6 weeks, compared to only 4 of 10 FIV
RT
vaccinates. By 12 weeks postchallenge, only 6 of 10 control cats
yielded positive results from 500 ng of DNA compared to 10 of 10 at
week 6, indicating that the proviral loads later in infection are
decreased. The four cats which remained negative by virus isolation and
seronegative by immunoblotting and ELISA gave isolated, transient
positive PCR results, three at 6 weeks postinfection and one at 12 weeks. These results indicate that the proviral loads in these cats are
close to the detection limit of the assay. Of the remaining six
vaccinates, all of which yielded positive results by virus isolation
and immunoblotting, a single cat was uniformly negative by PCR, three
gave single positive PCR results at week 6 postchallenge, one
gave positive results at high DNA concentrations at weeks 6 and 12, and
the remaining cat gave positive PCR results at all DNA concentrations tested. It was notable that all of the cats in the group which received
FIV
RT and IFN-
became uniformly negative by PCR by 12 weeks
postchallenge even at the highest input of 1 µg of DNA.
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Comparison of viral loads in trial 1 at 6 and 12 weeks
postchallenge as measured by quantitative nested PCR
|
|
The FIV
RT immunization schedule can be reduced without
apparent loss of efficacy.
To investigate whether the lengthy
immunization schedule could be reduced without compromising
protection, we conducted a second experiment in which two groups
of five cats received either FIV
RT plus IFN-
or IFN-
alone
at 0, 4, and 8 weeks. As in the first trial, this regimen induced
cytolytic activity (data not shown) but no detectable antibody
responses by the same series of assays
(immunofluorescence, immunoblotting, anti-TM peptide ELISA,
and assay for virus-neutralizing antibodies). After challenge at 12 weeks, two of five vaccinates remained seronegative and virus could not
be isolated at any of the times tested (Table 1) whereas all of the
IFN-
-alone controls became seropositive and positive by virus
isolation, consistent with the results of the first trial. Again,
immunoblot analysis corroborated these findings (Fig. 7b).
Quantitative measurements of virus in the second trial (Fig. 8b)
revealed that at 6 weeks postchallenge, the FIV
RT-plus-IFN-
vaccinates developed significantly lower viral loads than did the
IFN-
vaccinates (P = 0.027). By 9 weeks postchallenge, the viral loads of all of the cats were low and there
were no differences between the groups (data not shown).
 |
DISCUSSION |
This study demonstrates that protection against FIV infection can
be achieved by intramuscular administration of nonreplicating FIV
DNA. A significant proportion of FIV
RT vaccinates was protected, and
the mean viral loads of the vaccinates were significantly reduced
compared to those of the control cats. Similar results were
obtained in a second trial in which the immunization schedule was
shorter, indicating that the interval between immunizations did not
appear to influence the protected status of vaccinated cats.
The mechanism of protection is of great interest, particularly in view
of the lack of a detectable humoral immune response in the vaccinates
prior to challenge. Our results provide an intriguing parallel
with the apparently protected status of individuals exposed to HIV who
remain seronegative but have measurable CTL responses (35,
37), suggesting that a potent cellular immune response may be
sufficient to confer immunity to infection. The induction of CTL in the
absence of a detectable humoral immune response following immunization
with the FIV
RT DNA vaccine is in contrast to the responses observed
recently following immunization of chimpanzees with a prospective HIV
DNA vaccine (4). Following immunization with a plasmid
carrying HIV env and rev under the regulatory
control of the cytomegalovirus promoter, antibodies specific for HIV
Env were detected in all four immunized animals (4).
However, it is notable that even with the protracted immunization
regime used to immunize the chimpanzees, there were marked differences
in the titers of antibodies induced following immunization. Moreover, three of the four immunized chimpanzees failed to generate a humoral response to the viral Gag protein. In this study, we were unable to
detect antibodies specific for either FIV Env or Gag proteins in the
cats immunized with either FIV
RT alone or FIV
RT in conjunction with IFN-
. In agreement with our findings, a recent study
involving FIV env gene-based DNA vaccines induced either low
or undetectable levels of FIV-specific antibodies (31).
The bias toward CTL induction rather than antibody production in
response to inoculation with FIV
RT suggested that intramuscular administration of the FIV
RT DNA generated primarily a Th1-type immune response. Given that previous studies have demonstrated that it
is possible to generate potent cellular and humoral immune responses
following immunization of macaques with plasmids expressing the
env and gag genes of SIVmac251 (24, 34,
49), there is clearly scope for further optimization of the
vaccination schedule. However, the question is then which type of
immune response is likely to confer protective immunity to challenge
with a lentivirus. The SIVmac251-based DNA vaccine neither protected
the immunized macaques from challenge with the homologous virus nor led
to a reduction in the viral load of the vaccinates
(24). Significantly, the SIVmac251 challenge is a
highly pathogenic virus; recent data suggest that the FIV-PET challenge
virus used in our study is less pathogenic than the FIV GL-8 strain
(21). Similarly, the HIV-1 SF2 challenge virus used in the
chimpanzee DNA vaccine trial does not induce disease readily in
infected animals (4). Future studies should address whether
protective immunity to infection with highly pathogenic strains of FIV
(7) can be achieved with DNA vaccines.
CTL activity to FIV Env was shown previously to correlate with
long-lived immunity induced by whole inactivated virus vaccines (11). In the present study, there was no clear correlation
between the elicitation of Env- or Gag-specific CTL responses in the
peripheral blood of vaccinated cats and the protection observed
following challenge, since qualitatively similar CTL responses were
detected in both protected and unprotected cats within each vaccine
group. Future studies will address the contribution of CTL responses with other viral specificities in protective immunity and will investigate the sequestration of virus-specific CTLs to the lymphoid organs, which may explain the rather short-lived CTL responses observed
in the peripheral blood. It should now be possible to identify the
critical targets for the protective immune response by selective gene
inactivation. Given that immunization of cats with FIV env
gene-based DNA vaccines resulted in enhancement of infection following
challenge (31), it is possible that regulatory gene products
expressed by the FIV
RT DNA vaccine contributed to its greater
efficacy.
A greater proportion of the cats in the group inoculated with IFN-
in conjunction with FIV
RT was protected following challenge compared
to the proportion in the group inoculated with FIV
RT alone,
suggesting that IFN-
may have enhanced the protective effect of
FIV
RT. IFN-
is a pleiotropic immune regulator which is depressed
in progressive HIV infection and has been reported to be inversely
correlated with lymph node virus load in primary SIV infection of
macaques (23). Although recombinant IFN-
is being
investigated widely as a therapeutic agent (15), its use as
a gene adjuvant has been limited so far. Interestingly, replacement of
the nef gene in infectious SIVmac with a human IFN-
gene
was recently found to cause further attenuation of the virus and to enhance protection against superinfection with virulent virus (14). Whether these effects are mediated by specific or
nonspecific immune mechanisms remains to be determined.
Our results raise wider questions about the role of antibodies in
natural and vaccinal immunity to lentiviruses. Hitherto, our assumption
has been that vaccines should stimulate the broadest possible range of
effector mechanisms, and our previous studies with whole inactivated
FIV vaccines demonstrated that neutralizing antibodies correlated with
protection (16). However, previous studies have described
enhancement of FIV infection following immunization with prospective
vaccines, including subunit vaccines and a DNA vaccine expressing a
limited range of FIV gene products (20, 31, 40). Further
studies are necessary to account for the different outcomes of these
vaccine experiments compared to the present study and to allow
extrapolation of these findings to other immunosuppressive lentiviruses
such as HIV in human beings.
 |
ACKNOWLEDGMENTS |
This work was supported by the U.K. Medical Research Council and
the EC Concerted Action, FAVEUR. T. Miyazawa received a fellowship from the Japanese Society for the Promotion of Science.
We are grateful to P. Johnson, NIAID, NIH, for kindly providing the F14
molecular clone; N. Pedersen, University of California at Davis, for
kindly providing monoclonal antibody 43/1B9; and J. Norrie, Robertson
Centre for Biostatistics, University of Glasgow, for the statistical
analyses. J. Cole, R. Irvine, and V. Dale are also thanked for their
assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Retrovirus
Research Laboratory, Department of Veterinary Pathology, University of
Glasgow, Bearsden, Glasgow G61 1QH, United Kingdom. Phone: 44 141 330 3274. Fax: 44 141 330 5602. E-mail:
m.hosie{at}vet.gla.ac.uk.
Present address: Department of Veterinary Microbiology, Faculty of
Agriculture, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113, Japan.
 |
REFERENCES |
| 1.
|
Argyle, D. J.,
K. Smith,
K. McBride,
R. Fulton, and D. E. Onions.
1995.
Nucleotide and predicted peptide sequence of feline interferon-gamma (IFN-gamma).
DNA Sequence
5:169-171[Medline].
|
| 2.
|
Avrameas, A.,
A. D. Strosberg,
A. Moraillon,
P. Sonigo, and G. Pancino.
1993.
Serological diagnosis of feline immunodeficiency virus (FIV) infection based on synthetic peptides from Env glycoproteins.
Res. Virol.
144:209-218[Medline].
|
| 3.
|
Baba, T. W.,
Y. S. Jeong,
D. Penninck,
R. Bronson,
M. F. Greene, and R. M. Ruprecht.
1995.
Pathogenicity of live attenuated SIV after mucosal infection of neonatal macaques.
Science
267:1820-1825[Abstract/Free Full Text].
|
| 4.
|
Boyer, J. D.,
K. E. Ugen,
B. Wang,
M. Agadjanyan,
L. Gilbert,
M. L. Bagarazzi,
M. Chattergoon,
P. Frost,
A. Javadian,
W. Williams,
Y. Refaeli,
R. B. Ciccarelli,
D. McCallus,
L. Coney, and D. B. Weiner.
1997.
Protection of chimpanzees from high dose heterologous HIV-1 challenge by DNA vaccination.
Nat. Med.
3:526-532[Medline].
|
| 5.
|
Crandell, R. A.,
C. G. Fabricant, and W. A. Nelson-Rees.
1973.
Development, characterisation and virus susceptibility of a feline (Felis catus) renal cell line (CRFK).
In Vitro
9:176-185[Medline].
|
| 6.
|
Daniel, M. D.,
F. Kirchhoff,
S. C. Czajak,
P. K. Sehgal, and R. C. Desrosiers.
1992.
Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene.
Science
258:1938-1941[Abstract/Free Full Text].
|
| 7.
|
Diehl, L. J.,
C. K. Mathiason-DuBard,
L. L. O'Neil,
L. Obert, and E. A. Hoover.
1995.
Induction of accelerated feline immunodeficiency virus disease by acute-phase virus passage.
J. Virol.
69:6149-6157[Abstract].
|
| 8.
|
Fauci, A. S.
1988.
The human immunodeficiency virus: infectivity and mechanisms of pathogenesis.
Science
239:617-622[Abstract/Free Full Text].
|
| 9.
|
Flynn, J. N.,
J. A. Beatty,
C. A. Cannon,
E. B. Stephens,
M. J. Hosie,
J. C. Neil, and O. Jarrett.
1995.
Involvement of gag- and env- specific cytotoxic T lymphocytes in protective immunity to feline immunodeficiency virus.
AIDS Res. Hum. Retroviruses
11:1107-1113[Medline].
|
| 10.
|
Flynn, J. N.,
C. A. Cannon,
G. Reid,
M. A. Rigby,
J. C. Neil, and O. Jarrett.
1995.
Induction of feline immunodeficiency virus-specific cell-mediated and humoral immune responses following immunization with a multiple antigenic peptide from the envelope V3 domain.
Immunology
85:171-175[Medline].
|
| 11.
|
Flynn, J. N.,
P. Keating,
M. J. Hosie,
M. Mackett,
E. B. Stephens,
J. A. Beatty,
J. C. Neil, and O. Jarrett.
1996.
Env-specific CTL predominate in cats protected from FIV infection by vaccination.
J. Immunol.
157:3658-3665[Abstract].
|
| 12.
|
Fontenot, J. D.,
E. A. Hoover,
J. H. Elder, and R. C. Montelaro.
1992.
Evaluation of feline immunodeficiency virus and feline leukaemia virus transmembrane peptides for serological diagnosis.
J. Clin. Microbiol.
30:1885-1890[Abstract/Free Full Text].
|
| 13.
|
Gerdts, V.,
A. Jons,
B. Makoschey,
N. Visser, and T. C. Mettenleiter.
1997.
Protection of pigs against Aujeszky's disease by DNA vaccination.
J. Gen. Virol.
78:2139-2146[Abstract].
|
| 14.
|
Giavedoni, L.,
S. Ahmad,
L. Jones, and T. Yilma.
1997.
Expression of gamma-interferon by simian immunodeficiency virus increases attenuation and reduces postchallenge virus load in vaccinated rhesus macaques.
J. Virol.
71:866-872[Abstract].
|
| 15.
|
Holyoake, T. L.
1996.
Cytokines at the research-clinical interface potential applications.
Blood Rev.
10:189-200[Medline].
|
| 16.
|
Hosie, M.,
R. Osborne,
J. K. Yamamoto,
J. C. Neil, and O. Jarrett.
1995.
Protection against homologous but not heterologous challenge induced by inactivated feline immunodeficiency virus vaccines.
J. Virol.
69:1253-1255[Abstract].
|
| 17.
|
Hosie, M. J.,
T. H. Dunsford,
A. de Ronde,
B. J. Willett,
C. A. Cannon,
J. C. Neil, and O. Jarrett.
1996.
Suppression of virus burden by immunisation with feline immunodeficiency virus Env protein.
Vaccine
14:405-411[Medline].
|
| 18.
|
Hosie, M. J., and J. N. Flynn.
1996.
Feline immunodeficiency virus vaccination: characterization of the immune correlates of protection.
J. Virol.
70:7561-7568[Abstract].
|
| 19.
|
Hosie, M. J., and O. Jarrett.
1990.
Serological responses of cats to feline immunodeficiency virus.
AIDS
4:215-220[Medline].
|
| 20.
|
Hosie, M. J.,
R. Osborne,
G. Reid,
J. C. Neil, and O. Jarrett.
1992.
Enhancement after feline immunodeficiency virus vaccination.
Vet. Immunol. Immunopathol.
35:191-198[Medline].
|
| 21.
| Hosie, M. J., B. J. Willett, T. H. Dunsford, C. A. Robertson, C. A. Cannon, J. C. Neil, and
O. Jarrett. Unpublished data.
|
| 22.
|
Israel, Z. R.,
P. F. Edmonson,
D. H. Maul,
S. P. O'Neil,
S. P. Mossman,
C. Thiriart,
L. Fabry,
O. Van Opstal,
C. Bruck,
F. Bex,
A. Burny,
P. N. Fultz,
J. I. Mullins, and E. A. Hoover.
1994.
Incomplete protection, but suppression of virus burden, elicited by subunit simian immunodeficiency virus vaccines.
J. Virol.
68:1843-1853[Abstract/Free Full Text].
|
| 23.
|
Khatissian, E.,
V. Monceaux,
M. C. Cumont,
L. Montagnier,
B. Hurtrel, and L. Chakrabarti.
1996.
Interferon-gamma expression in macaque lymph nodes during primary infection with simian immunodeficiency virus.
Cytokine
8:844-852[Medline].
|
| 24.
|
Lu, S.,
J. Arthos,
D. C. Montefiori,
Y. Yasutomi,
K. Manson,
F. Mustafa,
E. Johnson,
J. C. Santoro,
J. Wissink,
J. I. Mullins,
J. R. Haynes,
N. L. Letvin,
M. Wyand, and H. L. Robinson.
1996.
Simian immunodeficiency virus-DNA vaccine trial in macaques.
J. Virol.
70:3978-3991[Abstract].
|
| 25.
|
Lu, S.,
J. C. Santoro,
D. H. Fuller,
J. R. Haynes, and H. L. Robinson.
1995.
Use of DNAs expressing HIV-1 Env and noninfectious HIV-1 particles to raise antibody-responses in mice.
Virology
209:147-154[Medline].
|
| 26.
|
McCullagh, P., and J. A. Nelder.
1989.
Generalized linear models, p. 11-12.
Chapman & Hall, London, United Kingdom.
|
| 27.
|
Miyazawa, T. M.,
T. Furuya,
S. Itagaki,
Y. Tohya,
E. Takahashi, and T. Mikami.
1989.
Establishment of a feline T-lymphoblastoid cell line highly sensitive for replication of feline immunodeficiency virus.
Arch. Virol.
108:131-135[Medline].
|
| 28.
|
Olmsted, R. A.,
V. M. Hirsch,
R. H. Purcell, and P. R. Johnson.
1989.
Nucleotide sequence analysis of feline immunodeficiency virus: genome organization and relationship to other lentiviruses.
Proc. Natl. Acad. Sci. USA
86:8088-8092[Abstract/Free Full Text].
|
| 29.
|
Osborne, R.,
M. Rigby,
K. Siebelink,
J. C. Neil, and O. Jarrett.
1994.
Virus neutralization reveals antigenic variation among feline immunodeficiency virus isolates.
J. Gen. Virol.
75:3641-3645[Abstract/Free Full Text].
|
| 30.
|
Pancino, G.,
C. Chappey,
W. Saurin, and P. Sonigo.
1993.
B epitopes and selection pressures in feline immunodeficiency virus envelope glycoproteins.
J. Virol.
67:664-672[Abstract/Free Full Text].
|
| 31.
|
Richardson, J.,
A. Moraillon,
S. Baud,
A.-M. Cuisinier,
P. Sonigo, and G. Pancino.
1997.
Enhancement of feline immunodeficiency virus (FIV) infection after DNA vaccination with the FIV envelope.
J. Virol.
71:9640-9649[Abstract].
|
| 32.
|
Rigby, M. A.,
M. J. Hosie,
B. J. Willett,
N. Mackay,
M. McDonald,
C. Cannon,
T. Dunsford,
O. Jarrett, and J. C. Neil.
1997.
Comparative efficiency of feline immunodeficiency virus infection by DNA inoculation.
AIDS Res. Hum. Retroviruses
13:405-412[Medline].
|
| 33.
|
Robinson, H. L.,
L. A. Hunt, and R. G. Webster.
1993.
Protection against a lethal influenza virus challenge by immunization with a hemagglutinin-expressing plasmid DNA.
Vaccine
11:957-960[Medline].
|
| 34.
|
Robinson, H. L.,
S. Lu,
F. Mustafa,
E. Johnson,
J. C. Santoro,
J. Arthos,
J. Winsink,
J. I. Mullins,
D. Montefiori,
Y. Yasutomi,
N. L. Letvin,
J. R. Haynes,
K. Manson, and M. Wyand.
1995.
Simian immunodeficiency virus-DNA vaccine trial in macaques.
Ann. N.Y. Acad. Sci.
772:209-211[Medline].
|
| 35.
|
Rowland-Jones, S. L.,
J. Sutton,
K. Ariyoshi,
T. Dong,
F. Gotch,
S. McAdam,
D. Whitby,
S. Sabally,
A. Gallimore,
T. Corrah,
M. Takiguchi,
T. Schulz,
A. McMichael, and H. Whittle.
1995.
HIV-specific cytotoxic T-cells in HIV-exposed but uninfected Gambian women.
Nat. Med.
1:59-64[Medline].
|
| 36.
|
Sakaguchi, M.,
H. Nakamura,
K. Sonoda,
F. Hamamda, and K. Hirai.
1996.
Protection of chickens from Newcastle disease by vaccination with a linear plasmid DNA expressing the F protein of Newcastle disease virus.
Vaccine
14:747-752[Medline].
|
| 37.
|
Shearer, G. M., and M. Clerici.
1996.
Protective immunity against HIV infection: has nature done the experiment for us?
Immunol. Today
17:21-24[Medline].
|
| 38.
|
Shiver, J. W.,
M. E. Davies,
H. C. Perry,
D. C. Freed, and M. A. Liu.
1996.
Humoral and cellular immunities elicited by HIV-1 DNA vaccination.
J. Pharm. Sci.
85:1317-1324[Medline].
|
| 39.
|
Sibille, P.,
A. Avrameas,
A. Moraillon,
J. Richardson,
P. Sonigo,
G. Pancino, and A. D. Strosberg.
1995.
Comparison of serological tests for the diagnosis of feline immunodeficiency virus infection of cats.
Vet. Microbiol.
45:259-267[Medline].
|
| 40.
|
Siebelink, K. H. J.,
E. Tijhaar,
R. C. Huisman,
W. Huisman,
A. de Ronde,
I. H. Darby,
M. J. Francis,
G. F. Rimmelzwaan, and A. D. M. E. Osterhaus.
1995.
Enhancement of feline immunodeficiency virus infection after immunization with envelope glycoprotein subunit vaccines.
J. Virol.
69:3704-3711[Abstract].
|
| 41.
|
Stephens, E. B.,
E. J. Butfiloski, and E. Monck.
1992.
Analysis of the amino terminal presequence of the feline immunodeficiency virus glycoprotein: effect of deletions on the intracellular transport of gp95.
Virology
190:569-578[Medline].
|
| 42.
|
Ulmer, J. B.,
J. C. Sadoff, and M. A. Liu.
1996.
DNA vaccines.
Curr. Opin. Immunol.
8:531-536[Medline].
|
| 43.
|
Wang, B.,
J. Boyer,
V. Srikantan,
L. Coney,
R. Carrano,
C. Phan,
M. Merva,
K. Dang,
M. Agadjanan,
L. Gilbert,
K. E. Ugen,
W. V. Williams, and D. B. Weiner.
1993.
DNA inoculation induces neutralizing immune responses against human immunodeficiency virus type-1 in mice and non-human primates.
DNA Cell Biol.
12:799-805[Medline].
|
| 44.
|
Willett, B.,
M. J. Hosie,
T. Dunsford,
J. C. Neil, and O. Jarrett.
1991.
Productive infection of helper T lymphocytes with FIV is accompanied by reduced expression of CD4.
AIDS
5:1469-1475[Medline].
|
| 45.
|
Willett, B. J.,
J. N. Flynn, and M. J. Hosie.
1997.
FIV infection of the domestic cat: an animal model for AIDS.
Immunol. Today
18:182-189[Medline].
|
| 46.
|
Wyand, M. S.,
K. H. Manson,
M. Garcia-Moll,
D. Montefiori, and R. Desrosiers.
1996.
Vaccine protection by a triple deletion mutant of simian immunodeficiency virus.
J. Virol.
70:3724-3733[Abstract].
|
| 47.
|
Yamamoto, J. K.,
C. D. Ackley,
H. Zochlinski,
H. Louie,
E. Pembroke,
M. Torten,
H. Hansen,
R. Munn, and T. Okuda.
1991.
Development of IL-2-independent feline lymphoid cell lines chronically infected with feline immunodeficiency viruses: importance for diagnostic reagents and vaccines.
Intervirology
32:361-375[Medline].
|
| 48.
|
Yamamoto, J. K.,
T. Okuda,
C. D. Ackley,
H. Louie,
E. Pembroke,
H. Zochlinski,
R. J. Munn, and M. B. Gardner.
1991.
Experimental vaccine protection against feline immunodeficiency virus.
AIDS Res. Hum. Retroviruses
7:911-921[Medline].
|
| 49.
|
Yasutomi, Y.,
H. L. Robinson,
S. Lu,
F. Mustafa,
C. Lekutis,
J. Arthos,
J. I. Mullins,
G. Voss,
K. Manson,
M. Wyand, and N. L. Letvin.
1996.
Simian immunodeficiency virus-specific cytotoxic T-lymphocyte induction through DNA vaccination of rhesus monkeys.
J. Virol.
70:678-681[Abstract].
|
Journal of Virology, September 1998, p. 7310-7319, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sun, S.-Q., Liu, X.-T., Guo, H.-C., Yin, S.-H., Shang, Y.-J., Feng, X., Liu, Z.-X., Xie, Q.-G.
(2007). Protective immune responses in guinea pigs and swine induced by a suicidal DNA vaccine of the capsid gene of swine vesicular disease virus. J. Gen. Virol.
88: 842-848
[Abstract]
[Full Text]
-
Gupta, S., Leutenegger, C. M., Dean, G. A., Steckbeck, J. D., Cole, K. S., Sparger, E. E.
(2007). Vaccination of Cats with Attenuated Feline Immunodeficiency Virus Proviral DNA Vaccine Expressing Gamma Interferon. J. Virol.
81: 465-473
[Abstract]
[Full Text]
-
Broche-Pierre, S., Richardson, J., Moraillon, A., Sonigo, P.
(2005). Evaluation of live feline immunodeficiency virus vaccines with modified antigenic properties. J. Gen. Virol.
86: 2495-2506
[Abstract]
[Full Text]
-
Pistello, M., Matteucci, D., Bonci, F., Isola, P., Mazzetti, P., Zaccaro, L., Merico, A., Del Mauro, D., Flynn, N., Bendinelli, M.
(2003). AIDS Vaccination Studies Using an Ex Vivo Feline Immunodeficiency Virus Model: Protection from an Intraclade Challenge Administered Systemically or Mucosally by an Attenuated Vaccine. J. Virol.
77: 10740-10750
[Abstract]
[Full Text]
-
Akahata, W., Ido, E., Akiyama, H., Uesaka, H., Enose, Y., Horiuchi, R., Kuwata, T., Goto, T., Takahashi, H., Hayami, M.
(2003). DNA vaccination of macaques by a full-genome simian/human immunodeficiency virus type 1 plasmid chimera that produces non-infectious virus particles. J. Gen. Virol.
84: 2237-2244
[Abstract]
[Full Text]
-
Steinrigl, A., Klein, D.
(2003). Phylogenetic analysis of feline immunodeficiency virus in Central Europe: a prerequisite for vaccination and molecular diagnostics. J. Gen. Virol.
84: 1301-1307
[Abstract]
[Full Text]
-
Hosie, M. J., Willett, B. J., Klein, D., Dunsford, T. H., Cannon, C., Shimojima, M., Neil, J. C., Jarrett, O.
(2002). Evolution of Replication Efficiency following Infection with a Molecularly Cloned Feline Immunodeficiency Virus of Low Virulence. J. Virol.
76: 6062-6072
[Abstract]
[Full Text]
-
Flynn, J. N., Dunham, S. P., Watson, V., Jarrett, O.
(2002). Longitudinal Analysis of Feline Leukemia Virus-Specific Cytotoxic T Lymphocytes: Correlation with Recovery from Infection. J. Virol.
76: 2306-2315
[Abstract]
[Full Text]
-
Hanlon, L., Argyle, D., Bain, D., Nicolson, L., Dunham, S., Golder, M. C., McDonald, M., McGillivray, C., Jarrett, O., Neil, J. C., Onions, D. E.
(2001). Feline Leukemia Virus DNA Vaccine Efficacy Is Enhanced by Coadministration with Interleukin-12 (IL-12) and IL-18 Expression Vectors. J. Virol.
75: 8424-8433
[Abstract]
[Full Text]
-
Gorelick, R. J., Benveniste, R. E., Lifson, J. D., Yovandich, J. L., Morton, W. R., Kuller, L., Flynn, B. M., Fisher, B. A., Rossio, J. L., Piatak, M. Jr., Bess, J. W. Jr., Henderson, L. E., Arthur, L. O.
(2000). Protection of Macaca nemestrina from Disease following Pathogenic Simian Immunodeficiency Virus (SIV) Challenge: Utilization of SIV Nucleocapsid Mutant DNA Vaccines with and without an SIV Protein Boost. J. Virol.
74: 11935-11949
[Abstract]
[Full Text]
-
Leutenegger, C. M., Boretti, F. S., Mislin, C. N., Flynn, J. N., Schroff, M., Habel, A., Junghans, C., Koenig-Merediz, S. A., Sigrist, B., Aubert, A., Pedersen, N. C., Wittig, B., Lutz, H.
(2000). Immunization of Cats against Feline Immunodeficiency Virus (FIV) Infection by Using Minimalistic Immunogenic Defined Gene Expression Vector Vaccines Expressing FIV gp140 Alone or with Feline Interleukin-12 (IL-12), IL-16, or a CpG Motif. J. Virol.
74: 10447-10457
[Abstract]
[Full Text]
-
Wang, S.-W., Kozlowski, P. A., Schmelz, G., Manson, K., Wyand, M. S., Glickman, R., Montefiori, D., Lifson, J. D., Johnson, R. P., Neutra, M. R., Aldovini, A.
(2000). Effective Induction of Simian Immunodeficiency Virus-Specific Systemic and Mucosal Immune Responses in Primates by Vaccination with Proviral DNA Producing Intact but Noninfectious Virions. J. Virol.
74: 10514-10522
[Abstract]
[Full Text]
-
Hosie, M. J., Dunsford, T., Klein, D., Willett, B. J., Cannon, C., Osborne, R., MacDonald, J., Spibey, N., Mackay, N., Jarrett, O., Neil, J. C.
(2000). Vaccination with Inactivated Virus but Not Viral DNA Reduces Virus Load following Challenge with a Heterologous and Virulent Isolate of Feline Immunodeficiency Virus. J. Virol.
74: 9403-9411
[Abstract]
[Full Text]
-
Reichert, M., Cantor, G. H., Willems, L., Kettmann, R.
(2000). Protective effects of a live attenuated bovine leukaemia virus vaccine with deletion in the R3 and G4 genes. J. Gen. Virol.
81: 965-969
[Abstract]
[Full Text]
-
Woodberry, T., Gardner, J., Mateo, L., Eisen, D., Medveczky, J., Ramshaw, I. A., Thomson, S. A., Ffrench, R. A., Elliott, S. L., Firat, H., Lemonnier, F. A., Suhrbier, A.
(1999). Immunogenicity of a Human Immunodeficiency Virus (HIV) Polytope Vaccine Containing Multiple HLA A2 HIV CD8+ Cytotoxic T-Cell Epitopes. J. Virol.
73: 5320-5325
[Abstract]
[Full Text]