Previous Article | Next Article ![]()
Journal of Virology, September 1998, p. 7237-7244, Vol. 72, No. 9
Department of Microbiology, University of
Colorado Health Sciences Center, Denver, Colorado
80262,1 and
Department of Pathology,
Uniformed Services University of the Health Sciences, Bethesda,
Maryland 208142
Received 20 February 1998/Accepted 28 May 1998
Mouse hepatitis virus receptor (MHVR) is a murine biliary
glycoprotein (Bgp1a). Purified, soluble MHVR expressed from
a recombinant vaccinia virus neutralized the infectivity of the A59
strain of mouse hepatitis virus (MHV-A59) in a concentration-dependent
manner. Several anchored murine Bgps in addition to MHVR can also
function as MHV-A59 receptors when expressed at high levels in
nonmurine cells. To investigate the interactions of these alternative
MHVR glycoproteins with MHV, we expressed and purified to apparent
homogeneity the extracellular domains of several murine Bgps as
soluble, six-histidine-tagged glycoproteins, using a baculovirus
expression system. These include MHVR isoforms containing four or two
extracellular domains and the corresponding Bgp1b
glycoproteins from MHV-resistant SJL/J mice, as well as Bgp2 and
truncation mutants of MHVR and Bgp1b comprised of the first
two immunoglobulin-like domains. The soluble four-domain MHVR
glycoprotein (sMHVR[1-4]) had fourfold more MHV-A59 neutralizing
activity than the corresponding soluble Bgp1b
(sBgp1b) glycoprotein and at least 1,000-fold more
neutralizing activity than sBgp2. Although virus binds to the
N-terminal domain (domain 1), soluble truncation mutants of MHVR and
Bgp1b containing only domains 1 and 2 bound virus poorly
and had 10- and 300-fold less MHV-A59 neutralizing activity than the
corresponding four-domain glycoproteins. In contrast, the soluble MHVR
glycoprotein containing domains 1 and 4 (sMHVR[1,4]) had as much
neutralizing activity as the four-domain glycoprotein, sMHVR[1-4].
Thus, the virus neutralizing activity of MHVR domain 1 appears to be
enhanced by domain 4. The sBgp1b[1-4] glycoprotein had
500-fold less neutralizing activity for MHV-JHM than for MHV-A59. Thus,
MHV strains with differences in S-glycoprotein sequence, tissue
tropism, and virulence can differ in the ability to utilize the various
murine Bgps as receptors.
Mouse hepatitis viruses (MHV) are a
group of coronaviruses that can cause diarrhea, hepatitis,
immunological dysfunction, acute and chronic neurological disorders, or
subclinical infections in mice (3, 14, 62). In vitro, MHV
strains readily infect many murine cell lines, usually causing cell
fusion and lysis. MHV infection is initiated by binding of the viral
spike, a trimer of 180-kDa S glycoproteins (11, 16), to a
receptor glycoprotein on the cell membrane, followed by S-mediated
fusion of the viral envelope with the cell membrane (60).
The first receptor identified for MHV, MHVR (also called
Bgp1a [24, 44, 65, 66]), is a biliary
glycoprotein (Bgp) in the carcinoembryonic antigen (CEA) family of the
immunoglobulin (Ig) superfamily (7, 53, 65). MHVR consists
of four Ig-like extracellular domains, a transmembrane domain, and
either a long or a short cytoplasmic tail (24, 42). MHVR is
expressed at the portals of virus entry on the apical membranes of
intestinal and respiratory epithelial cells, on the luminal surfaces of
endothelial cells, and in lymphoid cells, macrophages, liver, and
spleen (15, 20, 31). Bgps can function as cell adhesion
molecules and may have signal transducing activity (41, 61).
Recognition of MHVR by the viral spike glycoprotein is the initial
determinant of species specificity and tissue tropism of MHV infection,
although subsequent steps in the virus life cycle, such as membrane
fusion, virus uncoating, and replication, can also affect
susceptibility to MHV infection (1, 13, 18, 24, 57, 69). The
viral spike protein and an anti-MHVR monoclonal antibody (MAb CC1) that blocks virus infection of mouse cells both bind to the N-terminal Ig-like domain of MHVR (referred to in this report as domain 1) (25, 30).
In addition to MHVR, several other murine glycoproteins in the CEA
family can also serve as receptors for MHV strain A59 (MHV-A59) when
they are expressed at high levels in MHV-resistant nonmurine cells
(22, 70, 71). These receptor glycoproteins include an
isoform of MHVR consisting of domains 1 and 4 (MHVR[1,4]) (42, 70), homologous glycoproteins that have four or two Ig-like domains derived from MHV-resistant SJL/J mice (referred to as Bgp1b[1-4] and Bgp1b[1,4], respectively)
(22, 42, 67, 71), the two-domain Bgp2 glycoprotein
(44), and brain CEA, a member of the pregnancy-specific glycoprotein family (9). SJL/J mice are homozygous for the Bgp1b allele. They are much more resistant to infection by
MHV-A59 than BALB/c mice, and Bgp1b binds virus poorly
relative to MHVR (3, 4, 6, 19, 47, 71). However, when
recombinant Bgp1b is expressed at high levels in
MHV-resistant hamster (BHK) cells or in an embryonic fibroblast cell
line derived from MHV-resistant SJL/J mice, these cells become
susceptible to infection by MHV-A59, suggesting that receptor density
may also affect cellular susceptibility to infection (22,
71). The principal differences between MHVR and Bgp1b
lie in domain 1, which differs in 28 of its 108 amino acids (65, 67, 71). The Bgp2 and bCEA glycoproteins are much less efficient receptors than MHVR (9, 22, 44). The outcome of MHV
infection depends on the strain of MHV, mouse strain and age, and the
dose and route of administration of the virus (4, 18, 57,
63). The different spike glycoproteins of various MHV strains may
interact differently with the Bgp receptor glycoproteins, possibly
affecting the tissue tropisms and virulence of the virus strains in the same host (13, 28, 48, 51, 70).
Ig-related glycoproteins are specific receptors for poliovirus,
rhinovirus, and human immunodeficiency virus (HIV) (reviewed in
references 33, 45, 50, and 55),
and soluble versions of these membrane glycoproteins have been used to
study virus binding and uncoating. A truncated, soluble, anchorless
form of the poliovirus receptor neutralizes virus by binding to and
eliciting structural changes in the viral capsid (37, 68).
Soluble forms of ICAM-1, the major receptor for human rhinoviruses,
also neutralize infectious virus by inducing conformational changes in
the virion that resemble the normal process of uncoating (32, 34,
46). The binding of soluble CD4 to soluble HIV gp120 spike
glycoprotein elicits conformational changes in both gp120 and CD4 that
are required for viral fusion at the cell membrane (17).
Several soluble forms of MHVR and Bgp1b have been used to
investigate the interactions between MHV and its receptors. A soluble,
truncated glycoprotein consisting of MHVR domain 1 alone blocks MHV-A59
infection in vitro (23), and a fusion protein consisting of
MHVR domain 1 with the Fc domain of IgG showed differences in binding
and induction of conformational change in the spike glycoproteins of
two MHV-JHM variants (30). Furthermore, unpurified soluble
two-domain MHVR[1,4] neutralizes MHV-JHM infectivity 500-fold better
than the corresponding soluble two-domain Bgp1b[1,4]
(48).
This report describes the expression of a soluble, anchorless MHVR
glycoprotein by using a recombinant vaccinia virus and the expression
of five murine Bgp glycoproteins, plus two two-domain (domains 1 and 2)
truncation mutants of MHVR and Bgp1b, as anchorless,
soluble glycoproteins by using a baculovirus expression system. These
glycoproteins were purified to apparent homogeneity and used to compare
their MHV-A59 binding activities and neutralizing activities for
MHV-A59 and MHV-JHM.
Cells and viruses.
Spodoptera frugiperda (Sf9) cells
(Invitrogen, Carlsbad, Calif.) were maintained at 27°C in TC-100
medium (JRH BioSciences, Lenexa, Kans.) with 10% fetal bovine serum
(FBS; Gemini Bioproducts, Calabasas, Calif.) and 2% antibiotics
(penicillin, streptomycin, and amphotericin B; Gibco/BRL, Gaithersburg,
Md.). The 17 clone 1 line of spontaneously transformed BALB/c 3T3
fibroblasts, L2 cells (22), and African green monkey kidney
cells (Vero-76; American Type Culture Collection) were maintained in
Dulbecco's modified Eagle's minimal essential medium (DMEM,
Gibco/BRL) with 10% FBS and 2% antibiotics at 37°C and 5%
CO2.
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Purified, Soluble Recombinant Mouse Hepatitis Virus Receptor,
Bgp1b, and Bgp2 Murine Coronavirus Receptors Differ in
Mouse Hepatitis Virus Binding and Neutralizing Activities


![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
Antibodies. Anti-MHVR MAb CC1 binds to the N-terminal domain of MHVR but not Bgp1b (25), blocks virus binding to MHVR, and prevents virus infection of murine cells (24, 56, 66). MAb CC1 and a control IgG1 MAb directed against an irrelevant antigen (the B subunit of cholera toxin) were used as supernatant media from hybridoma cultures. Polyclonal rabbit anti-MHVR antiserum 655 was prepared by inoculation with MHVR glycoprotein purified from Swiss Webster mouse liver by affinity chromatography with MAb CC1 (66). In immunoblots, anti-MHVR antiserum 655 detects both MHVR and Bgp1b glycoproteins but not Bgp2 (24). The polyclonal goat antibody AO4 directed against purified MHV-A59 spike glycoprotein was previously described (59).
Soluble MHVR from recombinant vaccinia virus. The recombinant vaccinia virus, vac-sMHVR, that encodes a soluble four-domain MHVR glycoprotein [truncated at amino acid 420, just prior to the transmembrane domain; designated sMHVR(vac)] is described in reference 49. Vero cells were inoculated with vac-sMHVR at a multiplicity of infection (MOI) of 10, and culture medium containing the secreted 106-kDa sMHVR(vac) glycoprotein was collected 48 h postinoculation. The sMHVR(vac) glycoprotein was concentrated as a 50 to 90% ammonium sulfate precipitate and then separated from serum proteins by preparative isoelectric focusing in a pH 3 to 10 gradient in a Rotofor apparatus (Bio-Rad, Hercules, Calif.). Fractions (pH 3 to 3.5) containing sMHVR(vac) glycoprotein were identified by dot blot analysis with MAb CC1 and then pooled and concentrated by ultrafiltration with a Centricon-10 (Amicon, Beverly, Mass.) before further purification by gel filtration on a Superose-6 column (Pharmacia, Piscataway, N.J.).
Recombinant baculoviruses expressing six-histidine-tagged soluble receptor glycoproteins. The baculovirus expression vector pAcMP2 (PharMingen, San Diego, Calif.) was digested with XbaI and BamHI, and preannealed oligonucleotides BZ4 and BZ5 (CTAGACTCGTCCCTAGAGGATCCCATCACCATCACCATCACTAA and TCTTCGTGATGGTGATGGTGATGGGATCCTCTAGGGACGAGT; all oligonucleotides from Gibco/BRL) were ligated in to create pAcMP2(TH). The inserted oligonucleotides encoded a consensus thrombin cleavage site and six histidine residues that would be coupled to the carboxyl termini of proteins encoded by cDNAs ligated in frame into the XbaI site. The cDNA sequences encoding the leader and four extracellular Ig-like domains of MHVR (24) or Bgp1b (42) were amplified by using Pfu polymerase (Stratagene, La Jolla, Calif.) and oligonucleotides BZ1 and BZ2 (GCACTGCAGACCATGGAGCTGGCCTCAGCA and CGCGTGTCTAGAGAGGCCTCCTTGTGTTGG), which added PstI and XbaI restriction sites to the 5' and 3' ends, respectively, to allow cloning into pAcMP2(TH). The resulting constructs, called pAcMP2(TH)-MHVR[1-4] and pAcMP2(TH)-Bgp1b[1-4], produced soluble, six-histidine-tagged glycoproteins called sMHVR[1-4] and sBgp1b[1-4], respectively. Similarly, we made three additional constructs that combined pAcMP2(TH) with Pfu-amplified products encoding the leader sequence and first two extracellular domains of MHVR and Bgp1b (oligonucleotides BZ1 and BZ3 [CGCGCGTCTAGAAGGGGGATATAATCGGGGT]) and the leader sequence and two extracellular Ig-like domains of Bgp2 (44) (oligonucleotides BZ1 and BZ13 [CGCGCTCTAGAGGGGACATCTGAAATGTCATTG]). The anchorless, six-histidine-tagged proteins encoded by these constructs are called sMHVR[1,2], sBgp1b[1,2], and sBgp2[1,4], respectively. Two additional constructs, pAcMP2(TH)-sMHVR[1,4] and pAcMP2(TH)-sBgp1b[1,4], were generated by combining pAcMP2(TH) with the products made by amplifying cDNAs encoding the naturally occurring 1,4 splice variants of MHVR and Bgp1b (42), using oligonucleotides BZ1 and BZ2. The soluble, six-histidine-tagged glycoproteins encoded by these constructs are called sMHVR[1,4] and sBgp1b[1,4], respectively. The baculovirus expression constructs were cotransfected with BaculoGold DNA (PharMingen) into Sf9 cells, and progeny viruses were plaque purified according to the manufacturer's instructions. Diagrams of the constructs are shown in Fig. 1.
|
Purification of soluble, six-histidine-tagged glycoproteins.
Large-scale (0.5- to 1-liter) infections were done in the UCHSC Cancer
Center Tissue Culture Core Facility, using spinner-adapted Sf9 cells
inoculated at an MOI of 1 and grown in SF-900 II serum-free medium
(Gibco/BRL) for 72 h. The culture medium was clarified by
centrifugation (10,000 × g, 30 min) and filtration
(0.22-mm-pore-size filter; Millipore, Bedford, Mass.) prior to two
20-fold overnight dialyses at 4°C against Tris-buffered saline (TBS;
25 mM Tris [pH 7.6], 150 mM NaCl). The dialysate (approximately 1 mg
of total protein per ml) was then loaded onto a 5-ml HiTrap metal
affinity column (Pharmacia) previously charged with 10 ml of 100 mM
NiSO4. After washing with TBS containing 5% glycerol
(TBSG), bound proteins were eluted with a 0 to 500 mM gradient of
imidazole (Sigma, St. Louis, Mo.) in TBSG. Fractions containing soluble
recombinant receptor glycoproteins were identified by immunoblot
analysis, pooled, diluted with 3 volumes of 25 mM Tris (pH 7.6)-5%
glycerol, loaded onto an HR 5/5 MonoQ column (Pharmacia), and eluted at 100 to 150 mM NaCl in a 50 to 300 mM NaCl gradient. After analysis by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and staining with Coomassie brilliant blue G (Sigma), fractions containing purified receptor glycoproteins were pooled and stored at
80°C.
Immunoblots and virus binding assays. The soluble receptor glycoproteins (500 ng of each) and prestained molecular weight standards (Bio-Rad) were resolved by SDS-PAGE (12% gels), transferred to Immobilon-P membranes (Millipore), and blocked overnight at 4°C in TBST (25 mM Tris [pH 7.6], 150 mM NaCl, 0.1% Tween 20) supplemented with 5% powdered milk; all subsequent steps used TBST with 0.5% milk. Primary antisera, either anti-MHVR MAb CC1 or rabbit polyclonal serum 655 were used at a 1:4,000 dilution and incubated for 1 h. Duplicate blots were probed with control MAb IgG1 or normal rabbit serum. After washing, the blots were incubated for 30 min with a 1:4,000 dilution of the appropriate horseradish peroxidase-conjugated secondary antibody, either goat anti-mouse IgG (Cappel, Durham, N.C.) or donkey anti-rabbit IgG (Amersham, Arlington Heights, Ill.). Bound horseradish peroxidase-antibody complexes were detected with Renaissance Chemiluminescence Reagent and Reflection autoradiography film (DuPont/NEN, Boston, Mass.).
For virus overlay protein blot analysis (VOPBA), blots of purified receptor glycoproteins were blocked overnight at 4°C with TBST containing 2% BSA and then incubated for 1 h with 20 ml of MHV-A59 (107 PFU/ml). Bound virus was detected with anti-MHV-A59 spike antiserum AO4 and 125I-protein A (10 µCi/µg, 105 dpm/ml; DuPont/NEN) and visualized by autoradiography (6). Brush border membranes (BBM) purified from the small intestines of adult BALB/c mice were positive controls for virus binding, and BSA and BBM from adult SJL/J mice were negative controls (data not shown) (6).Virus neutralization assays.
Dilutions of supernatant medium
from vac-sMHVR-inoculated cells or purified sMHVR(vac) were
preincubated with 2 × 104 PFU of MHV-A59 for 15 min
at 37°C prior to inoculating onto L2 cells in 96-well culture plates.
After 1 h at 37°C, the monolayers were washed and refed. At
7 h postinoculation, the cell monolayers were washed with PBS,
fixed in methanol at
20°C, and air dried. The amount of viral
nucleocapsid (N) protein in each well was measured by enzyme-linked
immunosorbent assay as previously described (23).
Neutralization of MHV by sMHVR(vac) was calculated by comparing the
amounts of N antigen in wells inoculated with MHV-A59 preincubated with
sMHVR(vac) with that in control wells infected with MHV-A59
preincubated with buffer alone.
[(number of experimental
plaques/number of control plaques) × 100]. The results were graphed
and fitted to a sigmoid curve, using the Origin 4.1 (Microcal,
Northampton, Mass.) program. The amount of each soluble receptor that
neutralized 50% of the virus is called the 50% neutralizing dose
(ND50). Table 1 reports the average values, standard deviations, and number of experiments used for
each determination. For the soluble receptors that caused less than
50% neutralization at the highest concentrations tested, the
ND50 was approximated by extrapolation from the available data, and a minimum value is given in Table 1. Representative experiments are illustrated in Fig. 4 and 5. The significance (P) of the differences in virus neutralizing activities of
two soluble glycoproteins was calculated by one-way analysis of
variance.
|
| |
RESULTS |
|---|
|
|
|---|
MHV-A59 neutralization activity of sMHVR(vac) expressed in Vero cells from a recombinant vaccinia virus. The vaccinia virus expression system was used to produce a secreted, anchorless four-domain MHVR glycoprotein, sMHVR(vac), which is recognized by MAb CC1 and binds MHV-A59 in a VOPBA (49). Figure 2 shows that both unpurified sMHVR(vac) and highly purified sMHVR(vac) neutralized MHV-A59 in a concentration-dependent manner. The purified sMHVR(vac) (calculated ND50 = 20 nM) showed a 1,000-fold increase in specific activity over the crude sMHVR(vac) supernatant.
|
Characterization of six-histidine-tagged, soluble murine receptor glycoproteins expressed by baculovirus. We constructed seven baculovirus expression vectors which encoded soluble, six-histidine-tagged MHVR-related receptor glycoproteins: sMHVR[1-4], sMHVR[1,4], sMHVR[1,2], sBgp1b[1-4], sBgp1b[1,4], sBgp1b[1,2], and sBgp2[1,4] (Fig. 1). The secreted receptor glycoproteins were purified to apparent homogeneity from the Sf9 cell supernatant by nickel affinity and ion-exchange chromatography. The purified proteins migrated as broad bands, except for sBgp1b[1,4], which migrated as two distinct bands (Fig. 3A). The molecular weights of the glycoproteins were higher than expected based on their predicted amino acid compositions, probably due to glycosylation; all stained positively for carbohydrate (Fig. 3B). Electrophoresis in nondenaturing gels and size exclusion chromatography showed that each of the purified glycoproteins migrated as a single peak corresponding to a monomer of the expected size for an Ig-like molecule (data not shown).
|
Virus neutralization activities of purified soluble receptor glycoproteins produced by recombinant baculovirus. The soluble recombinant receptor glycoprotein sMHVR[1-4] expressed in insect cells has the same four domains as sMHVR(vac), the glycoprotein expressed in mammalian cells by using recombinant vaccinia virus. To assay the biological activity of baculovirus-expressed, purified protein, 5,000 PFU of MHV-A59 virus was incubated at 37°C for 1 h with dilutions of sMHVR[1-4]. The remaining infectious virus was assayed by plaquing on murine 17 clone 1 cells (Fig. 4). Different lots of purified, baculovirus-expressed glycoprotein had 20- to 200-fold more virus neutralizing activity than vaccinia virus-expressed sMHVR(vac). The six-histidine tag had no effect on the strong virus neutralization activity of sMHVR[1-4], as removal of the tag did not affect virus neutralization activity (data not shown). We estimate that the number of sMHVR[1-4] molecules at the ND50 (0.7 nM, 8.4 × 109 molecules/assay) is approximately 10-fold greater than the estimated number of spike molecules (approximately 9 × 108 spike proteins/assay, estimated as 5,000 PFU/assay × 300 virions/PFU × 200 peplomers/virion × 3 spike proteins/peplomer). The higher yield, ease of purification, and enhanced biological activity of sMHVR[1-4] in comparison to sMHVR(vac) justified the use of the baculovirus system for the production of the other six soluble receptor glycoproteins.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Initial studies of the MHV-A59 neutralization activities of murine Bgp-related glycoproteins used affinity-purified, anchorless MHVR glycoprotein, sMHVR(vac), expressed in mammalian cells by vaccinia virus (Fig. 2). This sMHVR(vac) glycoprotein effectively neutralized MHV-A59 infectivity (ND50 = 20 nM) and served as a benchmark for our studies using purified soluble receptor proteins expressed in insect cells. The sMHVR[1-4] glycoprotein expressed in insect cells and purified to apparent homogeneity had 20-fold more MHV-A59 neutralizing activity (ND50 = 0.7 nM) than sMHVR(vac). Thus, soluble, biologically active sMHVR[1-4] glycoprotein is produced in insect cells by infection with recombinant baculovirus even though the pattern of glycosylation in insect cells differs from that in animal cells (35, 36, 58). This finding is consistent with the evidence that glycosylation of domain 1 of MHVR is not essential for MHV-A59 receptor activity (21). Therefore, because of the high yield and biological activity of the receptor glycoprotein expressed in insect cells, the recombinant baculovirus system was used to produce the other soluble murine Bgps for MHV-A59 virus binding and neutralizing studies.
MHV-A59 virus bound strongly to purified sMHVR[1-4] and sMHVR[1,4], less well to sMHVR[1,2] and sBgp1b[1-4], and not at all to sBgp1b[1,2], sBgp1b[1,4], or sBgp2 (Fig. 3E). In VOPBAs, virus binding depends upon the affinity of the virus-receptor interaction and the renaturation of the receptor glycoprotein after SDS denaturation (6). Despite this dependence on protein refolding, the rank order of virus binding activity among the soluble receptors in VOPBAs correlates with the virus neutralization activities of the soluble receptors and with the receptor activities of the corresponding anchored murine Bgp glycoproteins expressed at high levels in BHK cells (44, 64). Although the four-domain receptor glycoprotein sMHVR[1-4] bound more virus than sBgp1b[1-4], the virus binding activity of sBgp1b[1-4], derived from MHV-resistant SJL/J mice, was unexpected. Our previous studies using intestinal BBM from MHV-A59-susceptible adult BALB/c and MHV-A59-resistant SJL/J mice showed that anchored MHVR[1-4] binds MHV-A59 in VOPBA, but anchored Bgp1b[1-4] does not (6). However, an embryonic SJL/J mouse fibroblast line that expresses Bgp1b and is resistant to infection with MHV-A59 becomes susceptible to infection when additional recombinant anchored Bgp1b[1-4] is expressed (22). This finding suggests that MHV-A59 can bind to high concentrations of Bgp1b. The MHV-A59 binding activity of purified sBgp1b[1-4] observed in Fig. 3E probably results from a higher density of Bgp1b on blots of highly purified receptor in comparison to blots of SJL/J BBM.
Quantitative analysis of the MHV-A59 neutralizing activities of the MHVR-related soluble glycoproteins expressed in insect cells revealed at least a 1,000-fold difference between the most and least active glycoproteins (Fig. 4 and 5; Table 1). Overall, for each of the soluble receptor glycoproteins, these data correlated well with the virus receptor activity of the corresponding anchored glycoproteins (22, 44, 48, 64, 71). This finding demonstrates that the soluble receptors produced in insect cells are suitable for in vitro studies of virus-receptor interactions.
Our experiments show that virus neutralization activity is primarily determined by the primary amino acid sequence of domain 1, in that each soluble MHVR glycoprotein had more activity than the corresponding soluble Bgp1b glycoprotein (Fig. 4 and 5; Table 1). Domain 1 of Bgp1b differs from that of MHVR in 28 of its 108 amino acids, while domain 1 of Bgp2 is even more divergent (51 of 108 amino acids). Many of these amino acid differences lie in the putative C-C' loop, C' beta sheet, and C'-C" loop, which includes the MHV binding site (51, 64). In contrast, the amino acid sequences of domains 2, 3, and 4 of MHVR and Bgp1b are remarkably similar (five differences in 282 amino acids) (42). Thus, the primary sequences in domain 1 of sMHVR[1-4], sBgp1b[1-4], and sBgp2 probably account for the observed differences in their MHV-A59 binding and neutralizing activities.
These experiments also show that domains 2, 3, and 4 modulate the virus binding and neutralizing activities of domain 1. The sMHVR[1,2] glycoprotein had markedly less MHV-A59 binding activity and had 10-fold less MHV-A59 neutralizing activity than sMHVR[1-4] and sMHVR[1,4]. Similarly, anchored MHVR[1,2] is a poor receptor in comparison to MHVR[1-4] and MHVR[1,4], even when expressed at high levels in BHK cells (64). One major difference between the structures of Ig-related proteins that can affect their functions is the nature of the interdomain junctions (2, 40). The junction between domains 1 and 2 of MHVR may have a different degree of flexibility than the junction between domains 1 and 4, which might affect the virus binding and neutralizing activities of domain 1. Perhaps domain 4, which is common to both sMHVR[1-4] and sMHVR[1,4], maintains domain 1 in an optimal conformation for virus binding and neutralization. While sBgp1b[1-4] had some MHV-A59 binding and neutralizing activity, both the sBgp1b[1,4] and sBgp1b[1,2] glycoproteins had very little neutralizing activity. The amino acid differences in domain 1 of Bgp1b may affect its interactions with other domains in addition to its direct effect on virus binding and neutralizing activities. Future structural studies of the purified proteins will allow comparison of the Ig-like domains of MHVR and Bgp1b and their interdomain junctions.
Several previous studies compared the relative MHV receptor activities of various anchored receptor glycoproteins, using transiently transfected cell lines to express the recombinant receptor glycoproteins (22, 48, 51, 64, 70, 71). However, infection in these assays depends on the strain and MOI of the virus, the percentage of cells transfected, and the surface density of the expressed receptor glycoprotein in addition to its intrinsic receptor activity (10, 29, 30). This report provides a quantitative comparison of the virus neutralizing activities of soluble forms of the receptor glycoproteins. If, as seems likely, the neutralizing activities of the soluble receptors provide a more sensitive assay for the differences between receptor glycoproteins than cells transfected with anchored receptors, our data predict that anchored Bgp1b[1,4] would be a very poor receptor for MHV-A59 compared with anchored Bgp1b[1-4], while anchored MHVR[1,4] and MHVR[1-4] both would have the highest receptor activity. This may help explain why adult SJL/J mice are resistant to MHV-A59 infection (4, 39, 57), even though Bgp1b[1-4] has only fourfold less virus neutralizing activity than MHVR[1-4]. In BALB/c mice, both MHVR[1-4] and MHVR[1,4] would serve as effective receptors, while the SJL/J mouse would have only one functional receptor, Bgp1b[1-4], since Bgp1b[1,4] probably has little receptor function. Susceptibility to infection may require that both the two- and four-domain receptors be functional receptors. Since Bgps may exist in the cell membrane as homodimers or heterodimers (5, 26), in BALB/c mice both the two-domain and four-domain homodimers and heterodimers may be functional, while in the SJL mouse only the four-domain Bgp1b[1-4] homodimer may be functional. Unfortunately, the expression patterns of various isoforms of MHVR and Bgp1b in particular cell types have not yet been determined (38, 44).
Soluble receptors may neutralize virus by competing with cellular receptor for binding to the viral spike protein and/or by inducing conformational changes in virus attachment proteins that mimic the initial events of virus entry and uncoating. Soluble receptor glycoproteins that neutralize the infectivity of HIV, rhinovirus, and poliovirus induce conformational changes in HIV gp120 and the picornavirus capsids (8, 12, 32, 34, 37, 43). Binding of an MHVR domain1-IgG Fc chimera to MHV-JHM results in the dissociation of the S1 and S2 subunits of the spike glycoprotein, a process that may resemble the natural entry process for MHV (30, 54, 60) and serves as a model for neutralization by soluble receptors. Fusion of MHV with the host cell membrane probably involves some sort of receptor-induced conformational change in S to bring the lipid bilayers close enough to fuse.
The different tissue tropisms and virulence of MHV strains may reflect differences in the ability to utilize the various receptor isoforms expressed on different murine tissues. We compared the neutralizing activities of the soluble receptors for MHV-JHM and MHV-A59. The sMHVR[1-4] and sMHVR[1,4] glycoproteins neutralized both virus strains quite well (Fig. 5A and B; Table 1), and the corresponding anchored MHVR glycoproteins are functional receptors for both MHV-A59 and MHV-JHM (47, 51, 70). In contrast, sBgp1b[1-4] had at least 300-fold less neutralizing activity for MHV-JHM than for MHV-A59. This quantitative difference in the susceptibility of MHV-A59 and MHV-JHM to neutralization by purified sBgp1b[1-4] in our in vitro assay is consistent with the observation that MHV-A59 could infect an SJL/J cell line (PSJLSV) that expresses Bgp1b, while MHV-JHM could not infect these cells (71). The two-domain sBgp1b[1,4] glycoprotein did not neutralize either MHV-A59 or MHV-JHM. This finding confirms and extends the observation of Ohtsuka et al. that soluble Bgp1b[1,4] blocked MHV-JHM infection of DBT cells 500-fold less efficiently than soluble MHVR[1,4] (48). Thus, the quantitative studies on the neutralization of murine coronaviruses by purified soluble receptor glycoproteins provide insight into the entry mechanisms and receptor specificities of various MHV strains and mutants. Such studies may elucidate how receptor selectivity influences the tissue tropism and virulence of different MHV strains.
| |
ACKNOWLEDGMENTS |
|---|
We thank Nicole Beauchemin, Dianna Blau, Aurelio Bonavia, Carlos Catallano, Dina Tresnan, Jeanne Schickli, and David Wentworth for helpful discussions and review of the manuscript. We thank Thomas Chamberlain and John Schneider for excellent technical assistance and Kurt Christiansen and Suzanne Meintzer of the UCHSC Cancer Center Core (supported by NCI grant P30-CA46934) for assistance with the baculovirus expression system.
This work was supported by NIH grants AI25231 and AI26075.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Microbiology, Campus Box B-175, University of Colorado Health Sciences Center, 4200 East 9th Ave., Denver, CO 80262. Phone: (303) 315-7329. Fax: (303) 315-6785. E-mail: kathryn.holmes{at}uchsc.edu.
Present address: Medical Virology Section, Laboratory of Clinical
Investigation, NIAID, NIH, Bethesda, MD 20892.
Present address: Genetic Therapy Inc., Gaithersburg, MD 20878.
§ Present address: H. M. Jackson Foundation, AFRIMS, Bangkok, Thailand.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Asanaka, M., and M. M. Lai. 1993. Cell fusion studies identified multiple cellular factors involved in mouse hepatitis virus entry. Virology 197:732-741[Medline]. |
| 2. | Banfield, M. J., D. J. King, A. Mountain, and R. L. Brady. 1997. VL:VH domain rotations in engineered antibodies: crystal structures of the Fab fragments from two murine antitumor antibodies and their engineered human constructs. Proteins 29:161-171[Medline]. |
| 3. | Barthold, S. W. 1986. Mouse hepatitis virus: biology and epizootiology, p. 571-601. In P. N. Bhatt, R. O. Jacoby, H. C. Morse III, and A. E. New (ed.), Viral and mycoplasma infections of laboratory rodents. Effects on biomedical research. Academic Press, Orlando, Fla. |
| 4. | Barthold, S. W., D. S. Beck, and A. L. Smith. 1986. Mouse hepatitis virus nasoencephalopathy is dependent upon virus strain and host genotype. Arch. Virol. 91:247-256[Medline]. |
| 5. | Bates, P. A., J. Luo, and M. J. Sternberg. 1992. A predicted three-dimensional structure for the carcinoembryonic antigen (CEA). FEBS Lett. 301:207-214[Medline]. |
| 6. |
Boyle, J. F.,
D. G. Weismiller, and K. V. Holmes.
1987.
Genetic resistance to mouse hepatitis virus correlates with absence of virus-binding activity on target tissues.
J. Virol.
61:185-189 |
| 7. | Brümmendorf, T., and F. G. Rathjen. 1994. Introduction, p. 951-962. In P. Sheterline (ed.), Cell adhesion molecules 1: immunoglobulin superfamily. Academic Press, London, England. |
| 8. |
Bryn, R. A.,
I. Sekigawa,
S. M. Chamow,
J. S. Johnson,
T. J. Gregory,
D. J. Capon, and J. E. Groopman.
1989.
Characterization of in vitro inhibition of human immunodeficiency virus by purified recombinant CD4.
J. Virol.
63:4370-4375 |
| 9. |
Chen, D. S.,
M. Asanaka,
K. Yokomori,
F. Wang,
S. B. Hwang,
H. P. Li, and M. M. Lai.
1995.
A pregnancy-specific glycoprotein is expressed in the brain and serves as a receptor for mouse hepatitis virus.
Proc. Natl. Acad. Sci. USA
92:12095-12099 |
| 10. | Chen, W., V. J. Madden, C. R. Bagnell, Jr., and R. S. Baric. 1997. Host-derived intracellular immunization against mouse hepatitis virus infection. Virology 228:318-332[Medline]. |
| 11. | Collins, A. R., R. L. Knobler, H. Powell, and M. J. Buchmeier. 1982. Monoclonal antibodies to murine hepatitis virus-4 (strain JHM) define the viral glycoprotein responsible for attachment and cell-cell fusion. Virology 119:358-371[Medline]. |
| 12. | Colston, E., and V. R. Racaniello. 1994. Soluble receptor-resistant poliovirus mutants identify surface and internal capsid residues that control interaction with the cell receptor. EMBO J. 13:5855-5862[Medline]. |
| 13. | Compton, S. R. 1994. Enterotropic strains of mouse coronavirus differ in their use of murine carcinoembryonic antigen-related glycoprotein receptors. Virology 203:197-201[Medline]. |
| 14. | Compton, S. R., S. W. Barthold, and A. L. Smith. 1993. The cellular and molecular pathogenesis of coronaviruses. Lab. Anim. Sci. 43:15-28[Medline]. (Erratum, 43:203.) |
| 15. | Coutelier, J.-P., C. Godfraind, G. S. Dveksler, M. Wysocka, C. B. Cardellichio, H. Nöel, and K. V. Holmes. 1994. B lymphocyte and macrophage expression of carcinoembryonic antigen-related adhesion molecules that serve as receptors for murine coronavirus. Eur. J. Immunol. 24:1383-1390[Medline]. |
| 16. |
Delmas, B., and H. Laude.
1990.
Assembly of coronavirus spike protein into trimers and its role in epitope expression.
J. Virol.
64:5367-5375 |
| 17. | Denisova, G., D. Raviv, I. Mondor, Q. J. Sattentau, and J. M. Gershoni. 1997. Conformational transitions in CD4 due to complexation with HIV envelope glycoprotein gp120. J. Immunol. 158:1157-1164[Abstract]. |
| 18. | Dindzans, V. J., E. Skamene, and G. A. Levy. 1986. Susceptibility/resistance to mouse hepatitis virus strain 3 and macrophage procoagulant activity are genetically linked and controlled by two non-H2-linked genes. J. Immunol. 137:2355-2360[Abstract]. |
| 19. | Dveksler, G. 1998. Unpublished data. |
| 20. | Dveksler, G. S., A. A. Basile, C. B. Cardellichio, N. Beauchemin, C. W. Dieffenbach, and K. V. Holmes. 1993. Expression of MHV-A59 receptor glycoproteins in susceptible and resistant strains of mice. Adv. Exp. Med. Biol. 342:267-272[Medline]. |
| 21. | Dveksler, G. S., A. A. Basile, C. B. Cardellichio, and K. V. Holmes. 1995. Mouse hepatitis virus receptor activities of an MHVR/mph chimera and MHVR mutants lacking N-linked glycosylation of the N-terminal domain. J. Virol. 69:543-546[Abstract]. |
| 22. |
Dveksler, G. S.,
C. W. Dieffenbach,
C. B. Cardellichio,
K. McCuaig,
M. N. Pensiero,
G. S. Jiang,
N. Beauchemin, and K. V. Holmes.
1993.
Several members of the mouse carcinoembryonic antigen-related glycoprotein family are functional receptors for the coronavirus mouse hepatitis virus-A59.
J. Virol.
67:1-8 |
| 23. | Dveksler, G. S., S. E. Gagneten, C. A. Scanga, C. B. Cardellichio, and K. V. Holmes. 1996. Expression of the recombinant anchorless N-terminal domain of mouse hepatitis virus (MHV) receptor makes hamster or human cells susceptible to MHV infection. J. Virol. 70:4142-4145[Abstract]. |
| 24. |
Dveksler, G. S.,
M. N. Pensiero,
C. B. Cardellichio,
R. K. Williams,
G. S. Jiang,
K. V. Holmes, and C. W. Dieffenbach.
1991.
Cloning of the mouse hepatitis virus (MHV) receptor: expression in human and hamster cell lines confers susceptibility to MHV.
J. Virol.
65:6881-6891 |
| 25. |
Dveksler, G. S.,
M. N. Pensiero,
C. W. Dieffenbach,
C. B. Cardellichio,
A. A. Basile,
P. E. Elia, and K. V. Holmes.
1993.
Mouse hepatitis virus strain A59 and blocking antireceptor monoclonal antibody bind to the N-terminal domain of cellular receptor.
Proc. Natl. Acad. Sci. USA
90:1716-1720 |
| 26. |
Edlund, M.,
I. Blikstad, and B. Obrink.
1996.
Calmodulin binds to specific sequences in the cytoplasmic domain of C-CAM and down-regulates C-CAM self-association.
J. Biol. Chem.
271:1393-1399 |
| 27. |
Frana, M. F.,
J. N. Behnke,
L. S. Sturman, and K. V. Holmes.
1985.
Proteolytic cleavage of the E2 glycoprotein of murine coronavirus: host-dependent differences in proteolytic cleavage and cell fusion.
J. Virol.
56:912-920 |
| 28. | Gagneten, S., C. A. Scanga, G. S. Dveksler, N. Beauchemin, D. Percy, and K. V. Holmes. 1996. Attachment glycoproteins and receptor specificity of rat coronaviruses. Lab. Anim. Sci. 46:159-166[Medline]. |
| 29. | Gallagher, T. M. 1995. Overexpression of the MHV receptor. Effect on progeny virus secretion. Adv. Exp. Med. Biol. 380:331-336[Medline]. |
| 30. | Gallagher, T. M. 1997. A role for naturally occurring variation of the murine coronavirus spike protein in stabilizing association with the cellular receptor. J. Virol. 71:3129-3137[Abstract]. |
| 31. | Godfraind, C., S. G. Langreth, C. B. Cardellichio, R. Knobler, J. P. Coutelier, M. Dubois-Dalcq, and K. V. Holmes. 1995. Tissue and cellular distribution of an adhesion molecule in the carcinoembryonic antigen family that serves as a receptor for mouse hepatitis virus. Lab. Invest. 73:615-627[Medline]. |
| 32. |
Greve, J. M.,
C. P. Forte,
C. W. Marlor,
A. M. Meyer,
H. Hoover-Litty,
D. Wunderlich, and A. McClelland.
1991.
Mechanisms of receptor-mediated rhinovirus neutralization defined by two soluble forms of ICAM-1.
J. Virol.
65:6015-6023 |
| 33. | Gromeier, M., H. H. Lu, G. Bernhardt, J. J. Harber, J. A. Bibb, and E. Wimmer. 1995. The human poliovirus receptor. Receptor-virus interaction and parameters of disease specificity. Ann. N. Y. Acad. Sci. USA 753:19-36[Abstract]. |
| 34. |
Hoover-Litty, H., and J. M. Greve.
1993.
Formation of rhinovirus-soluble ICAM-1 complexes and conformational changes in the virion.
J. Virol.
67:390-397 |
| 35. | James, D. C., M. H. Goldman, M. Hoare, N. Jenkins, R. W. Oliver, B. N. Green, and R. B. Freedman. 1996. Posttranslational processing of recombinant human interferon-gamma in animal expression systems. Protein Sci. 5:331-340[Abstract]. |
| 36. | Jarvis, D. L., and E. E. Finn. 1995. Biochemical analysis of the N-glycosylation pathway in baculovirus-infected lepidopteran insect cells. Virology 212:500-511[Medline]. |
| 37. |
Kaplan, G.,
M. S. Freistadt, and V. R. Racaniello.
1990.
Neutralization of poliovirus by cell receptors expressed in insect cells.
J. Virol.
64:4697-4702 |
| 38. | Keck, U., P. Nedéllec, N. Beauchemin, J. A. Thompson, and W. Zimmerman. 1995. The CEA10 gene encodes a secreted member of the murine carcinoembryonic antigen family and is expressed in the placenta, gastrointestinal tract and bone marrow. Eur. J. Biochem. 229:455-464[Medline]. |
| 39. |
Knobler, R.,
L. A. Tunison, and M. B. Oldstone.
1984.
Host genetic control of mouse hepatitis virus type 4 (JHM strain) replication. I. Restriction of virus amplification and spread in macrophages from resistant mice.
J. Gen. Virol.
65:1543-1548 |
| 40. | Lange, G., S. J. Lewis, G. N. Murshudov, G. G. Dodson, P. C. Moody, J. P. Turkenburg, A. N. Barclay, and R. L. Brady. 1994. Crystal structure of an extracellular fragment of the rat CD4 receptor containing domains 3 and 4. Structure 2:469-481[Medline]. |
| 41. | Lin, S., W. Luo, K. Earley, P. Cheung, and D. C. Hixson. 1995. Structure and function of C-CAM1: effects of the cytoplasmic domain on cell aggregation. Biochem. J. 311:239-245. |
| 42. | McCuaig, K., M. Rosenberg, P. Nédellec, C. Turbide, and N. Beauchemin. 1993. Expression of the Bgp gene and characterization of mouse colon biliary glycoprotein isoforms. Gene 127:173-183[Medline]. |
| 43. |
Moore, J. P.,
J. A. McKeating,
W. A. Norton, and Q. J. Sattentau.
1991.
Direct measurement of soluble CD4 binding to human immunodeficiency virus type 1 virions: gp120 dissociation and its implications for virus-cell binding and fusion reactions and their neutralization by soluble CD4.
J. Virol.
65:1133-1140 |
| 44. |
Nédellec, P.,
G. S. Dveksler,
E. Daniels,
C. Turbide,
B. Chow,
A. A. Basile,
K. V. Holmes, and N. Beauchemin.
1994.
Bgp2, a new member of the carcinoembryonic antigen-related gene family, encodes an alternative receptor for mouse hepatitis viruses.
J. Virol.
68:4525-4537 |
| 45. | Norkin, L. C. 1995. Virus receptors: implications for pathogenesis and the design of antiviral agents. Clin. Microbiol. Rev. 8:293-315[Abstract]. |
| 46. |
Ohlin, A.,
H. Hoover-Litty,
G. Sanderson,
A. Paessens,
S. L. Johnson,
S. T. Holgate,
E. Huguenel, and J. M. Greve.
1997.
Spectrum of activity of soluble intercellular adhesion molecule-1 against rhinovirus reference strains and field isolates.
Antimicrob. Agents Chemother.
38:1413-1415 |
| 47. | Ohtsuka, N., and F. Taguchi. 1997. Mouse susceptibility to mouse hepatitis virus infection is linked to viral receptor genotype. J. Virol. 71:8860-8863[Abstract]. |
| 48. |
Ohtsuka, N.,
Y. K. Yamada, and F. Taguchi.
1996.
Difference in virus-binding activity of two distinct receptor proteins for mouse hepatitis virus.
J. Gen. Virol.
77:1683-1692 |
| 49. |
Pensiero, M. N.,
G. S. Dveksler,
C. B. Cardellichio,
G. Jiang,
P. E. Elia,
C. W. Dieffenbach, and K. V. Holmes.
1992.
Binding of the coronavirus mouse hepatitis virus A59 to its receptor expressed from a recombinant vaccinia virus depends on posttranslational processing of the receptor glycoprotein.
J. Virol.
66:4028-4039 |
| 50. | Racaniello, V. R. 1991. Virus-receptor interaction in poliovirus entry and pathogenesis. Harvey Lect. 87:1-16[Medline]. |
| 51. | Rao, P. V., and T. M. Gallagher. 1997. Identification of a contiguous 6-residue determinant in the MHV receptor that controls the level of virion binding to cells. Virology 229:336-348[Medline]. |
| 52. | Rowe, C. L., S. C. Baker, M. J. Nathan, and J. O. Fleming. 1997. Evolution of mouse hepatitis virus: detection and characterization of spike deletion variants during persistent infection. J. Virol. 71:2959-2969[Abstract]. |
| 53. | Rudert, F., A. M. Saunders, S. Rebstock, J. A. Thompson, and W. Zimmerman. 1992. Characterization of murine carcinoembryonic antigen gene family members. Mamm. Genome 3:262-273[Medline]. |
| 54. | Saeki, K., N. Ohtsuka, and F. Taguchi. 1997. Identification of spike protein residues of murine coronavirus responsible for receptor-binding activity by use of soluble receptor-resistant mutants. J. Virol. 71:9024-9031[Abstract]. |
| 55. | Signoret, N., P. Poignard, D. Blanc, and Q. J. Sattentau. 1993. Human and simian immunodeficiency viruses: virus-receptor interactions. Trends Microbiol. 1:328-333[Medline]. |
| 56. | Smith, A. L., C. B. Cardellichio, D. F. Winograd, M. S. de Souza, S. W. Barthold, and K. V. Holmes. 1991. Monoclonal antibody to the receptor for murine coronavirus MHV-A59 inhibits viral replication in vivo. J. Infect. Dis. 163:879-882[Medline]. |
| 57. | Smith, M. S., R. E. Click, and P. G. Plagemann. 1984. Control of mouse hepatitis virus replication in macrophages by a recessive gene on chromosome 7. J. Immunol. 133:428-432[Abstract]. |
| 58. | Sridhar, P., A. K. Panda, R. Pal, G. P. Talwar, and S. E. Hasnain. 1993. Temporal nature of the promoter and not relative strength determines the expression of an extensively processed protein in a baculovirus system. FEBS Lett. 315:282-286[Medline]. |
| 59. |
Sturman, L. S.,
K. V. Holmes, and J. Behnke.
1980.
Isolation of coronavirus envelope glycoproteins and interaction with the viral nucleocapsid.
J. Virol.
33:449-462 |
| 60. |
Sturman, L. S.,
C. S. Ricard, and K. V. Holmes.
1990.
Conformational change of the coronavirus peplomer glycoprotein at pH 8.0 and 37°C correlates with virus aggregation and virus-induced cell fusion.
J. Virol.
64:3042-3050 |
| 61. |
Turbide, C.,
M. Rojas,
C. P. Stanners, and N. Beauchemin.
1991.
A mouse carcinoembryonic antigen gene family member is a calcium-dependent cell adhesion molecule.
J. Biol. Chem.
266:309-315 |
| 62. | Wege, H., S. Siddell, and V. ter Meulan. 1982. The biology and pathogenesis of coronaviruses. Curr. Top. Microbiol. Immunol. 99:165-200[Medline]. |
| 63. | Weiser, W., I. Vellisto, and F. B. Bang. 1976. Congenic strains of mice susceptible and resistant to mouse hepatitis virus. Proc. Soc. Exp. Biol. Med. 152:499-502[Abstract]. |
| 64. |
Wessner, D. R.,
P. C. Shick,
J.-H. Lu,
C. B. Cardellichio,
S. E. Gagneten,
N. Beauchemin,
K. V. Holmes, and G. S. Dveksler.
1998.
Mutational analysis of the virus and monoclonal antibody binding sites in MHVR, the cellular receptor of the murine coronavirus mouse hepatitis virus strain MHV-A59.
J. Virol.
72:1941-1948 |
| 65. |
Williams, R. K.,
G. S. Jiang, and K. V. Holmes.
1991.
Receptor for mouse hepatitis virus is a member of the carcinoembryonic antigen family of glycoproteins.
Proc. Natl. Acad. Sci. USA
88:5533-5536 |
| 66. |
Williams, R. K.,
G. S. Jiang,
S. W. Snyder,
M. F. Frana, and K. V. Holmes.
1990.
Purification of the 110-kilodalton glycoprotein receptor for mouse hepatitis virus (MHV)-A59 from mouse liver and identification of a nonfunctional, homologous protein in MHV-resistant SJL/J mice.
J. Virol.
64:3817-3823 |
| 67. | Williams, R. K., S. W. Snyder, and K. V. Holmes. 1990. MHV-resistant SJL/J mice express a non-functional homolog to the MHV receptor glycoprotein. Adv. Exp. Med. Biol. 276:45-50[Medline]. |
| 68. | Yafal, A. G., G. Kaplan, V. R. Racaniello, and J. M. Hogle. 1993. Characterization of poliovirus conformational alteration mediated by soluble cell receptors. Virology 197:501-505[Medline]. |
| 69. | Yokomori, K., M. Asanaka, S. A. Stohlman, and M. M. Lai. 1993. A spike protein-dependent cellular factor other than the viral receptor is required for mouse hepatitis virus entry. Virology 196:45-56[Medline]. |
| 70. |
Yokomori, K., and M. M. Lai.
1992.
Mouse hepatitis virus utilizes two carcinoembryonic antigens as alternative receptors.
J. Virol.
66:6194-6199 |
| 71. |
Yokomori, K., and M. M. Lai.
1992.
The receptor for mouse hepatitis virus in the resistant mouse strain SJL is functional: implications for the requirement of a second factor for viral infection.
J. Virol.
66:6931-6938 |
This article has been cited by other articles: