Previous Article | Next Article 
Journal of Virology, September 1998, p. 7154-7159, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Ability of Positive Transcription Elongation Factor b To
Transactivate Human Immunodeficiency Virus Transcription Depends on
a Functional Kinase Domain, Cyclin T1, and Tat
Koh
Fujinaga,1
Thomas P.
Cujec,1
Junmin
Peng,2
Judit
Garriga,3
David H.
Price,2
Xavier
Graña,3 and
B. Matija
Peterlin1,*
Departments of Medicine, Microbiology, and
Immunology, Howard Hughes Medical Institute, University of
California, San Francisco, San Francisco, California
94143-07031;
Department of
Biochemistry, University of Iowa, Iowa City, Iowa
522422; and
Fels Institute for
Cancer Research and Molecular Biology and Department of
Biochemistry, Temple University School of Medicine, Philadelphia,
Pennsylvania 191403
Received 4 May 1998/Accepted 10 June 1998
 |
ABSTRACT |
By binding to the transactivation response element (TAR) RNA, the
transcriptional transactivator (Tat) from the human immunodeficiency virus increases rates of elongation rather than initiation of viral
transcription. Two cyclin-dependent serine/threonine kinases, CDK7 and
CDK9, which phosphorylate the C-terminal domain of RNA polymerase II,
have been implicated in Tat transactivation in vivo and in vitro. In
this report, we demonstrate that CDK9, which is the kinase component of
the positive transcription elongation factor b (P-TEFb) complex, can
activate viral transcription when tethered to the heterologous Rev
response element RNA via the regulator of expression of virion proteins
(Rev). The kinase activity of CDK9 and cyclin T1 is essential for these
effects. Moreover, P-TEFb binds to TAR only in the presence of Tat. We
conclude that Tat-P-TEFb complexes bind to TAR, where CDK9 modifies
RNA polymerase II for the efficient copying of the viral genome.
 |
INTRODUCTION |
The transcriptional transactivator
Tat from human immunodeficiency viruses (HIV-1 and HIV-2) and simian
immunodeficiency virus is a highly conserved and unique transcriptional
activator in that it binds to RNA rather than to DNA to increase rates
of elongation rather than initiation of transcription (17).
Its RNA target, the transactivation response element (TAR), forms a
stable stem-loop at the 5' end of all viral transcripts
(17). Tat is absolutely essential for viral replication and
has been a major focus of research on new anti-HIV therapeutic
strategies (10). For example, dominant negative Tat proteins
(5), TAR decoys (19), new phenothiazines
(16), and kinase inhibitors (22) have all been demonstrated to decrease the ability of Tat to function on the viral
promoter, the 5' long terminal repeat (HIV-1 LTR).
Tat binds to TAR via its RNA-binding domain in the C-terminal half of
the protein (17). Additionally, Tat exists in multiprotein complexes in cells. One of these comprises the RNA polymerase II
(RNAPII) holoenzyme (7, 11), which contains up to 100 polypeptides and can initiate transcription from promoters in the
presence of general transcription factors TFIID and TFIIB (7). In the holoenzyme complex, Tat interacts with TFIIH and activates CDK7, a cyclin H-dependent serine/threonine kinase that is
known to phosphorylate the C-terminal domain (CTD) of RNAPII (7,
12, 27, 35). The conversion from a nonphosphorylated CTD
(RNAPIIa) to a phosphorylated CTD (RNAPIIo) is a hallmark of the
transition from initiation to elongation of transcription (26). Tat also exists in a second complex, which contains
CDK9, which, together with cyclin T1, hyperphosphorylates the CTD
(22, 34, 38). Transcriptionally active CDK9 is a component
of the positive transcription elongation factor b (P-TEFb), which was defined first in in vitro transcription systems from Drosophila melanogaster (23). Cyclin T1 also binds to Tat,
increases the affinity of Tat for TAR in vitro, and rescues the block
to Tat transactivation in rodent cells (33). Tat-TFIIH and
Tat-P-TEFb complexes might function independently and sequentially,
such that the activation of CDK7 leads to promoter clearance and the recruitment of CDK9 for efficient elongation, or dependently, such that
CDK7 directly or indirectly modifies the activity of CDK9 or vice
versa.
Given these data, several critical questions remained. Which of these
Tat complexes can interact with TAR, and which kinase can function via
RNA to transactivate the HIV-1 LTR? In this study, we demonstrate that
CDK9 can function via RNA but only when its kinase domain is intact.
Cyclin T1 is also required for the function of CDK9. Finally, we
demonstrate that the Tat-P-TEFb complex interacts specifically with
TAR in a manner that depends on the 5' bulge and central loop of TAR.
We conclude that Tat-P-TEFb complexes are functional at TAR and
suggest that Tat-TFIIH complexes act at an earlier step, such as
promoter clearance.
 |
MATERIALS AND METHODS |
Plasmid constructions.
The plasmids pRevTat, pHIVSCAT,
pRRESCAT, and pCyclin T1 have been described previously (18, 21,
28, 32). To construct pSPORTRev, Rev coding sequences (350 bp)
were amplified by PCR from pcRev (32), restricted with
AflII and SacI, and cloned into the
PstI and SacI sites of pSV · SPORT 1 (Gibco BRL, Gaithersburg, Md.), which contains modified polylinker
sequences (sequences available upon request). Functional expression of
Rev was confirmed as described elsewhere (20). Full-length
wild-type CDK9 and its kinase-deficient counterpart (D167N) were
amplified by PCR from pRc/CMVCDK9-HA (pCDK9) and
pRc/CMVCDK9D-NHA [pCDK9(D167N)] (13),
respectively, with the oligonucleotides 5'
GCGATCcagctgGAGGCGGCCATGGCAAAGCAGTACGACTCGGT 3' (lowercase letters indicate the PvuII site) and 5'
CAGACGGAGTTTGAGCGCGTCTTCCTCGAGAGGGGCCGGCG 3'. Amplified products
(1.1 kbp) were restricted with PvuII and subcloned into
pSPORTRev (PvuII). The identities of the resulting plasmids
[pRevCDK9 and pRevCDK9(D167N)] were confirmed by dideoxynucleotide DNA sequencing (Amersham, Arlington Heights, Ill.). The expression of
fusion proteins in COS cells was evaluated by Western blotting with
anti-Rev and anti-CDK9 antibodies. Wild-type (+1 to +80) or mutant TAR
sequences derived from HIV-1SF2 were cloned into pGEM7fZ(+)
(SphI-HindIII; Promega, Madison, Wis.) with
oligonucleotides containing SphI (5') and
HindIII (3') linkers. Sequences of the resulting
plasmids pGEM7WT (wild-type TAR), pGEM7
B (bulge deletion), and
pGEM7
L (loop deletion) were confirmed by DNA sequencing (see Fig.
4A).
Transfection and CAT assays.
HeLa cells were transfected
with plasmid reporters (0.1 µg) and plasmid effector (0.1 µg) in
the presence or absence of pTat (18) with Lipofectamine as
recommended by the manufacturer (Gibco BRL). For Fig. 3 and 4,
increasing amounts of competitor plasmids were also used (see legends
to Fig. 3 and 4). Forty-eight hours after the transfection, cells were
harvested and lysed (0.25 M Tris-HCl at pH 7.5, 0.1% Triton X-100).
Chloramphenicol acetyltransferase (CAT) assays were performed as
described previously (25). As an internal control, 0.2 µg
of pCMV
Gal was cotransfected with CAT plasmid reporters.
-Galactosidase assays were performed as follows. Cell lysates were
mixed with the same amount of 2×
-galactosidase reaction mixture
(200 mM NaPO4 [pH 7.3], galactopyranoside) and incubated at 37°C
for 2 h.
-Galactosidase activities were quantified by measuring
the absorbance at 450 nm by the enzyme-linked immunosorbent assay plate
reader. All CAT data were normalized to this internal control.
Cell culture.
Human 293 cells stably expressing CDK9-HA
(PITALRE-HA) have been described earlier (13). Briefly, 293 cells were transfected with pRc/CMVCDK9-HA and selected in
G418-containing culture medium (13).
RNA capture assays.
Wild-type and mutant TAR RNA species
were prepared from the pGEM7 plasmids by transcribing linearized
templates (HindIII) with T7 polymerase in the presence
of [
-32P]UTP with the MAXIscript kit (Ambion, Austin,
Tex.). Labeled RNA was purified from a 5% denaturing polyacrylamide
gel and eluted (1.95 M NH4OAc, 1% sodium dodecyl sulfate,
60 µg of tRNA per ml) for 6 h at 60°C. After phenol and
chloroform extractions, the RNA was precipitated with 2.5 volumes of
EtOH and resuspended in RNA capture buffer (50 mM HEPES-KOH at pH 7.6, 50 mM KCl, 0.1 mM EDTA, 5% glycerol, 7 mM Mg2Cl, 10 mM
dithiothreitol). Nuclear extracts (9) were prepared from 293 cells stably expressing hemagglutinin (HA)-tagged wild-type CDK9 or the
parental vector. CDK9 complexes were immunoprecipitated (50 µg of
nuclear extract/treatment) onto protein A-Sepharose beads (Pharmacia,
Piscataway, N.J.). These beads were washed at least three times in the
wash buffer (50 mM Tris-HCl at pH 7.4, 0.25 M NaCl, 0.1% Triton X-100,
5 mM EDTA, 10 mM dithiothreitol, 1 mM sodium metabisulfite, 0.2 mM phenylmethylsulfonyl fluoride) and two times in RNA capture buffer before being resuspended in 250 µl of binding buffer. RNA capture assays were performed in the presence or absence of recombinant Tat
protein (500 ng) (7), wild-type or mutant
[
-32P]UTP-RNA (106 to 108
cpm/µg, respectively), and 10 ng of tRNA per ml. Binding reaction mixtures were incubated at 25°C for 1 h with gentle rotation and then washed extensively with RNA capture buffer. Complexes were extracted with phenol (pH 5.0), concentrated by precipitation (0.3 M
sodium acetate, 20 µg of tRNA, 2.5 volumes of EtOH), and resolved on
10% denaturing polyacrylamide gels. Captured RNA was visualized
following exposure of the dried gel to X-ray film.
 |
RESULTS |
The hybrid RevCDK9 protein activates transcription from the HIV-1
LTR where TAR was replaced by SLIIB from RRE.
Recently, P-TEFb and
especially cyclin T1 were demonstrated to interact with Tat (22,
34, 38). Furthermore, the inhibition of the kinase activity of
CDK9 abolished Tat transactivation (22). Since P-TEFb
phosphorylates the CTD, we wanted to test whether CDK9 could activate
transcription when introduced to the transcription complex via RNA. To
this end, the following plasmids were used (Fig.
1). They directed the synthesis of Rev
(pRev), hybrid RevTat (pRevTat), RevCDK9 (pRevCDK9), and mutant
RevCDK9(D167N) [pRevCDK9(D167N)] proteins from the simian virus 40 early promoter (Fig. 1A). The mutation of aspartic acid at position 167 to asparagine abolishes the ability of CDK9 to phosphorylate the
retinoblastoma protein (13) and the CTD (data not
presented). However, this same mutation does not affect the ability of
the mutant CDK9 to form higher-order complexes (data not presented).
Additionally, we used pTat and pCDK9. These plasmids are described
elsewhere (13, 18). Two major plasmid effectors were used.
They contained the wild-type HIV-1 LTR (pHIVSCAT) or the HIV-1 LTR
where TAR was replaced by the high-affinity Rev-binding stem-loop IIB
(SLIIB) from the Rev response element (RRE) (pRRESCAT) (32)
linked to the CAT reporter gene (Fig. 1B).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Diagrammatic representation of plasmid effectors and
reporters used in this study. (A) Plasmid effectors consisted of pRev,
pRevTat, pRevCDK9, and pRevCDK9(D167N), which directed the synthesis of
Rev, hybrid RevTat, hybrid RevCDK9, and hybrid Rev-kinase-negative-CDK9
proteins from the simian virus 40 early promoter, respectively. (B)
Plasmid reporters consisted of pHIVSCAT, and pRRESCAT, which contained
the wild-type HIV-1 LTR from HIV-1SF2 and substituted HIV-1
LTRs, where TAR was replaced by SLIIB from the RRE linked to the CAT
reporter gene, respectively. Ovals before arrows denote types of
promoters, followed by start sites of transcription (lines with
arrows), TAR and SLIIB structures, and reporters (CAT), followed by the
polyadenylation site (pA). D167N stands for a mutation of aspartic acid
to asparagine at position 167 of CDK9, which destroys the kinase
activity of CDK9.
|
|
First, we cotransfected our plasmid effectors with the wild-type HIV-1
LTR target (pHIVSCAT). The wild-type Tat increased
levels of expression
99-fold over that for the mutant Tat (Fig.
2A, lanes 1 and 2). Similarly, the hybrid
RevTat protein transactivated
the HIV-1 LTR 86-fold (Fig.
2A, lane 3).
Basal levels of expression
in this and subsequent experiments were
measured by the liquid
CAT assay, where the slope was measured by
increases in counts
per minute (Fig.
2, bottom). As expected, since Rev
has no affinity
for TAR, neither Rev nor the hybrid RevCDK9 proteins
had any effect
on the HIV-1 LTR. In sharp contrast, the hybrid RevCDK9
transactivated
the substituted HIV-1 LTR (pRRESCAT), where TAR was
replaced by
SLIIB, 26-fold (Fig.
2B, lane 4). This effect was about
one-half
of that observed with the hybrid RevTat protein on the same
plasmid
target (46-fold [Fig.
2B, lane 3]). Importantly, neither
wild-type
Tat nor the mutant hybrid RevCDK9(D167N) protein had any
effect
when targeted to the HIV-1 LTR via SLIIB (Fig.
2B, lanes 2 and
5). Together, these data demonstrate that CDK9 can function when
tethered to RNA and that the kinase activity of CDK9 is essential
for
this effect. Interestingly, neither hybrid RevCDK9 nor RevVP16
protein
(
32) worked as well as the hybrid RevTat protein, suggesting
that structural constraints on these fusion proteins might exist.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
RNA tethering is required for the activity of CDK9 on
the HIV-1 LTR. HeLa cells were cotransfected with pHIVSCAT (A) or
pRRESCAT (B) and indicated plasmid effectors. (A) Only the wild-type
Tat and hybrid RevTat proteins transactivated pHIVSCAT, which contains
TAR (99- and 86-fold, respectively [black bars]). Neither the hybrid
RevCDK9 nor RevCDK9(D167N) protein transactivated the wild-type HIV-1
LTR (striped bars). (B) Both the hybrid RevTat and RevCDK9 but not Tat
and RevCDK9(D167N) proteins increased transcription from pRRESCAT,
which contains the binding site for Rev (SLIIB) in place of TAR. The
hybrid RevCDK9 protein had about one-half the activity of the hybrid
RevTat protein (46-fold versus 26-fold transactivation [black versus
striped bars]). A total of 0.1 µg of each plasmid target and
effector was used. The table below the bar graphs contains the mean
slopes from liquid CAT data and absolute values for the fold
transactivation. Experiments are representative of three independent
transfections performed in duplicate where the standard errors of the
means are given.
|
|
Cyclin T1 is also required for the function of CDK9 in cells.
To determine what other components of P-TEFb might also be required for
the function of CDK9, we performed the following squelching experiments
in cells. Squelching refers to the ability of one domain of a protein
to prevent the relevant cofactor(s) from interacting with the target
protein. Previously, free Tat could efficiently compete for a limiting
coactivator on heterologously tethered hybrid Tat proteins (6,
21). As presented in Fig. 3, a
twofold excess of free CDK9 could decrease levels of transactivation of the hybrid RevCDK9 protein by 80% (15- to 3-fold, lanes 2 and 3).
Western blots revealed that levels of CDK9 were twofold higher than
those of the chimera (data not presented). When increasing amounts of
cyclin T1 were coexpressed with both CDK9 proteins, this squelching
was eliminated in a dose-dependent fashion (Fig. 3, lanes 4 to
6). Importantly, coexpression of these different proteins had little to
no effect on the cotransfected internal control, pCMV
Gal (Fig.
3, bottom). We conclude that cyclin T1 is present in limiting amounts
in cells and is required for the function of CDK9. Based on the data
presented in Fig. 2, this function is the ability of CDK9 to act as a
kinase. Additionally, these results suggest strongly that no other
component of P-TEFb is limiting or required for the function of CDK9 in
cells.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Squelching assays revealed functional interactions
between CDK9 and cyclin T1 in cells. The expression of free CDK9
reduced effects of the hybrid RevCDK9 protein on SLIIB (15- to 3-fold
transactivation [lanes 2 and 3, white and cross-hatched bars]).
However, the coexpression of increasing amounts of cyclin T1 together
with CDK9 and the chimera restored levels of transactivation from 8- to
15-fold (lanes 4 to 6, cross-hatched bars). The coexpression of Tat had
limited effects on the hybrid RevCDK9 protein (16-fold to 10-fold
transactivation [lanes 7 and 8, black bars]). A total of 0.1 µg of
the plasmid effector was used. Amounts of plasmid effectors are given
below the bar graph. The introduction of various proteins had minimal
effects on the expression of LacZ from the cotransfected pCMV Gal,
which served as our internal control plasmid (table; expressed as
absorbance units). Experiments are representative of two independent
transfections performed in duplicate where the standard errors of the
means are given. OD450, optical density at 450 nm.
|
|
We also asked whether Tat had any effect in this system. One could
imagine that Tat could have a positive, a negative, or
no effect on the
hybrid RevCDK9 protein. However, Tat had virtually
no effect on the
hybrid RevCDK9 protein, even at a fivefold excess
of Tat over the
chimera (Fig.
3, lanes 7 and 8). We conclude that
Tat does not affect
interactions between cyclin T1 and CDK9 and
that Tat does not increase
the activity of CDK9. This finding
is in agreement with previous
studies, where no effect of Tat
on the activity of CDK9 was reported in
vitro (
22). In this
scenario, Tat would allow for optimal
interactions between CDK9,
cyclin T1, and TAR RNA and the presentation
of P-TEFb to the transcription
complex.
Complexes containing Tat and P-TEFb bind to TAR specifically.
Since we could establish a functional link among cyclin T1, CDK9, and
the ability of CDK9 to act via RNA, we wondered if P-TEFb could bind to
TAR RNA in vitro. Recently, recombinant Tat and cyclin T1 were
demonstrated to interact with TAR, and this binding depended on an
intact 5' bulge and central loop in TAR (33). Moreover, the
mutant Tat protein lacking its RNA binding arginine-rich domain no
longer facilitated these interactions (33). However, the
ability of the P-TEFb complex to bind to TAR had not been tested. To
this end, we created 293 cells which constitutively express influenza
virus HA-tagged CDK9. In these cells, P-TEFb can be immunoprecipitated
with anti-HA antibodies. As reported previously, the
immunoprecipitation of CDK9 from nuclear extracts purifies P-TEFb,
which can hyperphosphorylate the CTD in vitro (38). TAR and
mutant TAR RNA species were created (Fig.
4A). Anti-HA immunoprecipitates were
tested for their binding to these labeled TAR RNA species in the
presence and absence of Tat.

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 4.
CDK9 as part of P-TEFb binds to TAR RNA in the presence
of Tat. (A) Different TAR sequences were used in our RNA binding
studies. The wild-type TAR contained the entire TAR (60 nucleotides)
and an additional 20 nucleotides to the HindIII site at
its 3' end. bulge lacked the 5' bulge (circled boldface letters).
loop lacked 4 nucleotides of the central loop (boldface letters).
Only relevant nucleotides from the upper stem are presented; the rest
of the loop is schematized by the railroad track. (B) All three TAR
sequences were labeled equivalently, and loop migrated faster on
these 10% polyacrylamide gels. Immunoprecipitated P-TEFb complex (from
HeLa cells expressing HA-tagged CDK9) bound to the wild-type but not
mutant TAR sequences only in the presence of Tat (compare lanes 1 and 2 to lanes 3, 4, 5, and 6). In the absence of HA-tagged CDK9 (wild-type
HeLa cells), no binding to TAR was observed even in the presence of Tat
(lanes 5 and 6). wt, wild type; nt, nucleotide(s).
|
|
As observed from data presented in Fig.
4B, P-TEFb could bind to the
wild-type TAR RNA only in the presence of Tat (lanes
1 and 2). Our Tat
was purified by affinity chromatography following
its overexpression in
Escherichia coli, which yielded a single
stained band on gel
electrophoresis (with the Coomassie blue dye
[
7]).
This Tat-P-TEFb complex could not bind to a TAR RNA where
the 5' bulge
was deleted (

bulge, Fig.
4B, lanes 3 and 4) or where
the central
loop was absent (

loop, Fig.
4B, lanes 5 and 6). Importantly,
in the
absence of the HA-tagged CDK9, immunoprecipitates from
wild-type HeLa
cells demonstrated no binding to TAR in the presence
or absence of Tat
(Fig.
4B, lanes 7 and 8). Additionally, the
mutant Tat containing only
the activation domain of Tat (N-terminal
48 residues) did not
facilitate these interactions (data not presented).
We conclude that
P-TEFb can bind to the wild-type TAR, which contains
an intact 5'
bulge and central loop, and that these interactions
depend on the
presence of the wild-type Tat protein.
 |
DISCUSSION |
In this study, we demonstrated that CDK9 can function via RNA
provided that its kinase domain is intact. However, since no effect of
CDK9 or the hybrid RevCDK9 proteins was observed in the absence of
SLIIB, RNA tethering is required for these effects. Additionally,
cyclin T1 was required for the activity of CDK9 via RNA. Although Tat
had no effect on this heterologous tethering system, P-TEFb complexes,
which contain CDK9, could bind specifically to TAR RNA only in the
presence of Tat. This binding required the 5' bulge and central loop in
TAR. We conclude that Tat-P-TEFb complexes bind to TAR where CDK9
phosphorylates the CTD and possibly other proteins (Fig.
5).

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 5.
A model for interactions among Tat, P-TEFb, and TAR.
CDK9 exists in the P-TEFb complex in cells. This complex minimally
contains CDK9 and cyclin T1. Tat binds to P-TEFb in the absence of TAR.
This complex has also been referred to as the Tat-TAK (Tat-associated
kinase) complex. The assembly of the Tat-P-TEFb complex results in the
formation of a high-affinity surface for the binding to TAR RNA. Both
the 5' bulge and central loop are required for these protein-RNA
interactions. Upon binding to TAR, CDK9 can then phosphorylate the CTD
of RNAPIIo and possibly other targets, which results in efficient
elongation of viral transcription. Importantly, the kinase activity of
CDK9 and the presence of cyclin T1 are required for these effects.
|
|
The hybrid RevCDK9 protein functioned efficiently via RNA. In this
context, CDK9 was required but was by itself not sufficient for
activity, i.e., both an intact kinase domain and cyclin T1 were
required for transactivation. This finding implies that RNA tethering
is involved in catalysis, e.g., in the phosphorylation of the CTD of
RNAPII. Since RNA must pass by the CTD for cotranscriptional processing
(31), it is not surprising that RNA presentation would
represent an optimal way of bringing kinases to the CTD. On the other
hand, most transcriptional activators recruit general transcription factors and RNAPII to the promoter (29) and
therefore do not function via RNA. So far, the only exception is VP16,
which can also interact with TFIIH and possibly other kinases
(35).
Our squelching results suggest that components of P-TEFb, especially
cyclin T1, are also limiting in cells. This finding has some relevance
to the replication of HIV and the establishment of molecular latency.
It is possible that HIV enters cells where levels of P-TEFb are low,
e.g., nonactivated cells (34). In this scenario, there might
be insufficient P-TEFb to support Tat transactivation, leading to a
block in viral transcription. In these cells, optimal Tat
transactivation would occur only upon cellular activation. Finally,
direct binding studies revealed that P-TEFb and Tat form a complex that
binds specifically to TAR, and this cooperative binding depends on the
intact 5' bulge and central loop of TAR. Since CDK9 is encoded on the
human chromosome 4 (4), our data also support the finding
that cyclin T1 is the protein encoded on the human chromosome 12, which
rescues Tat transactivation in rodent cells (33). Moreover,
our studies extend this finding by revealing that Tat is required for
the binding of P-TEFb to TAR RNA.
Tat has placed the control of transcriptional elongation at center
stage. After the initiation of transcription, there exist a series of
well-orchestrated steps leading to productive elongation of
transcription (2, 3, 14, 15, 30). TFIIH plays the major role
in promoter clearance (1, 35), which in HIV is increased by
Tat (8, 12, 27). CDK7 partially phosphorylates the CTD, and
the activity of CDK7 is increased by Tat (8, 12, 27). In
this study, we did not present data on RNA tethering of CDK7. However,
the hybrid RevCDK7, RevCyclinH, and RevMat1 proteins were all inactive
on pRRESCAT. These data could mean that all these chimeras rendered
CDK7 inactive or that the work of CDK7 is completed by the time that
SLIIB, which is longer than TAR, is synthesized (14, 37).
The latter finding would agree nicely with studies that revealed that
TFIIH dissociates from RNAPII early after promoter clearance
(37).
In a subsequent step, CDK9 hyperphosphorylates the CTD and possibly
other targets. In the case of HIV, the entrance of P-TEFb into the
transcription complex depends on Tat and TAR. The conversion of RNAPII
from the IIa to the IIo form then results in an exchange of cellular
proteins that bind to the CTD (24, 36). Studies of Tat will
allow for the dissection of these steps and the characterization of
participating proteins. One intriguing possibility is that RNA
presentation leads to proper positioning and longer association between
cyclin-dependent kinases, CTD, and the transcription complex. How other
promoters, which are also regulated by attenuation, such as
c-myc, c-myb, and c-fos, recruit their
kinase complexes to RNAPII remains to be investigated (3,
30).
Our study is compatible with the following model for interactions among
Tat, TAR, and P-TEFb (Fig. 5). However, it does not exclude an
important role for interactions between Tat and CDK7 (Tat-CAK or
Tat-TFIIH complexes) at an earlier step in transcription from the HIV
promoter. Tat and P-TEFb are known to assemble independently of TAR in
cells (34, 38). These interactions result in structural changes of the Tat-P-TEFb complex that allow for its binding to TAR.
When TAR is made, Tat-P-TEFb complex is recruited to TAR, where CDK9
hyperphosphorylates the CTD of RNAPII and possibly other targets.
Efficient elongation of transcription results. To extend the model,
other components of P-TEFb must be characterized, targets of CDK9 must
be identified, and the elongating RNAPIIo must be analyzed. In the
process, new therapeutic strategies against HIV might be revealed.
 |
ACKNOWLEDGMENTS |
We thank Michael Armanini for expert secretarial assistance and
other members of the laboratory for helpful discussions and comments on
the manuscript.
This work was supported in part by grants from the NIH (AI38532-01 to
B.M.P. and GM35500 to D.H.P.).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Departments of
Medicine, Microbiology, and Immunology, Howard Hughes Medical
Institute, University of California, San Francisco, San Francisco, CA
94143-0703. Phone: (415) 502-1902. Fax: (415) 502-1901. E-mail:
matija{at}itsa.ucsf.edu.
 |
REFERENCES |
| 1.
|
Akoulitchev, S.,
T. P. Makela,
R. A. Weinberg, and D. Reinberg.
1995.
Requirement for TFIIH kinase activity in transcription by RNA polymerase II.
Nature
377:557-560[Medline].
|
| 2.
|
Aso, T.,
J. W. Conaway, and R. C. Conaway.
1995.
The RNA polymerase II elongation complex.
FASEB J.
9:1419-1428[Abstract].
|
| 3.
|
Bentley, D. L.
1995.
Regulation of transcriptional elongation by RNA polymerase II.
Curr. Opin. Genet. Dev.
5:210-216[Medline].
|
| 4.
|
Bullrich, F.,
T. K. MacLachlan,
N. Sang,
T. Druck,
M. L. Veronese,
S. L. Allen,
N. Chiorazzi,
A. Koff,
K. Heubner,
C. M. Croce, and A. Giordano.
1995.
Chromosomal mapping of members of the cdc2 family of protein kinases, cdk3, cdk6, PISSLRE, and PITALRE, and a cdk inhibitor, p27Kip1, to regions involved in human cancer.
Cancer Res.
55:1199-1205[Abstract/Free Full Text].
|
| 5.
|
Caputo, A.,
M. P. Grossi,
R. Bozzini,
C. Rossi,
M. Betti,
P. C. Marconi,
G. Barbanti-Brodano, and P. G. Balboni.
1996.
Inhibition of HIV-1 replication and reactivation from latency by tat transdominant negative mutants in the cysteine rich region.
Gene Ther.
3:235-245[Medline].
|
| 6.
|
Carroll, R.,
B. M. Peterlin, and D. Derse.
1992.
Inhibition of human immunodeficiency virus type 1 Tat activity by coexpression of heterologous trans activators.
J. Virol.
66:2000-2007[Abstract/Free Full Text].
|
| 7.
|
Cujec, T. P.,
H. Cho,
E. Maldonado,
J. Meyer,
D. Reinberg, and B. M. Peterlin.
1997.
The human immunodeficiency virus transactivator Tat interacts with the RNA polymerase II holoenzyme.
Mol. Cell. Biol.
17:1817-1823[Abstract].
|
| 8.
|
Cujec, T. P.,
H. Okamoto,
K. Fujinaga,
J. Meyer,
H. Chamberlin,
D. O. Morgan, and B. M. Peterlin.
1997.
The HIV transactivator TAT binds to the CDK-activating kinase and activates the phosphorylation of the carboxy-terminal domain of RNA polymerase II.
Genes Dev.
11:2645-2657[Abstract/Free Full Text].
|
| 9.
|
Dignam, J. D.,
R. M. Lebovitz, and R. G. Roeder.
1983.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res.
11:1475-1480[Abstract/Free Full Text].
|
| 10.
|
Gait, M. J., and J. Karn.
1995.
Progress in anti-HIV structure-based drug design.
Trends Biotechnol.
13:430-438[Medline].
|
| 11.
|
Garcia-Martinez, L. F.,
D. Ivanov, and R. B. Gaynor.
1997.
Association of Tat with purified HIV-1 and HIV-2 transcription preinitiation complexes.
J. Biol. Chem.
272:6951-6958[Abstract/Free Full Text].
|
| 12.
|
Garcia-Martinez, L. F.,
G. Mavankal,
J. M. Neveu,
W. S. Lane,
D. Ivanov, and R. B. Gaynor.
1997.
Purification of a Tat-associated kinase reveals a TFIIH complex that modulates HIV-1 transcription.
EMBO J.
16:2836-2850[Medline].
|
| 13.
|
Garriga, J.,
X. Mayol, and X. Grana.
1996.
The CDC2-related kinase PITALRE is the catalytic subunit of active multimeric protein complexes.
Biochem. J.
319:293-298.
|
| 14.
|
Goodrich, J. A., and R. Tjian.
1994.
Transcription factors IIE and IIH and ATP hydrolysis direct promoter clearance by RNA polymerase II.
Cell
77:145-156[Medline].
|
| 15.
|
Greenblatt, J.,
J. R. Nodwell, and S. W. Mason.
1993.
Transcriptional antitermination.
Nature
364:401-406[Medline].
|
| 16.
|
Haubrich, R. H.,
C. Flexner,
M. M. Lederman,
M. Hirsch,
C. P. Pettinelli,
R. Ginsberg,
P. Lietman,
F. M. Hamzeh,
S. A. Spector, and D. D. Richman.
1995.
A randomized trial of the activity and safety of Ro 24-7429 (Tat antagonist) versus nucleoside for human immunodeficiency virus infection. The AIDS Clinical Trials Group 213 Team.
J. Infect. Dis.
172:1246-1252[Medline].
|
| 17.
|
Jones, K. A., and B. M. Peterlin.
1994.
Control of RNA initiation and elongation at the HIV-1 promoter.
Annu. Rev. Biochem.
63:717-743[Medline].
|
| 18.
|
Kao, S. Y.,
A. F. Calman,
P. A. Luciw, and B. M. Peterlin.
1987.
Anti-termination of transcription within the long terminal repeat of HIV-1 by Tat gene product.
Nature
330:489-493[Medline].
|
| 19.
|
Lee, S. W.,
H. F. Gallardo,
O. Gaspar,
C. Smith, and E. Gilboa.
1995.
Inhibition of HIV-1 in CEM cells by a potent TAR decoy.
Gene Ther.
2:377-384[Medline].
|
| 20.
|
Luo, Y.,
S. J. Madore,
T. G. Parslow,
B. R. Cullen, and B. M. Peterlin.
1993.
Functional analysis of interactions between Tat and the trans-activation response element of human immunodeficiency virus type 1 in cells.
J. Virol.
67:5617-5622[Abstract/Free Full Text].
|
| 21.
|
Madore, S. J., and B. R. Cullen.
1993.
Genetic analysis of the cofactor requirement for human immunodeficiency virus type 1 Tat function.
J. Virol.
67:3703-3711[Abstract/Free Full Text].
|
| 22.
|
Mancebo, H. S.,
G. Lee,
J. Flygare,
J. Tomassini,
P. Luu,
Y. Zhu,
J. Peng,
C. Blau,
D. Hazuda,
D. Price, and O. Flores.
1997.
P-TEFb kinase is required for HIV Tat transcriptional activation in vivo and in vitro.
Genes Dev.
11:2633-2644[Abstract/Free Full Text].
|
| 23.
|
Marshall, N. F., and D. H. Price.
1995.
Purification of P-TEFb, a transcription factor required for the transition into productive elongation.
J. Biol. Chem.
270:12335-12338[Abstract/Free Full Text].
|
| 24.
|
McCracken, S.,
N. Fong,
K. Yankulov,
S. Ballantyne,
G. Pan,
J. Greenblatt,
S. D. Patterson,
M. Wickens, and D. L. Bentley.
1997.
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[Medline].
|
| 25.
|
Neumann, J. R.,
C. A. Morency, and K. O. Russian.
1987.
A novel rapid assay for chloramphenicol acetyltransferase gene expression.
BioTechniques
5:444-447.
|
| 26.
|
O'Brien, T.,
S. Hardin,
A. Greenleaf, and J. T. Lis.
1994.
Phosphorylation of RNA polymerase II C-terminal domain and transcriptional elongation.
Nature
370:75-77[Medline].
|
| 27.
|
Parada, C. A., and R. G. Roeder.
1996.
Enhanced processivity of RNA polymerase II triggered by Tat-induced phosphorylation of its carboxy-terminal domain.
Nature
384:375-378[Medline].
|
| 28.
|
Peng, J.,
Y. Zhu,
J. T. Milton, and D. H. Price.
1998.
Identification of multiple cyclin subunits of human P-TEFb.
Genes Dev.
12:755-762[Abstract/Free Full Text].
|
| 29.
|
Ptashne, M., and A. Gann.
1997.
Transcriptional activation by recruitment.
Nature
386:569-577[Medline].
|
| 30.
|
Spencer, C. A., and M. Groudine.
1990.
Transcription elongation and eukaryotic gene regulation.
Oncogene
5:777-785[Medline].
|
| 31.
|
Steinmetz, E. J.
1997.
Pre-mRNA processing and the CTD of RNA polymerase II: the tail that wags the dog?
Cell
89:491-494[Medline].
|
| 32.
|
Tiley, L. S.,
S. J. Madore,
M. H. Malim, and B. R. Cullen.
1992.
The VP16 transcription activation domain is functional when targeted to a promoter-proximal RNA sequence.
Genes Dev.
6:2077-2087[Abstract/Free Full Text].
|
| 33.
|
Wei, P.,
M. E. Garber,
S. M. Fang,
W. H. Fischer, and K. A. Jones.
1998.
A novel CDK9-associated C-type cyclin interacts directly with HIV-1 Tat and mediates its high-affinity, loop-specific binding to TAR RNA.
Cell
92:451-462[Medline].
|
| 34.
|
Yang, X. Z.,
M. O. Gold,
D. N. Tang,
D. E. Lewis,
C. H. Herrmann, and A. P. Rice.
1997.
TAK, an HIV Tat-associated kinase, is a member of the cyclin-dependent family of protein kinases and is induced by activation of peripheral blood lymphocytes and differentiation of promyelocytic cell lines.
Proc. Natl. Acad. Sci. USA
94:12331-12336[Abstract/Free Full Text].
|
| 35.
|
Yankulov, K. Y.,
M. Pandes,
S. McCraken,
D. Bouchard, and D. Bentley.
1996.
TFIIH functions in regulating transcriptional elongation by RNA polymerase II in Xenopus oocytes.
Mol. Cell. Biol.
16:3291-3299[Abstract].
|
| 36.
|
Yuryev, A.,
M. Patturajan,
Y. Litingtung,
R. V. Joshi,
C. Gentile,
M. Gebara, and J. L. Corden.
1996.
The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins.
Proc. Natl. Acad. Sci. USA
93:6975-6980[Abstract/Free Full Text].
|
| 37.
|
Zawel, L.,
K. P. Kumar, and D. Reinberg.
1995.
Recycling of the general transcription factors during RNA polymerase II transcription.
Genes Dev.
9:1479-1490[Abstract/Free Full Text].
|
| 38.
|
Zhu, Y.,
T. Pe'ery,
J. Peng,
Y. Ramanathan,
N. Marshall,
T. Marshall,
B. Amendt,
M. B. Mathews, and D. H. Price.
1997.
Transcription elongation factor P-TEFb is required for HIV-1 Tat transactivation in vitro.
Genes Dev.
11:2622-2632[Abstract/Free Full Text].
|
Journal of Virology, September 1998, p. 7154-7159, Vol. 72, No. 9
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gilchrist, D. A., Nechaev, S., Lee, C., Ghosh, S. K. B., Collins, J. B., Li, L., Gilmour, D. S., Adelman, K.
(2008). NELF-mediated stalling of Pol II can enhance gene expression by blocking promoter-proximal nucleosome assembly. Genes Dev.
22: 1921-1933
[Abstract]
[Full Text]
-
Sabo, A., Lusic, M., Cereseto, A., Giacca, M.
(2008). Acetylation of Conserved Lysines in the Catalytic Core of Cyclin-Dependent Kinase 9 Inhibits Kinase Activity and Regulates Transcription. Mol. Cell. Biol.
28: 2201-2212
[Abstract]
[Full Text]
-
Mahlknecht, U., Dichamp, I., Varin, A., Van Lint, C., Herbein, G.
(2008). NF-{kappa}B-dependent control of HIV-1 transcription by the second coding exon of Tat in T cells. J. Leukoc. Biol.
83: 718-727
[Abstract]
[Full Text]
-
Fu, J., Yoon, H.-G., Qin, J., Wong, J.
(2007). Regulation of P-TEFb Elongation Complex Activity by CDK9 Acetylation. Mol. Cell. Biol.
27: 4641-4651
[Abstract]
[Full Text]
-
Barboric, M., Yik, J. H. N., Czudnochowski, N., Yang, Z., Chen, R., Contreras, X., Geyer, M., Matija Peterlin, B., Zhou, Q.
(2007). Tat competes with HEXIM1 to increase the active pool of P-TEFb for HIV-1 transcription. Nucleic Acids Res
35: 2003-2012
[Abstract]
[Full Text]
-
Drozina, G., Kohoutek, J., Nishiya, T., Peterlin, B. M.
(2006). Sequential Modifications in Class II Transactivator Isoform 1 Induced by Lipopolysaccharide Stimulate Major Histocompatibility Complex Class II Transcription in Macrophages. J. Biol. Chem.
281: 39963-39970
[Abstract]
[Full Text]
-
Kempf, M.-C., Jones, J., Heil, M. L., Kutsch, O.
(2006). A High-Throughput Drug Screening System for HIV-1 Transcription Inhibitors. J Biomol Screen
11: 807-815
[Abstract]
-
Jiang, H., Zhang, F., Kurosu, T., Peterlin, B. M.
(2005). Runx1 Binds Positive Transcription Elongation Factor b and Represses Transcriptional Elongation by RNA Polymerase II: Possible Mechanism of CD4 Silencing. Mol. Cell. Biol.
25: 10675-10683
[Abstract]
[Full Text]
-
Barboric, M., Zhang, F., Besenicar, M., Plemenitas, A., Peterlin, B. M.
(2005). Ubiquitylation of Cdk9 by Skp2 Facilitates Optimal Tat Transactivation. J. Virol.
79: 11135-11141
[Abstract]
[Full Text]
-
Schulte, A., Czudnochowski, N., Barboric, M., Schonichen, A., Blazek, D., Peterlin, B. M., Geyer, M.
(2005). Identification of a Cyclin T-Binding Domain in Hexim1 and Biochemical Analysis of Its Binding Competition with HIV-1 Tat. J. Biol. Chem.
280: 24968-24977
[Abstract]
[Full Text]
-
Shan, B., Zhuo, Y., Chin, D., Morris, C. A., Morris, G. F., Lasky, J. A.
(2005). Cyclin-dependent Kinase 9 Is Required for Tumor Necrosis Factor-{alpha}-stimulated Matrix Metalloproteinase-9 Expression in Human Lung Adenocarcinoma Cells. J. Biol. Chem.
280: 1103-1111
[Abstract]
[Full Text]
-
Kutsch, O., Levy, D. N., Bates, P. J., Decker, J., Kosloff, B. R., Shaw, G. M., Priebe, W., Benveniste, E. N.
(2004). Bis-Anthracycline Antibiotics Inhibit Human Immunodeficiency Virus Type 1 Transcription. Antimicrob. Agents Chemother.
48: 1652-1663
[Abstract]
[Full Text]
-
Roisin, A., Robin, J.-P., Dereuddre-Bosquet, N., Vitte, A.-L., Dormont, D., Clayette, P., Jalinot, P.
(2004). Inhibition of HIV-1 Replication by Cell-penetrating Peptides Binding Rev. J. Biol. Chem.
279: 9208-9214
[Abstract]
[Full Text]
-
Chiu, Y.-L., Cao, H., Jacque, J.-M., Stevenson, M., Rana, T. M.
(2004). Inhibition of Human Immunodeficiency Virus Type 1 Replication by RNA Interference Directed against Human Transcription Elongation Factor P-TEFb (CDK9/CyclinT1). J. Virol.
78: 2517-2529
[Abstract]
[Full Text]
-
Xie, B., Calabro, V., Wainberg, M. A., Frankel, A. D.
(2004). Selection of TAR RNA-Binding Chameleon Peptides by Using a Retroviral Replication System. J. Virol.
78: 1456-1463
[Abstract]
[Full Text]
-
Fujinaga, K., Irwin, D., Huang, Y., Taube, R., Kurosu, T., Peterlin, B. M.
(2004). Dynamics of Human Immunodeficiency Virus Transcription: P-TEFb Phosphorylates RD and Dissociates Negative Effectors from the Transactivation Response Element. Mol. Cell. Biol.
24: 787-795
[Abstract]
[Full Text]
-
Lin, X., Irwin, D., Kanazawa, S., Huang, L., Romeo, J., Yen, T. S. B., Peterlin, B. M.
(2003). Transcriptional Profiles of Latent Human Immunodeficiency Virus in Infected Individuals: Effects of Tat on the Host and Reservoir. J. Virol.
77: 8227-8236
[Abstract]
[Full Text]
-
Shoya, Y., Tokunaga, K., Sawa, H., Maeda, M., Ueno, T., Yoshikawa, T., Hasegawa, H., Sata, T., Kurata, T., Hall, W. W., Cullen, B. R., Takahashi, H.
(2003). Human topoisomerase I promotes HIV-1 proviral DNA synthesis: Implications for the species specificity and cellular tropism of HIV-1 infection. Proc. Natl. Acad. Sci. USA
100: 8442-8447
[Abstract]
[Full Text]
-
Zhang, F., Barboric, M., Blackwell, T. K., Peterlin, B. M.
(2003). A model of repression: CTD analogs and PIE-1 inhibit transcriptional elongation by P-TEFb. Genes Dev.
17: 748-758
[Abstract]
[Full Text]
-
Yedavalli, V. S. R. K., Benkirane, M., Jeang, K.-T.
(2003). Tat and Trans-activation-responsive (TAR) RNA-independent Induction of HIV-1 Long Terminal Repeat by Human and Murine Cyclin T1 Requires Sp1. J. Biol. Chem.
278: 6404-6410
[Abstract]
[Full Text]
-
Xie, B., Wainberg, M. A., Frankel, A. D.
(2003). Replication of Human Immunodeficiency Viruses Engineered with Heterologous Tat-Transactivation Response Element Interactions. J. Virol.
77: 1984-1991
[Abstract]
[Full Text]
-
Fujinaga, K., Irwin, D., Taube, R., Zhang, F., Geyer, M., Peterlin, B. M.
(2002). A Minimal Chimera of Human Cyclin T1 and Tat Binds TAR and Activates Human Immunodeficiency Virus Transcription in Murine Cells. J. Virol.
76: 12934-12939
[Abstract]
[Full Text]
-
Fujinaga, K., Irwin, D., Geyer, M., Peterlin, B. M.
(2002). Optimized Chimeras between Kinase-Inactive Mutant Cdk9 and Truncated Cyclin T1 Proteins Efficiently Inhibit Tat Transactivation and Human Immunodeficiency Virus Gene Expression. J. Virol.
76: 10873-10881
[Abstract]
[Full Text]
-
Richter, S., Ping, Y.-H., Rana, T. M.
(2002). TAR RNA loop: A scaffold for the assembly of a regulatory switch in HIV replication. Proc. Natl. Acad. Sci. USA
99: 7928-7933
[Abstract]
[Full Text]
-
Lin, X., Taube, R., Fujinaga, K., Peterlin, B. M.
(2002). P-TEFb Containing Cyclin K and Cdk9 Can Activate Transcription via RNA. J. Biol. Chem.
277: 16873-16878
[Abstract]
[Full Text]
-
Hoque, M., Young, T. M., Lee, C.-G., Serrero, G., Mathews, M. B., Pe'ery, T.
(2002). The Growth Factor Granulin Interacts with Cyclin T1 and Modulates P-TEFb-Dependent Transcription. Mol. Cell. Biol.
23: 1688-1702
[Abstract]
[Full Text]
-
Martin-Serrano, J., Li, K., Bieniasz, P. D.
(2002). Cyclin T1 Expression Is Mediated by a Complex and Constitutively Active Promoter and Does Not Limit Human Immunodeficiency Virus Type 1 Tat Function in Unstimulated Primary Lymphocytes. J. Virol.
76: 208-219
[Abstract]
[Full Text]
-
Taube, R., Lin, X., Irwin, D., Fujinaga, K., Peterlin, B. M.
(2002). Interaction between P-TEFb and the C-Terminal Domain of RNA Polymerase II Activates Transcriptional Elongation from Sites Upstream or Downstream of Target Genes. Mol. Cell. Biol.
22: 321-331
[Abstract]
[Full Text]
-
Ghose, R., Liou, L.-Y., Herrmann, C. H., Rice, A. P.
(2001). Induction of TAK (Cyclin T1/P-TEFb) in Purified Resting CD4+ T Lymphocytes by Combination of Cytokines. J. Virol.
75: 11336-11343
[Abstract]
[Full Text]
-
Marcello, A., Cinelli, R. A. G., Ferrari, A., Signorelli, A., Tyagi, M., Pellegrini, V., Beltram, F., Giacca, M.
(2001). Visualization of in Vivo Direct Interaction between HIV-1 TAT and Human Cyclin T1 in Specific Subcellular Compartments by Fluorescence Resonance Energy Transfer. J. Biol. Chem.
276: 39220-39225
[Abstract]
[Full Text]
-
Foskett, S. M., Ghose, R., Tang, D. N., Lewis, D. E., Rice, A. P.
(2001). Antiapoptotic Function of Cdk9 (TAK/P-TEFb) in U937 Promonocytic Cells. J. Virol.
75: 1220-1228
[Abstract]
[Full Text]
-
Garber, M. E., Mayall, T. P., Suess, E. M., Meisenhelder, J., Thompson, N. E., Jones, K. A.
(2000). CDK9 Autophosphorylation Regulates High-Affinity Binding of the Human Immunodeficiency Virus Type 1 Tat-P-TEFb Complex to TAR RNA. Mol. Cell. Biol.
20: 6958-6969
[Abstract]
[Full Text]
-
Barboric, M., Taube, R., Nekrep, N., Fujinaga, K., Peterlin, B. M.
(2000). Binding of Tat to TAR and Recruitment of Positive Transcription Elongation Factor b Occur Independently in Bovine Immunodeficiency Virus. J. Virol.
74: 6039-6044
[Abstract]
[Full Text]
-
Ivanov, D., Kwak, Y. T., Guo, J., Gaynor, R. B.
(2000). Domains in the SPT5 Protein That Modulate Its Transcriptional Regulatory Properties. Mol. Cell. Biol.
20: 2970-2983
[Abstract]
[Full Text]
-
Price, D. H.
(2000). P-TEFb, a Cyclin-Dependent Kinase Controlling Elongation by RNA Polymerase II. Mol. Cell. Biol.
20: 2629-2634
[Full Text]
-
Koth, C. M., Botuyan, M. V., Moreland, R. J., Jansma, D. B., Conaway, J. W., Conaway, R. C., Chazin, W. J., Friesen, J. D., Arrowsmith, C. H., Edwards, A. M.
(2000). Elongin from Saccharomyces cerevisiae. J. Biol. Chem.
275: 11174-11180
[Abstract]
[Full Text]
-
Kashanchi, F., Agbottah, E. T., Pise-Masison, C. A., Mahieux, R., Duvall, J., Kumar, A., Brady, J. N.
(2000). Cell Cycle-Regulated Transcription by the Human Immunodeficiency Virus Type 1 Tat Transactivator. J. Virol.
74: 652-660
[Abstract]
[Full Text]
-
Taube, R., Fujinaga, K., Irwin, D., Wimmer, J., Geyer, M., Peterlin, B. M.
(2000). Interactions between Equine Cyclin T1, Tat, and TAR Are Disrupted by a Leucine-to-Valine Substitution Found in Human Cyclin T1. J. Virol.
74: 892-898
[Abstract]
[Full Text]
-
Bieniasz, P. D., Grdina, T. A., Bogerd, H. P., Cullen, B. R.
(1999). Recruitment of cyclin T1/P-TEFb to an HIV type 1 long terminal repeat promoter proximal RNA target is both necessary and sufficient for full activation of transcription. Proc. Natl. Acad. Sci. USA
96: 7791-7796
[Abstract]
[Full Text]
-
Long, M. C., Leong, V., Schaffer, P. A., Spencer, C. A., Rice, S. A.
(1999). ICP22 and the UL13 Protein Kinase Are both Required for Herpes Simplex Virus-Induced Modification of the Large Subunit of RNA Polymerase II. J. Virol.
73: 5593-5604
[Abstract]
[Full Text]
-
Bieniasz, P. D., Grdina, T. A., Bogerd, H. P., Cullen, B. R.
(1999). Highly Divergent Lentiviral Tat Proteins Activate Viral Gene Expression by a Common Mechanism. Mol. Cell. Biol.
19: 4592-4599
[Abstract]
[Full Text]
-
Fujinaga, K., Taube, R., Wimmer, J., Cujec, T. P., Peterlin, B. M.
(1999). Interactions between human cyclin T, Tat, and the transactivation response element (TAR) are disrupted by a cysteine to tyrosine substitution found in mouse cyclin T. Proc. Natl. Acad. Sci. USA
96: 1285-1290
[Abstract]
[Full Text]
-
Garber, M. E., Wei, P., KewalRamani, V. N., Mayall, T. P., Herrmann, C. H., Rice, A. P., Littman, D. R., Jones, K. A.
(1998). The interaction between HIV-1 Tat and human cyclin T1 requires zinc and a critical cysteine residue that is not conserved in the murine CycT1 protein. Genes Dev.
12: 3512-3527
[Abstract]
[Full Text]
-
GARBER, M.E., WEI, P., JONES, K.A.
(1998). HIV-1 Tat Interacts with Cyclin T1 to Direct the P-TEFb CTD Kinase Complex to TAR RNA. Cold Spring Harb Symp Quant Biol
63: 371-380
[Abstract]
-
Sawaya, B. E., Khalili, K., Gordon, J., Taube, R., Amini, S.
(2000). Cooperative Interaction between HIV-1 Regulatory Proteins Tat and Vpr Modulates Transcription of the Viral Genome. J. Biol. Chem.
275: 35209-35214
[Abstract]
[Full Text]
-
Zhang, J., Tamilarasu, N., Hwang, S., Garber, M. E., Huq, I., Jones, K. A., Rana, T. M.
(2000). HIV-1 TAR RNA Enhances the Interaction between Tat and Cyclin T1. J. Biol. Chem.
275: 34314-34319
[Abstract]
[Full Text]
-
Chao, S.-H., Price, D. H.
(2001). Flavopiridol Inactivates P-TEFb and Blocks Most RNA Polymerase II Transcription in Vivo. J. Biol. Chem.
276: 31793-31799
[Abstract]
[Full Text]
-
Kino, T., Slobodskaya, O., Pavlakis, G. N., Chrousos, G. P.
(2002). Nuclear Receptor Coactivator p160 Proteins Enhance the HIV-1 Long Terminal Repeat Promoter by Bridging Promoter-bound Factors and the Tat-P-TEFb Complex. J. Biol. Chem.
277: 2396-2405
[Abstract]
[Full Text]
-
Zhou, M., Nekhai, S., Bharucha, D. C., Kumar, A., Ge, H., Price, D. H., Egly, J.-M., Brady, J. N.
(2001). TFIIH Inhibits CDK9 Phosphorylation during Human Immunodeficiency Virus Type 1 Transcription. J. Biol. Chem.
276: 44633-44640
[Abstract]
[Full Text]
-
Holloway, A. F., Occhiodoro, F., Mittler, G., Meisterernst, M., Shannon, M. F.
(2000). Functional Interaction between the HIV Transactivator Tat and the Transcriptional Coactivator PC4 in T Cells. J. Biol. Chem.
275: 21668-21677
[Abstract]
[Full Text]