Previous Article | Next Article 
Journal of Virology, September 1998, p. 7263-7269, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Equine Infectious Anemia Virus Is Found in Tissue
Macrophages during Subclinical Infection
J. Lindsay
Oaks,1,*
Travis C.
McGuire,1
Catherine
Ulibarri,2 and
Timothy B.
Crawford1
Departments of Veterinary Microbiology and
Pathology1 and
Veterinary and
Comparative Anatomy, Pharmacology and
Physiology,2 Washington State University,
Pullman, Washington 99164
Received 1 October 1997/Accepted 27 May 1998
 |
ABSTRACT |
The equine infectious anemia virus (EIAV) often results in lifelong
subclinical infection following early episodes of clinical disease. To
identify the cellular reservoirs of EIAV during subclinical infection,
horses were infected with EIAV and allowed to develop subclinical
infections. Horses with acute disease served as a basis for comparison.
The tissue distribution, replication status, location of infected
cells, and viral load were characterized by PCR for proviral DNA and
reverse transcriptase PCR for viral RNA, in situ hybridization, and in
situ PCR. Proviral DNA was widespread in tissues regardless of disease
status. Viral gag and env RNAs were also
detected in tissues of all horses regardless of disease status. Plasma
viral RNA (viremia) could be detected in some, but not all, horses with
subclinical infections. In situ assays determined that a primary
cellular reservoir and site of viral replication during subclinical
infection is the macrophage. During subclinical infection, viral load
was decreased 4- to 733-fold and there was decreased viral RNA
expression within infected cells. These data indicate that viral
replication continues at all times, even in horses that are clinically
quiescent. Moreover, restricted viral replication at the cellular level
is associated with clinical remission.
 |
INTRODUCTION |
The factors that control the
expression of clinical disease remain a poorly understood aspect of
lentiviral pathogenesis. Salient features of lentiviral infections
include lifelong persistence and prolonged periods of subclinical
infection followed by progressive disease. However, in some proportion
of infected domestic animals (6), nonhuman primates (6,
22), and possibly humans (4, 38), clinical disease
never develops. The basis for the control of clinical lentiviral
disease within a given host has not been fully established. Subclinical
human immunodeficiency virus type 1 (HIV-1) and simian immunodeficiency
virus (SIV) infections are generally associated with reductions in
viral load relative to initial infection and clinical AIDS, although
viremia remains consistently detectable, indicative of continuing viral
replication (1, 13, 18, 21, 34). Long-term subclinical HIV-1
infections have been associated with polymorphisms in HIV-1 chemokine
coreceptors which affect viral tropism (10, 46), strong
HIV-1-specific cell-mediated immune responses (7), and
defective viruses (26). However, virus is not eliminated,
and the long-term prognosis for these patients has not been determined
(4, 38). In contrast, SIV infections of the natural primate
host are completely apathogenic, even in the face of continuous viral
replication (21). Infections with the ungulate lentiviruses
ovine visna virus and caprine arthritis-encephalitis virus do not
always result in clinical disease. However, the disease course is
progressive if clinical signs do appear (6, 11).
Cellular reservoirs for lentiviruses include cells of the
monocyte-macrophage lineage (6). Reservoirs for the
immunodeficiency viruses also include latently infected lymphocytes
(14) and virus sequestered on the processes of follicular
dendritic cells (16). With the non-lymphocyte-tropic
ungulate lentiviruses, disease signs are referable to infected
macrophages and inflammatory lesions (6). Macrophages are
also important as reservoirs, as restricted viral replication in these
cells may allow the virus to avoid immunologic detection and may
facilitate viral dissemination as "Trojan horses" (6, 17,
39).
Infection of horses with the equine infectious anemia virus
(EIAV), a lentivirus, is characterized clinically by recurrent episodes
of fever, anemia, and thrombocytopenia (reviewed in reference 43). Some horses die from either acute or chronic
clinical disease. However, in most horses, disease episodes
progressively decrease in frequency and intensity over about a year,
after which the animals remain clinically normal (43). Acute
episodes of clinical equine infectious anemia (EIA) are associated with
extensive viral replication in tissue macrophages (5, 32)
and readily detectable viremia (12, 20, 27, 47). In
contrast, during subclinical EIAV infections, more sensitive techniques
such as PCR are required to detect viral nucleic acids in tissues
(25) and plasma (28), or inoculation of
susceptible horses is needed to detect viral infectivity (8, 15,
20, 36). Thus, EIAV is similar to HIV-1 and SIV in that initial
extensive viral replication is followed by a reduction in viral load
(13, 18, 22). EIAV is distinct, however, in that many horses
effectively suppress clinical disease following the onset of clinical
signs, even when infected with highly virulent strains (25).
This feature makes EIAV a useful model for the examination of a
lentiviral infection in which disease can be successfully controlled.
Since the sites and mechanisms of EIAV persistence have not been
clearly defined, the purpose of this study was to identify the cellular
reservoirs of EIAV in vivo during subclinical infection. The presence
of viral replication and the amount of virus present were also
evaluated.
 |
MATERIALS AND METHODS |
Animals, viruses, and clinical parameters.
Seven horses were
infected intravenously with EIAV. Four horses (three Arabian foals and
one adult pony) were infected with the highly virulent Wyoming strain
of EIAV (EIAVWyo); two with 106 and one horse
each with 103 and 101 horse infectious doses.
The lower doses were used to reduce dose-dependent mortality
(23). Three horses (one Arabian foal and two ponies) were
infected intravenously with 106 50% tissue culture
infectious doses of the WSU5 strain of EIAV (EIAVWSU5).
EIAVWSU5 is an equine dermal fibroblast-adapted
(29), pony-passaged (37) variant of
EIAVWyo that is less virulent than EIAVWyo.
Physical examinations, rectal temperatures, hemograms, and platelet
counts were performed daily during clinical episodes and intermittently
during chronic clinical disease or subclinical infection. Serum,
plasma, and peripheral blood mononuclear cell (PBMC) samples were
collected, processed, and stored at
80°C until needed. Necropsy
tissues were fixed for 48 h in 4% paraformaldehyde and paraffin
embedded. Replicate samples of unfixed tissues were snap-frozen in
liquid nitrogen and stored at
80°C.
Nucleic acid extractions, PCR, and reverse transcriptase PCR
(RT-PCR).
DNA from tissue and PBMC was extracted by using
proteinase K digestion and a commercial extraction system (Stratagene
DNA extraction kit), phenol-chloroform-isoamyl alcohol, and ethanol precipitation. Total RNA was extracted from tissues homogenized in a
commercial guanidinium isothiocyanate-phenol-chloroform solution (Trizol Reagent; Life Technologies), followed by additional
phenol-chloroform-isoamyl alcohol extraction and digestion with DNase.
Plasma or serum viral RNA was obtained by pelleting the virions from 1 ml of sample at 47,000 × g for 1 h at 4°C,
extracted as described above with a polysaccharide gel carrier
(Microcarrier Gel-TR; Molecular Research Center).
DNA PCR was performed on 2 or 3 µg of DNA, using a protocol modified
from that previously described (19). PCR amplification consisted of 1 cycle of 3 min at 95°C, followed by 35 to 40 cycles of
30 s at 94°C, 30 s at 56°C, and 30 s at 72°C and
then 1 cycle of 7 min at 72°C. For nested PCR, the first round was
performed as described above except that the annealing temperature was
50°C, and 1 µl of the first reaction was added to the second
reaction and amplified as described above. The oligonucleotide primers used for DNA PCR were from the capsid protein sequence of
EIAVWyo gag (40); they included
primers 854 (5' GGCTGGAAACAGAAATTTTA 3') and 1262 (5'
TAGGTTTTCCAATCATCACT 3') as internal primers and primers 636 (5' CCATTGCTGGAAGATGTAAC 3') and 1399 (5'
TGCGTTCTGAATAGTCAGTG 3') as flanking primers. RT-PCR for viral
RNA was performed on 2 or 3 µg of total RNA from tissues or 2 or 3 µl of RNA extracted from plasma. The assay combined reverse
transcription and PCR in a one-tube format using the PCR primers to
also initiate reverse transcription (19). RT-PCR and nested
RT-PCR for EIAV gag RNA were performed as described
above for DNA PCR except that the reaction mixture contained RNase
inhibitor and Moloney murine leukemia virus reverse transcriptase
(SuperScript II; Life Technologies), and PCR amplification was preceded
by a reverse transcription step of 40 min at 42°C. RT-PCR and nested
RT-PCR were also performed for the singly spliced message for EIAV
env by selecting primers that bridged the mRNA splice site.
This protocol was performed as described above, using the following
oligonucleotide primers as described previously (3): 297 (5' CTAGTTTGTCTGTTCGAGATCC 3') and 5470 (5'
CTTGCTTCCTTCGATTCTGCCATGCTGTTC 3') as flanking primers, with 297 and 5416 (5' GGTTGAAACATTGTGTTCTCCTCACACTTAG 3') as internal
primers. The specificity of these assays for RNA was confirmed for
positive samples by duplicate reactions without reverse transcriptase.
In situ hybridization (ISH) and immunohistochemistry.
Five-micrometer sections of paraffin-embedded tissues were mounted onto
Microprobe-Plus slides (Fisher Scientific). Deparaffinized sections
were rehydrated, permeabilized with 0.2 N HCl and 5 µg of proteinase
K per ml, acetylated with 0.25% acetic anhydride in 0.1 M
triethanolamine buffer, and rinsed in 2× SSC (1× SSC is 150 mM NaCl
and 15 mM sodium citrate). Nonspecific nucleic acid binding was blocked
by treatment with prehybridization solution [50% formamide with 310 µg of sheared herring sperm DNA, per ml, 310 µg of poly(A) per ml,
31 mM EDTA, 25 mM HEPES, 1 M NaCl, 0.25% sodium dodecyl sulfate, 125 mM dithiothreitol, and 1× Denhardt's solution). An EIAV-antisense
RNA probe was produced by in vitro transcription using T7 RNA
polymerase from pEIAp26.1 (pGEM4Z vector [Promega] containing a
450-bp fragment of EIAV gag) and labeled by
[35S]dUTP (New England Nuclear-DuPont) or
digoxigenin-dUTP (Boehringer Mannheim). Either 5 ng of
35S-labeled probe (approximately 4.5 × 106 cpm) or 100 ng of digoxigenin-labeled probe, diluted in
prehybridization solution, was hybridized to each section overnight at
42°C. Following hybridization, unbound probe was digested with 50 µg RNase A per ml, and the sections were washed in decreasing
concentrations of SSC. Bound 35S-labeled probe was detected
by autoradiography (NTB2 emulsion; Eastman Kodak) for 5 to 14 days at
80°C. Bound digoxigenin-labeled probe was detected with Boehringer
Mannheim's antidigoxigenin Fab fragments conjugated with alkaline
phosphatase, 5-bromo-4-chloro-3-indolylphosphate-nitroblue tetrazolium
chromogen (BCIP-NBT), and the Wash and Block system.
In tissues that have not been subjected to conditions that denature
DNA, the antisense
gag probe is specific for full-length
genomic viral RNA, the presence of which is suggestive of viral
replication (
5,
41,
44). Controls for specificity included
(i) hybridization on nondenatured, EIAV-infected tissues with
a
complementary-sense probe specific for proviral DNA (unavailable
for
hybridization), (ii) a nonsense probe from a gene of
Trypanosoma cruzi, and (iii) the antisense probe on uninfected tissues.
In situ PCR.
Deparaffinized tissue sections were rehydrated,
permeabilized with proteinase K (75 to 200 µg/ml) for 35 min at
37°C, rinsed in water and ethanol, and air dried. In situ PCR for
proviral DNA was performed by applying 50 µl of PCR mix (500 pmol
each of EIAV gag-specific primers 854 and 1262, 1.2 mM
each deoxynucleoside triphosphate, 4.5 mM MgCl2, and 20 U
of Taq DNA polymerase in Perkin-Elmer PCR II buffer) to the
sections at 70°C, covering the reagents with Amplicover Discs and
Clips (Perkin-Elmer), and using the GeneAmp In Situ PCR System 1000 for
amplification as follows: 1 cycle of 4 min at 95°C for denaturation
and then 35 cycles of 1 min at 94°C, 1 min at 55°C, and 1.5 min at
72°C. Negative controls included tissues from uninfected horses and
PCR mix without Taq polymerase on infected tissues.
Following thermal cycling, sections were serially rinsed in 2× SSC,
phosphate-buffered saline, and ethanol and then air dried. DNA was
denatured by heating for 4 min at 92°C, and amplified proviral cDNA
was detected by ISH as described above. The probe used for the
detection of in situ PCR products was a digoxigenin-labeled,
sense-polarity RNA transcript of the same plasmid pEIAp26.1 used in
ISH experiments. The sense-orientation probe was generated by
transcription with SP6 RNA polymerase, is complementary to EIAV
gag, and because of its sense polarity is specific for
proviral DNA.
Quantitative PCR.
The copy number of proviral DNA in tissue
was determined by adaptation of a method previously described for the
quantitation of HIV-1 DNA (34). PCRs (primers 854 and 1262)
were performed in triplicate and repeated nine times for each sample.
Reaction products were visualized in ethidium bromide-stained agarose
gels, and their densities were quantitated by a commercial digital
imaging system (IS1000; Alpha Innotech). The copy number of provirus in 2 to 3 µg of tissue DNA was determined from a standard curve
constructed by performing PCR in triplicate on known copy numbers of an
EIAV-containing plasmid (33) and reported as copies per
10,000 cell-equivalents of tissue DNA. The plasmid copy number was
calculated from its mass; mass was determined by comparing band
intensities of the plasmid to dilutions of a DNA-mass standard (Life
Technologies) in an ethidium bromide-stained agarose gel. PCRs for the
test samples and plasmid were performed simultaneously, using a
reagent-master mix, and were analyzed simultaneously on a single
agarose gel.
 |
RESULTS |
Clinical disease.
All seven EIAV-infected horses
initially developed clinical disease and detectable plasma viral RNA
(viremia) (Table 1). Disease severity was
related to the virulence of the infecting viral strain and, in contrast
to a previous report (23), did not appear to be dose
dependent. Signs in all horses included fever (up to 40.8°C) and
thrombocytopenia; anemia was present in horses 2084, 2092, 2079, and
2085. Three horses (2079, 2084, and 2092) were euthanized with acute
disease; two of these (2084 and 2092) developed hemorrhagic diathesis
and were euthanized in extremis. Horse 2085 exhibited chronic EIA
(43), characterized by prolonged clinical signs (30 days),
followed by resolution of fever but persistent thrombocytopenia,
anemia, and poor body condition until necropsy at day 124 postinfection. Horse 524 experienced an initial disease episode of 14 days, followed by six episodes of recrudescent disease (fever up to
41°C and thrombocytopenia but never anemia) lasting 2 to 5 days each.
Plasma viral RNA was readily detected by RT-PCR during clinical
episodes and the intervening subclinical periods. Following
recrudescent disease, this horse remained afebrile until necropsy at
day 878. During most of the afebrile period, this horse was borderline
thrombocytopenic; however, at the time of necropsy, the platelet count
had normalized and this horse was classified as subclinically infected.
The remaining two horses (489 and 498) were necropsied at days 665 and
726, at which time they were clinically normal.
Tissue proviral DNA and viral RNA.
PCR for proviral DNA
and RT-PCR for viral RNA was performed on nucleic acids extracted from
a panel of tissues to identify the tissue reservoirs of EIAV during
acute disease and subclinical infection. In subclinically infected
horses, this was to identify infected tissues for subsequent in situ
studies. Amplicons were shown to be derived from EIAV
gag or env by sequencing. Tissues from an
uninfected control horse were negative (data not shown).
In the subclinically infected horses, not all tissues contained
sufficient proviral DNA to be detected with a single round
of PCR,
although all tissues tested (except PBMC) were positive
by nested
PCR (Table
2). RT-PCR detected viral
gag and/or
env RNA in either spleen, bone marrow,
or plasma of all three subclinically
infected horses, although levels
were sufficiently low in these
horses to require nested RT-PCR (Table
3). In the two horses
with subclinical EIAV
WSU5
infections, plasma viral RNA could not
be detected, even by using
nested RT-PCR on as much as 4 ml of
plasma. In contrast, the horses
with acute and chronic clinical
disease contained levels of proviral
DNA that were readily detected
with a single round of PCR in
PBMC, lung, spleen, lymph node,
and bone marrow (Table
2); also
strongly positive were kidney,
ileum, colon, heart, and brain (data not
shown). Viral
gag or
env RNA was readily
detected in either spleen, bone marrow, and
plasma of these horses
(Table
3). The widespread tissue distribution
of EIAV is consistent
with a number of previous reports (
5,
24,
32,
42) for horses
with acute disease and the single
report for a subclinically infected
horse examined by PCR (
25).
The presence of viral
gag and
env RNA indicates viral replication
in
the subclinically infected horses, even when EIAV is undetectable
in plasma or PBMC.
ISH and in situ PCR.
ISH for viral gag RNA
and in situ PCR for proviral gag DNA were performed to
determine the cellular tropism of EIAV. Spleens were used for in
situ experiments since this tissue, based on solution-phase PCR
results, contained readily detected levels of viral DNA and RNA in all
horses. Viral RNA-expressing cells were identified in spleens from
horses with chronic clinical disease and subclinical infection with the
virulent strain of EIAV (EIAVWyo) (Tables
3 and 4;
Fig. 1a). The locations of these infected
cells in the splenic sinusoids suggested that they were
macrophages. Viral RNA-expressing cells could not be detected in
spleens from the horses subclinically infected with the less virulent
strain (EIAVWSU5), despite numerous attempts with both
isotopic and nonisotopic ISH. Proviral DNA also could not be detected
by ISH in any tissues from horses with subclinical infections. Proviral
DNA was also undetectable by ISH in tissues from acutely infected
horses, including tissues in which viral RNA was easily detected by
ISH, indicating that the copy number of proviral DNA per cell was below
the threshold of detection for the ISH assay. In situ PCR, however, did
detect cells containing proviral DNA in the spleens of subclinically EIAVWSU5-infected horses; the presence of
hemosiderin in some of these cells suggested that they were macrophages
(Fig. 1b). Varying the amount of protease digestion used in experiments
to identify proviral DNA in macrophages, in order to control for cell
type variation in protease digestion optima, did not reveal additional
types of infected cells. The ability to detect viral RNA (both
gag and env) by solution-phase RT-PCR, but not by
ISH, in these splenic macrophages (cells that contain levels of viral RNA readily detected by ISH during acute disease) indicates relative restriction of viral transcription at the cellular level. In situ PCR
on spleens of horses with acute or chronic clinical disease did not
identify proviral DNA in cells that differed in location, morphology,
or numbers from the cells expressing viral RNA (Fig. 2), suggesting unrestricted replication
during acute disease.

View larger version (83K):
[in this window]
[in a new window]
|
FIG. 1.
(a) Photomicrograph of a cell containing viral RNA
(arrow) in the spleen from a horse subclinically infected with
EIAVWyo. The cell is labeled by ISH (darkly staining
cytoplasm) for EIAV gag RNA with the digoxigenin-labeled
antisense probe and BCIP-NBT. Bar = 10 µm. (b) Photomicrograph
of two cells containing proviral DNA (solid arrows) in the spleen from
a horse subclinically infected with EIAVWSU5. The cell
is labeled by in situ PCR (darkly staining nucleus) followed by ISH for
EIAV gag cDNA with the digoxigenin-labeled sense probe
and BCIP-NBT. Note the presence of hemosiderin (open arrow) in the
cytoplasm of an infected cell, indicating that it is a macrophage.
Bar = 10 µm.
|
|

View larger version (121K):
[in this window]
[in a new window]
|
FIG. 2.
Photomicrograph of subadjacent sections from the spleen
of a horse with acute clinical EIAVWSU5 infection,
comparing the number cells containing viral RNA to the number of cells
containing viral DNA. (a) Cells containing viral RNA (darkly staining
cells) are labeled by ISH for EIAV gag RNA with the
digoxigenin-labeled antisense probe and BCIP-NBT. Bar = 50 µm.
(b) Cells containing viral DNA (darkly staining cells) are labeled by
in situ PCR followed by ISH for EIAV gag cDNA with the
digoxigenin-labeled sense probe and BCIP-NBT. Bar = 50 µm. Note
the similar numbers of labeled cells in the sections, indicating that
most or all infected cells are replicating virus during clinical
disease.
|
|
During acute disease, viral RNA-containing cells were present
in tissues from all major organ systems in all infected horses.
ISH
with control (sense and nonsense) probes, and with the antisense
probe
on tissues from an uninfected horse, did not detect significant
nonspecific hybridization. Consistent with previous reports (
5,
32), viral RNA-containing cells were predominantly macrophages,
based on their location, morphology, and coexpression of lysozyme
in
dual-labeling experiments (
35). Viral RNA-containing
endothelial
cells were also identified (
35). Spleens
contained large numbers
of infected macrophages (Table
4) in the
sinusoids and lymphoid
germinal centers. A diffuse hybridization
pattern in germinal
centers suggested viral trapping on the processes
of dendritic
cells (Fig.
3a) (
2,
14,
16). Lymph nodes, in contrast,
did not contain large numbers of
infected cells or have preferential
hybridization in lymphoid follicles
(Fig.
3b).

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 3.
Photomicrograph of spleen and lymph node from a horse
with acute clinical EIAV infection. Cells containing viral RNA
(dark silver grains) are labeled by ISH for EIAV gag
with the 35S-labeled antisense probe. (a) Germinal center
in the spleen. Note the reticular pattern of silver grains indicating
the presence of virus on the processes of follicular dendritic cells
(arrowheads), in addition to the discrete pattern of silver grains
indicating infection of individual cells (arrows). Bar = 20 µm.
(b) Germinal center in the lymph node. Note the discrete pattern of
silver grains indicating infection of individual cells (arrow) and
absence of trapping of EIAV by dendritic cells. Bar = 20 µm.
|
|
Quantitation of viral load.
The copy number of provirus in
10,000 cell-equivalents of spleen DNA was determined by PCR to compare
viral load during acute disease and subclinical infection (Table 4). An
example of a standard curve used to determine copy number of proviral
DNA is shown in Fig. 4. During
subclinical infection, the copy number of EIAV provirus was
decreased 4- to 733-fold in comparison to acute disease (3 to 85 copies
for subclinical infection, versus 328 to 2,200 copies for acute
disease). The horse with chronic clinical disease had a level of
proviral DNA (273 copies) that overlapped levels for horses with both
acute disease and subclinical infections. Although large standard
deviations (ranging from 52 to 120%) and the small number of horses in
each group do not allow statistical comparison, the data suggest that
subclinical EIAV infections are associated with reductions in viral
load.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
Example of a standard curve used to quantitate EIAV
gag DNA in tissues by PCR. Plasmid copy number is plotted
against densitometry units. R2, regression coefficient.
Portions of agarose gel, stained with ethidium bromide, show PCR bands
in triplicate from serial dilutions of EIAV
gag-containing plasmid. cc, copies of plasmid.
|
|
Viral load was also evaluated by using the percentage of viral
RNA-expressing spleen cells, detected by ISH, in 120 4,500-µm
2 microscope fields (Table
4). During subclinical
infection, the
percentage of infected cells was decreased 308- to
1,840-fold
in comparison to acute disease (0.77 to 4.6% for acute
disease,
versus 0.0025% for subclinical infection). The horse with
chronic
clinical disease had an intermediate percentage of infected
cells
(0.12%).
Viral load also appears to be influenced by the virulence of the
infecting viral strain. Horses with acute EIAV
Wyo
infection
(horses 2084 and 2092) had a greater viral load (based on
either
copies of provirus or RNA-expressing cells) than the horse with
acute EIAV
WSU5 infection (horse 2079). Similarly, the
horse with
subclinical EIAV
Wyo infection (horse 524)
had a greater viral
load than the horses with subclinical
EIAV
WSU5 infections (horses
489 and 498). These
differences indicate that EIAV virulence is
related to viral load
and viral replication.
 |
DISCUSSION |
The results of this study indicate that subclinical EIAV
infection is associated with (i) reductions in viral load and (ii) relative transcriptional restriction in the same cell population (tissue macrophages) that is highly permissive during acute disease. Cell types other than the macrophage do not appear to serve as reservoirs of persistence for EIAV. Infected endothelial cells, detected during acute disease (35), were not apparent during subclinical infection.
Consistent with previous reports (5, 24, 25, 32, 42),
solution-phase PCR for proviral DNA in this study showed that EIAV
is present in most tissues, even after as long as 2 years of clinical
remission. Detection of viral RNA in subclinically infected horses
indicates that viral replication occurs during subclinical infection.
The spleen appears to be a predominant site of both viral replication
and persistence. However, the spleen is not the sole site of viral
persistence during subclinical infection, as EIAV replication also
occurs in other tissues such as bone marrow. Detection of viral RNA may
not correlate with productive infection if there are
posttranscriptional blocks to viral replication, as has been reported
for visna virus (17). The detection of plasma viral RNA in
one of the subclinically infected horses (horse 524) indicates that
even if there are posttranscriptional blocks to productive
infection, they are not absolute. Thus, virologic latency is not a
requirement for EIAV persistence or subclinical infection.
Decreased viral load was also a feature of subclinical infection
in this study. The amounts of proviral DNA in 10,000 cell-equivalents of spleen DNA, and the amount of plasma viral RNA,
were markedly lower during subclinical infection than during acute
disease. These reductions in viral load are similar to those
reported between asymptomatic and immunosuppressed HIV-1-infected
patients (9, 34) but are less than the 105-fold
reduction reported for EIAV by others (25). This
discrepancy may be related to the other study's examination of liver
(not analyzed in this study due to the consistent presence of PCR
inhibitors) or the longer period of subclinical infection (23 years). Spleens from horses acutely infected with the virulent
EIAVWyo contained higher levels of proviral DNA
per unit of spleen, and higher numbers of RNA-containing cells,
than spleens from horses acutely infected with the less virulent
EIAVWSU5. This finding suggests that a determinant of
virulence for EIAVWyo is enhanced viral replication during acute disease and may be related to differences in the long
terminal repeat enhancer regions (31).
Macrophages appear to be highly permissive in vivo during acute
disease (5) and therefore likely to be rapidly eliminated by
viral cytopathology and/or the immune system. Thus, it was anticipated
that another, less permissive cell type may be a reservoir of
persistence. This, however, does not seem to be the case; the site of
viral persistence and replication during subclinical infection are
apparently macrophages. Trapping of virus by follicular dendritic cells
in spleen or lymph node was not present in horses with chronic clinical
disease or subclinical infections; thus, while EIAV appeared to be
collected on the processes of dendritic cells during high-titered viremia, these cells are not an extracellular reservoir of virus as in
HIV-1 and SIV infections (2, 16). PCR in situ was necessary to detect infected cells (proviral DNA containing) during subclinical infection; ISH was insufficiently sensitive. ISH with the
sense-polarity probe for proviral DNA, on tissue sections with
denatured DNA, was consistently negative, even in tissue sections with
readily detectable viral RNA. Since only the spleen was examined in
situ, the possibility that other, nonmonocyte/macrophage cell types in
other tissues may be sites of persistence cannot be entirely excluded.
Restricted viral transcription in macrophages was present during
subclinical infection. During acute disease, the majority of
provirus-containing cells also expressed viral RNA, suggesting productive infection and lack of transcriptional restriction in these
cells. Viral RNA was undetectable by ISH in two of the horses with
subclinical infections. It could, however, be detected by solution-phase RT-PCR. Most or all of these macrophages express levels
of viral RNA detectable by ISH during acute disease, which suggests
relative restriction of viral transcription during subclinical infection. The significance of restricted viral replication to viral
persistence, or to the genesis of antigenic variants which may initiate
recrudescent disease (27), has not been determined. The
mechanisms that downregulate transcription in vivo also have not been
determined but are likely to be important in the pathogenesis of
EIA. In vitro, EIAV can be transcriptionally upregulated during differentiation of monocytes into macrophages (30, 44) and downregulated by cytokines expressed by macrophages (45). In vivo, differences in long terminal repeat enhancer region motifs which
may affect viral transcription and virulence have also been identified
(31). Identification of the host and/or viral factors that
influence the biology of reservoir macrophages and differentiate them
from the macrophages that are highly permissive to viral replication
during acute disease will be important in the further characterization
of the mechanisms of persistence of this equine lentivirus.
 |
ACKNOWLEDGMENTS |
This study was supported by Public Health Service grants
AI01255 (J.L.O.) and AI24291 (T.C.M.) from the National Institute of
Allergy and Infectious Diseases and grant HL46651 from the National
Heart Lung and Blood Institute (T.B.C.).
We acknowledge and thank Lori Fuller, Emma Karel, Brett Graham, and
Jessica Kinney for excellent technical assistance and Susan Tornquist
for assistance with hematology.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Microbiology and Pathology, Washington State University,
P.O. Box 647040, Pullman, WA 99164-7040. Phone: (509) 335-6044. Fax: (509) 335-8529. E-mail: loaks{at}vetmed.wsu.edu.
 |
REFERENCES |
| 1.
|
Bagnarelli, P.,
S. Menzo,
A. Valenza,
A. Manzin,
M. Giacca,
F. Ancarani,
G. Scalise,
P. E. Varaldo, and M. Clementi.
1992.
Molecular profile of human immunodeficiency virus type 1 infection in symptomless patients and in patients with AIDS.
J. Virol.
66:7328-7335[Abstract/Free Full Text].
|
| 2.
|
Baskin, G. B.,
L. N. Martin,
M. Murphey-Corb,
F. S. Hu,
D. Kuebler, and B. Davison.
1995.
Distribution of SIV in lymph nodes of serially sacrificed rhesus monkeys.
AIDS Res. Hum. Retroviruses
11:273-285[Medline].
|
| 3.
|
Beisel, C. E.,
J. F. Edwards,
L. L. Dunn, and N. R. Rice.
1993.
Analysis of multiple mRNAs from pathogenic equine infectious anemia virus (EIAV) in an acutely infected horse reveals a novel protein, Ttm, derived from the carboxy terminus of the EIAV transmembrane protein.
J. Virol.
67:832-842[Abstract/Free Full Text].
|
| 4.
|
Cao, Y.,
L. Qin,
L. Zhang,
J. Safrit, and D. D. Ho.
1995.
Virologic and immunologic characterization of long-term survivors of human immunodeficiency virus type 1 infection.
N. Engl. J. Med.
332:201-208[Abstract/Free Full Text].
|
| 5.
|
Clabough-Sellon, D. C.,
S. T. Perry,
L. Coggins, and F. J. Fuller.
1992.
Wild-type equine infectious anemia virus replicates in vivo predominantly in tissue macrophages, not in peripheral blood monocytes.
J. Virol.
66:5906-5913[Abstract/Free Full Text].
|
| 6.
|
Clements, J. E., and M. C. Zink.
1996.
Molecular biology and pathogenesis of animal lentivirus infections.
Clin. Microbiol. Rev.
9:100-117[Abstract].
|
| 7.
|
Clerici, M., and G. M. Shearer.
1996.
Correlates of protection in HIV infection and the progression of HIV infection to AIDS.
Immunol. Lett.
51:69-73[Medline].
|
| 8.
|
Coggins, L.
1984.
Carriers of equine infectious anemia virus.
J. Am. Vet. Med. Assoc.
184:279-281[Medline].
|
| 9.
|
Connor, R. I.,
H. Mohri,
Y. Cao, and D. D. Ho.
1993.
Increased viral burden and cytopathicity correlate temporally with CD4+ T-lymphocyte decline and clinical progression in human immunodeficiency virus type 1-infected individuals.
J. Virol.
67:1772-1777[Abstract/Free Full Text].
|
| 10.
|
Connor, R. I.,
K. E. Sheridan,
D. Ceradini,
S. Choe, and N. R. Landau.
1997.
Change in coreceptor use correlates with disease progression in HIV-1-infected individuals.
J. Exp. Med.
185:621-628[Abstract/Free Full Text].
|
| 11.
|
Crawford, T. B., and D. S. Adams.
1981.
Caprine arthritis-encephalitis: clinical features and presence of antibody in selected goat populations.
J. Am. Vet. Med. Assoc.
178:713-719[Medline].
|
| 12.
|
Crawford, T. B.,
K. J. Wardrop,
S. J. Tornquist,
E. Reilich,
K. M. Meyers, and T. C. McGuire.
1996.
A primary production deficit in the thrombocytopenia of equine infectious anemia.
J. Virol.
70:7842-7850[Abstract].
|
| 13.
|
Daar, E. S.,
T. Moudgil,
R. D. Meyer, and D. D. Ho.
1991.
Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection.
N. Engl. J. Med.
324:961-964[Abstract].
|
| 14.
|
Embretson, J.,
M. Zupancic,
J. L. Ribas,
A. Burke,
P. Racz,
K. Tenner-Racz, and A. T. Haase.
1993.
Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS.
Nature
362:359-362[Medline].
|
| 15.
|
Evans, K. S.,
S. L. Carpenter, and M. Sevoian.
1984.
Detection of equine infectious anemia virus in horse leukocyte cultures derived from horses in various stages of equine infectious anemia viral infection.
Am. J. Vet. Res.
45:20-25[Medline].
|
| 16.
|
Fox, C. H.,
K. Tenner-Racz,
P. Racz,
A. Firpo,
P. A. Pizzo, and A. S. Fauci.
1991.
Lymphoid germinal centers are reservoirs of human immunodeficiency virus type 1 RNA.
J. Infect. Dis.
164:1051-1057[Medline].
|
| 17.
|
Gendelman, H. E.,
O. Narayan,
S. Molineaux,
J. E. Clements, and Z. Ghotbi.
1985.
Slow, persistent replication of lentiviruses: role of tissue macrophages and macrophage precursors in bone marrow.
Proc. Natl. Acad. Sci. USA
82:7086-7090[Abstract/Free Full Text].
|
| 18.
|
Grant, R. M.,
A. Kaur,
R. P. Johnson,
H. McClure,
S. Staprans, and M. B. Feniberg.
1996.
Host-virus relationships in pathogenic and nonpathogenic SIV infections, abstr. We.A, p. 400.
In
Abstracts of the XI International Conference on AIDS.
|
| 19.
|
Hamel, A. L.,
M. D. Wasylyshen, and G. P. S. Nayar.
1995.
Rapid detection of bovine viral diarrhea virus by using RNA extracted directly from assorted specimens and a one-tube reverse transcription PCR assay.
J. Clin. Microbiol.
33:287-291[Abstract].
|
| 20.
|
Hammond, S. A.,
S. J. Cook,
D. L. Lichtenstein,
C. J. Issel, and R. C. Montelaro.
1997.
Maturation of the cellular and humoral immune responses to persistent infection in horses by equine infectious anemia virus is a complex and lengthy process.
J. Virol.
71:3840-3852[Abstract].
|
| 21.
|
Hartung, S.,
K. Boller,
K. Cichutek,
S. G. Norley, and R. Kurth.
1992.
Quantitation of a lentivirus in its natural host: simian immunodeficiency virus in African green monkeys.
J. Virol.
66:2143-2149[Abstract/Free Full Text].
|
| 22.
|
Hirsch, V. M.,
G. Dapolito,
P. R. Johnson,
W. R. Elkins,
W. T. London,
R. J. Montali,
S. Goldstein, and C. Brown.
1995.
Induction of AIDS by simian immunodeficiency virus from an African green monkey: species-specific variation in pathogenicity correlates with the extent of in vivo replication.
J. Virol.
69:955-967[Abstract].
|
| 23.
|
Kemeny, L. J.,
L. O. Mott, and J. E. Pearson.
1971.
Titration of equine infectious anemia virus. Effect of dosage on incubation time and clinical signs.
Cornell Vet.
61:687-695[Medline].
|
| 24.
|
Kim, C. H., and J. W. Casey.
1992.
Genomic variation and segregation of equine infectious anemia virus during acute infection.
J. Virol.
66:3879-3882[Abstract/Free Full Text].
|
| 25.
|
Kim, C. H., and J. W. Casey.
1994.
In vivo replicative status and envelope heterogeneity of equine infectious anemia virus in an inapparent carrier.
J. Virol.
68:2777-2780[Abstract/Free Full Text].
|
| 26.
|
Kirchhoff, F.,
T. C. Greenough,
D. B. Brettler,
J. L. Sullivan, and R. C. Desrosiers.
1995.
Absence of intact nef sequences in a long-term survivor with nonprogressive HIV-1 infection.
N. Engl. J. Med.
332:228-232[Free Full Text].
|
| 27.
|
Kono, Y.
1973.
Recurrences of equine infectious anemia. Approaches to an understanding of the mechanisms, p. 175-186.
In
J. T. Bryans, and H. Gerber (ed.), Equine infectious diseases III. S. Karger, Basel, Switzerland.
|
| 28.
|
Langemeier, J. L.,
S. J. Cook,
R. F. Cook,
K. E. Rushlow,
R. C. Montelaro, and C. J. Issel.
1996.
Detection of equine infectious anemia viral RNA in plasma samples from recently infected and long-term inapparent carrier animals by PCR.
J. Clin. Microbiol.
34:1481-1487[Abstract].
|
| 29.
|
Malmquist, W. A.,
D. Barnett, and C. S. Becvar.
1973.
Production of equine infectious anemia antigen in a persistently infected cell line.
Arch. Gesamte Virusforschung.
42:361-370.
|
| 30.
|
Maury, W.
1994.
Monocyte maturation controls expression of equine infectious anemia virus.
J. Virol.
68:6270-6279[Abstract/Free Full Text].
|
| 31.
|
Maury, W.,
S. Perryman,
J. L. Oaks,
B. K. Seid,
T. Crawford,
T. McGuire, and S. Carpenter.
1997.
Localized sequence heterogeneity in the long terminal repeats of in vivo isolates of equine infectious anemia virus.
J. Virol.
71:4929-4937[Abstract].
|
| 32.
|
McGuire, T. C.,
T. B. Crawford, and J. B. Henson.
1971.
Immunofluorescence localization of equine infectious anemia virus.
Am. J. Pathol.
62:283-292[Medline].
|
| 33.
|
McGuire, T. C.,
K. I. O'Rourke,
T. V. Baszler,
S. R. Leib,
A. L. Brassfield, and W. C. Davis.
1994.
Expression of functional protease and subviral particles by vaccinia virus containing equine infectious anaemia virus gag and 5' pol genes.
J. Gen. Virol.
75:895-900[Abstract/Free Full Text].
|
| 34.
|
Michael, N. L.,
M. Vahey,
D. S. Burke, and R. R. Redfield.
1992.
Viral DNA and mRNA expression correlate with the stage of human immunodeficiency virus (HIV) type 1 infection in humans: evidence for viral replication in all stages of HIV disease.
J. Virol.
66:310-316[Abstract/Free Full Text].
|
| 35.
| Oaks, J. L., C. Ulibarri, and T. B. Crawford. Endothelial cell infection by equine infectious anemia
virus. Submitted for publication.
|
| 36.
|
O'Rourke, K. I.,
M. L. Besola, and T. C. McGuire.
1991.
Proviral sequence detected by polymerase chain reaction in peripheral blood cells of horses with equine infectious anemia lentivirus.
Arch. Virol.
117:109-119[Medline].
|
| 37.
|
O'Rourke, K. I.,
L. E. Perryman, and T. C. McGuire.
1988.
Antiviral, anti-glycoprotein and neutralizing antibodies in foals with equine infectious anaemia virus.
J. Gen. Virol.
69:667-674[Abstract/Free Full Text].
|
| 38.
|
Pantaleo, G.,
S. Menzo,
M. Vaccarezza,
C. Graziosi,
O. J. Cohen,
J. F. Demarest,
S. D. Montefiori,
J. M. Orenstein,
C. Fox,
L. K. Schrager,
J. B. Margolick,
S. Buchbinder,
J. V. Giorgi, and A. S. Fauci.
1995.
Studies in subjects with long-term nonprogressive human immunodeficiency virus infection.
N. Engl. J. Med.
332:209-216[Abstract/Free Full Text].
|
| 39.
|
Peluso, R.,
A. Haase,
L. Strowring,
M. Edwards, and P. Ventura.
1985.
A trojan horse mechanism for the spread of visna virus in monocytes.
Virology
147:231-236[Medline].
|
| 40.
|
Perry, S. T.,
M. T. Flaherty,
M. J. Kelley,
D. L. Clabough,
S. R. Tronick,
L. Coggins,
L. Whetter,
C. R. Lengel, and F. Fuller.
1992.
The surface envelope protein gene region of equine infectious anemia virus is not an important determinant of tropism in vitro.
J. Virol.
66:4085-4097[Abstract/Free Full Text].
|
| 41.
|
Pomerantz, R. J.,
D. Trono,
M. B. Feinberg, and D. Baltimore.
1990.
Cells nonproductively infected with HIV-1 exhibit an aberrant pattern of viral RNA expression: a molecular model for latency.
Cell
61:1271-1276[Medline].
|
| 42.
|
Rice, N. R.,
A. S. Lequarre,
J. W. Casey,
S. Lahn,
R. M. Stephens, and J. Edwards.
1989.
Viral DNA in horses infected with equine infectious anemia virus.
J. Virol.
63:5194-5200[Abstract/Free Full Text].
|
| 43.
|
Sellon, D. C.,
F. J. Fuller, and T. C. McGuire.
1994.
The immunopathogenesis of equine infectious anemia virus.
Virus Res.
32:111-138[Medline].
|
| 44.
|
Sellon, D. C.,
K. M. Walker,
K. E. Russell,
S. T. Perry,
P. Covington, and F. J. Fuller.
1996.
Equine infectious anemia virus replication is upregulated during differentiation of blood monocytes from acutely infected horses.
J. Virol.
70:590-594[Abstract].
|
| 45.
|
Sellon, D. C.,
K. M. Walker,
K. E. Russell,
S. T. Perry, and F. J. Fuller.
1996.
Phorbol ester stimulation of equine macrophage cultures alters expression of equine infectious anemia virus.
Vet. Microbiol.
52:209-221[Medline].
|
| 46.
|
Smith, M. W.,
M. Dean,
M. Carrington,
C. Winkler,
G. A. Huttley,
D. A. Lomb,
J. J. Goedert,
T. R. O'Brien,
L. P. Jacobson,
R. Kaslow,
S. Buchbinder,
E. Vittinghoff,
D. Vlahov,
K. Hoots,
M. W. Hilgartner, and S. J. O'Brien.
1997.
Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression.
Science
277:959-965[Abstract/Free Full Text].
|
| 47.
|
Tornquist, S. J.,
J. L. Oaks, and T. B. Crawford.
1997.
Elevation of cytokines associated with the thrombocytopenia of equine infectious anemia.
J. Gen. Virol.
78:2541-2548[Abstract].
|
Journal of Virology, September 1998, p. 7263-7269, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bogerd, H. P., Tallmadge, R. L., Oaks, J. L., Carpenter, S., Cullen, B. R.
(2008). Equine Infectious Anemia Virus Resists the Antiretroviral Activity of Equine APOBEC3 Proteins through a Packaging-Independent Mechanism. J. Virol.
82: 11889-11901
[Abstract]
[Full Text]
-
Tallmadge, R. L., Brindley, M. A., Salmans, J., Mealey, R. H., Maury, W., Carpenter, S.
(2008). Development and Characterization of an Equine Infectious Anemia Virus Env-Pseudotyped Reporter Virus. CVI
15: 1138-1140
[Abstract]
[Full Text]
-
Brindley, M. A., Maury, W.
(2008). Equine Infectious Anemia Virus Entry Occurs through Clathrin-Mediated Endocytosis. J. Virol.
82: 1628-1637
[Abstract]
[Full Text]
-
Mooney, J., Flynn, O., Sammin, D.
(2006). Equine infectious anaemia in Ireland: characterisation of the virus. Vet Rec.
159: 570-570
[Full Text]
-
Brindley, M. A., Maury, W.
(2005). Endocytosis and a Low-pH Step Are Required for Productive Entry of Equine Infectious Anemia Virus. J. Virol.
79: 14482-14488
[Abstract]
[Full Text]
-
Maury, W., Thompson, R. J., Jones, Q., Bradley, S., Denke, T., Baccam, P., Smazik, M., Oaks, J. L.
(2005). Evolution of the Equine Infectious Anemia Virus Long Terminal Repeat during the Alteration of Cell Tropism. J. Virol.
79: 5653-5664
[Abstract]
[Full Text]
-
Mealey, R. H., Leib, S. R., Pownder, S. L., McGuire, T. C.
(2004). Adaptive Immunity Is the Primary Force Driving Selection of Equine Infectious Anemia Virus Envelope SU Variants during Acute Infection. J. Virol.
78: 9295-9305
[Abstract]
[Full Text]
-
Oaks, J. L., Long, M. T., Baszler, T. V.
(2004). Leukoencephalitis Associated with Selective Viral Replication in the Brain of a Pony with Experimental Chronic Equine Infectious Anemia Virus Infection. Vet Pathol
41: 527-532
[Abstract]
[Full Text]
-
Hines, R., Sorensen, B. R., Shea, M. A., Maury, W.
(2004). PU.1 Binding to ets Motifs within the Equine Infectious Anemia Virus Long Terminal Repeat (LTR) Enhancer: Regulation of LTR Activity and Virus Replication in Macrophages. J. Virol.
78: 3407-3418
[Abstract]
[Full Text]
-
Baccam, P., Thompson, R. J., Li, Y., Sparks, W. O., Belshan, M., Dorman, K. S., Wannemuehler, Y., Oaks, J. L., Cornette, J. L., Carpenter, S.
(2003). Subpopulations of Equine Infectious Anemia Virus Rev Coexist In Vivo and Differ in Phenotype. J. Virol.
77: 12122-12131
[Abstract]
[Full Text]
-
Maury, W., Wright, P. J., Bradley, S.
(2003). Characterization of a Cytolytic Strain of Equine Infectious Anemia Virus. J. Virol.
77: 2385-2399
[Abstract]
[Full Text]
-
McGuire, T. C., Leib, S. R., Lonning, S. M., Zhang, W., Byrne, K. M., Mealey, R. H.
(2000). Equine infectious anaemia virus proteins with epitopes most frequently recognized by cytotoxic T lymphocytes from infected horses. J. Gen. Virol.
81: 2735-2739
[Abstract]
[Full Text]
-
Hammond, S. A., Li, F., McKeon, B. M. Sr., Cook, S. J., Issel, C. J., Montelaro, R. C.
(2000). Immune Responses and Viral Replication in Long-Term Inapparent Carrier Ponies Inoculated with Equine Infectious Anemia Virus. J. Virol.
74: 5968-5981
[Abstract]
[Full Text]
-
Del Piero, F.
(2000). Equine Viral Arteritis. Vet Pathol
37: 287-296
[Abstract]
[Full Text]
-
Harrold, S. M., Cook, S. J., Cook, R. F., Rushlow, K. E., Issel, C. J., Montelaro, R. C.
(2000). Tissue Sites of Persistent Infection and Active Replication of Equine Infectious Anemia Virus during Acute Disease and Asymptomatic Infection in Experimentally Infected Equids. J. Virol.
74: 3112-3121
[Abstract]
[Full Text]
-
Oaks, J. L., Ulibarri, C., Crawford, T. B.
(1999). Endothelial cell infection in vivo by equine infectious anaemia virus. J. Gen. Virol.
80: 2393-2397
[Abstract]
[Full Text]