Previous Article | Next Article 
J Virol, August 1998, p. 6937-6943, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Maintenance of an Intact Human Immunodeficiency Virus Type 1 vpr Gene following Mother-to-Infant Transmission
Venkat R. K.
Yedavalli,1
Colombe
Chappey,2 and
Nafees
Ahmad1,*
Department of Microbiology and Immunology,
College of Medicine, The University of Arizona Health Sciences
Center, Tucson, Arizona 85724,1 and
National Center for Biotechnology Information, National
Library of Medicine, National Institutes of Health, Bethesda,
Maryland 208942
Received 5 March 1998/Accepted 5 May 1998
 |
ABSTRACT |
The vpr sequences from six human immunodeficiency virus
type 1 (HIV-1)-infected mother-infant pairs following perinatal
transmission were analyzed. We found that 153 of the 166 clones
analyzed from uncultured peripheral blood mononuclear cell DNA samples
showed a 92.17% frequency of intact vpr open reading
frames. There was a low degree of heterogeneity of vpr
genes within mothers, within infants, and between epidemiologically
linked mother-infant pairs. The distances between vpr
sequences were greater in epidemiologically unlinked individuals than
in epidemiologically linked mother-infant pairs. Moreover, the
infants' sequences displayed patterns similar to those seen in their
mothers. The functional domains essential for Vpr activity, including
virion incorporation, nuclear import, and cell cycle arrest and
differentiation were highly conserved in most of the sequences.
Phylogenetic analyses of 166 mother-infant pairs and 195 other
available vpr sequences from HIV databases formed distinct
clusters for each mother-infant pair and for other vpr
sequences and grouped the six mother-infant pairs' sequences with
subtype B sequences. A high degree of conservation of intact and
functional vpr supports the notion that vpr
plays an important role in HIV-1 infection and replication in
mother-infant isolates that are involved in perinatal transmission.
 |
TEXT |
Mother-to-infant transmission of
human immunodeficiency virus type 1 (HIV-1) occurs at an estimated rate
of more than 30% and is one of the major causes of AIDS in children
(1, 11, 17, 34, 43). In studies of the molecular
characterization of HIV-1 from mothers and infants with perinatal
transmission, we (2) and others (35, 42, 49) have
shown a selective transmission of HIV-1 from mothers to infants, based
on the sequence analyses of HIV-1 envelope variable regions. Selective
transmission of HIV-1 has also been demonstrated in sexual transmission
from transmitters to recipients, including a homogeneous sequence
population present in the recipients (32, 48, 52, 53).
Factors influencing maternal-fetal transmission of HIV-1 include
advanced clinical stage of the mother, low CD4+ counts,
maternal immune response to HIV-1 antigenemia, recent infection, high
viral load in mothers, maternal disease progression, and HIV-1
heterogeneity in the env region of mothers (1, 2, 34,
43, 49). However, the viral determinants involved in perinatal or
sexual transmission are not known, which makes it difficult to develop
strategies for prevention and treatment of HIV-1 infection in children.
Nonetheless, it is possible that several other regions of the HIV-1
genome including accessory and regulatory genes are one of the viral
determinants associated with mother-to-infant transmission. Recently,
we have shown that an intact and functional vif open reading
frame was conserved in HIV-1-infected mother-infant pairs following
perinatal transmission (50). Along with vif,
HIV-1 encodes another accessory gene, namely, vpr, that is
conserved among diverse members of the primate immunodeficiency viruses
and confers selection for its function in vivo (15, 44, 46).
We, therefore, sought to analyze vpr sequences from
mother-infant isolates following perinatal transmission.
The vpr open reading frame encodes a 14-kDa virion- and
cell-associated protein (6, 10, 27) that is dispensable for HIV-1 replication in T-cell lines (4, 9) but is required for
efficient replication in primary monocytes/macrophages (4, 5,
7). Several possible roles for Vpr in HIV-1 replication have been
suggested, including a modest transactivation of HIV-1 long terminal
repeat (6), enhancement of the nuclear migration of the
preintegration complex in newly infected nondividing cells (16), and inhibition of the establishment of chronic HIV-1
infection (36, 40). In addition, Vpr has been shown to
arrest cells in the G2/M phase of the cell cycle (18,
40). Moreover, Vpr has been reported to be capable of inducing
latent cells into high-level viral production (25). However,
the role of Vpr in AIDS pathogenesis is not very well understood. Lang
et al. (23) have shown that macaques infected with the
simian immunodeficiency virus SIVmac239 defective in vpr
progressed to AIDS slowly compared to SIVmac239 containing a wild-type
vpr. In vitro studies have shown that generation of
defective vpr genes results in viral persistence (20,
40) and loss of cytopathogenicity (20). While some
studies have demonstrated an association between the presence of
defective or mutated vpr quasispecies and long-term nonprogressors of HIV-1 infection (41, 47), others have
shown a lack of correlation (8, 51). However, a complete
analysis of vpr sequences following HIV-1 mother-infant
transmission has not been performed. Mutations in the vpr
gene may potentially affect mother-to-infant transmission of HIV-1,
since this gene is essential for efficient viral replication in primary
monocytes/macrophages (4, 5, 7) and the macrophage-tropic
viruses are believed to be involved in transmission (31,
53).
To characterize the HIV-1 vpr isolates involved in
mother-to-infant transmission, we have analyzed the vpr
sequences from six infected mother-infant pairs following perinatal
transmission. We show that the vpr open reading frame was
conserved in most of the mother-infant pair sequences. The domains
required for Vpr function were also present in most of the
mother-infant pair sequences, suggesting selection for Vpr function in
vivo. Taken together, these findings indicate that vpr is
important for HIV-1 infection and replication following
mother-to-infant transmission.
Patient population, sample collection, and clinical
parameters.
This study was approved by the Human Subjects
Committee of the University of Arizona, Tucson, Arizona, and the
Institutional Review Board of the Children's Hospital Medical Center,
Cincinnati, Ohio, and written informed consent was obtained for
participation in the study. Blood samples were collected from six
HIV-1-infected mother-infant pairs, and the ages of the infants at the
time of specimen collection were 6 weeks (infant A), 4.75 months
(infant B), 14 months (infant C), 28 months (infant D), 34 months
(infant E), and 1 week (infant F) following perinatal transmission.
Mothers A, B, C, D, and F and infants A, B, and F were asymptomatic,
whereas mother E and infants C, D, and E had symptomatic AIDS.
Moreover, mother E and infants C, E, and F were on zidovudine, and
infant D was on zalcitibine.
PCR amplification and cloning and sequencing of HIV-1
vpr genes.
The peripheral blood mononuclear cells
(PBMC) were isolated by a single-step Ficoll-Paque procedure
(Pharmacia-LKB) from whole-blood samples from HIV-1-infected
mother-infant pairs. DNA was isolated by a modified version of the
procedure described previously (2). TNE buffer (0.5 M
Tris-HCl [pH 7.5], 0.1 M NaCl, 1 mM EDTA) (0.5 ml) was used. A
two-step PCR amplification, first with outer
primers VIF5 (5'TGGCAGCAATTTCACCGGTACTA, positions 4580 to 4602, sense) and VPR1 (5'CAACTTGGCAATGAAAGCAACAC,
positions 5916 to 5939, antisense) and then with nested or inner
primers VIF6 (5'TCAAGCAGGAATTTGGAATTCCC, positions 4633 to
4655, sense) and VPR2 (5'GGTACAAGCAGTTTAGGCTGACT, positions
5875 to 5898, antisense), was performed to amplify vpr sequences from infected patient PBMC DNA samples (2, 3). Equal amounts of HIV-1 PBMC DNA were used from the patients as determined by end point dilution (13). The PCRs were
performed in a 25-µl reaction mixture containing 2.5 µl of 10× LA
PCR buffer which consists of 25 mM TAPS
[tris(hydroxymethyl)-methyl-amino propanesulfonic acid, sodium salt]
(pH 9.3), 50 mM KCl, 2 mM MgCl2, 1 mM 2-mercaptoethanol,
400 µM dATP, 400 µM dCTP, 400 µM dGPT, and 400 µM TTP, 0.2 µM
(each) outer primer, and 2.5 U of TaKaRa LA Taq polymerase
(TaKaRa Biomedicals, Shiga, Japan). PCR was performed for 35 cycles,
with 1 cycle consisting of 30 s at 95°C, 45 s at 50°C,
and 3 min at 72°C. After the first round of PCR, 1 µl of the
product was amplified for 35 cycles with the corresponding inner
primers, with 1 cycle consisting of 30 s at 95°C, 45 s at 55°C, and 3 min at 72°C. We also included a known HIV-1 NL 4-3 sequence for PCR amplifications as a control to assess errors generated
by TaKaRa LA Taq polymerase. The PCR products amplified by
inner primer pair VIF6-VPR2 that yielded 1,246-bp fragments (not
shown) were blunt ended by DNA polymerase I (Gibco-BRL, Gaithersburg, Md.), treated with T4 polynucleotide kinase (Gibco-BRL), and cloned into the SmaI site of pGem 3Zf (+) vector (Promega Corp.,
Madison, Wis.). The clones with the correct-size inserts were selected for DNA preparation followed by nucleotide sequencing of 9 to 19 clones from each patient according to Sequenase protocol (U.S. Biochemical Corp., Cleveland, Ohio).
Computer alignment and analysis of HIV-1 vpr
sequences.
The nucleotide sequences of the vpr genes
(288 bp) from the six mother-infant pairs were translated to the
corresponding amino acid sequences (96 amino acids). Alignments were
performed by hand, as one position contained a gap. Pairwise distances,
defined as the percentages of mismatches between two aligned nucleotide sequences, were used to study the extent of genetic variability for
sequences within an individual and between mother and infant. For
intraindividual variability (within mothers' and infants' sequence
sets), pairwise distances were calculated for all possible comparisons
of pairs of sequences within the set. For interindividual variability
(between mother-infant sets and between epidemiologically unlinked
individual sets), each sequence from one set was compared with each
sequence of the other set. The selection pressure was calculated as the
ratio of nonsynonymous to synonymous substitutions (38) by
comparing all possible pairs of sequences between mothers and their
infants. The phylogenetic analysis was performed by using the software
PHYLIP, version 3.5 (12). The tree was built from a distance
matrix (function DNADIST) by using the neighbor-joining method
(function NEIGHBOR). The robustness of the neighbor-joining tree was
assessed by bootstrap resampling of the multiple alignments (function
SEQBOOT). We traced two trees, one for 166 vpr sequences from 6 mother-infant pairs with HIV-1 NL 4-3 as a root and the second
for 166 mother-infant pair vpr sequences and 195 outgroup sequences found in the HIV databases. These outgroup sequences were
extracted by using Entrez version 6.04 (45) and handled by
using Sequin version 2.25 (19).
Analysis of vpr sequences in mother-infant
isolates.
The alignment of multiple deduced amino acid sequences
(96 amino acids) of 166 vpr clones from six mother-infant
pairs and subtype B consensus sequence is shown in Fig.
1. The coding potential of the
vpr open reading frame was maintained in most of the
sequences in 47,808 bp sequenced. We analyzed 166 different
vpr clones, and 153 clones contained intact vpr
open reading frames, a 92.17% frequency of conservation of intact
vpr open reading frames. The frequency of defective
vpr genes in our six mother-infant pair sequences was
7.83%. We found that a total of seven clones contained stop codons. In
addition, five clones (10IG, 5MB, 2IA, 8IA, and 10IA) lacked initiation
codons, and one clone (16IA) had a 90-bp (30-amino-acid) deletion at
the C terminus. Our vpr sequences displayed amino acid
sequence patterns in each mother-infant pair that were not seen in
epidemiologically unlinked pairs (Fig. 1). Interestingly, there were
several amino acid motifs present in most of the mother-infant pair
sequences, including an asparagine (N) at position 28, an alanine (A)
or threonine (T) at position 55, and a glutamine (Q) or arginine (R) at
position 77.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of multiple deduced amino acid sequences of
the vpr gene of HIV-1 from six mother-infant pairs following
perinatal transmission. In the six mother-infant pair sequence
designations, the letters A to F indicate the mother-infant pairs A, B,
C, D, E, and F, respectively, the letter M indicates the mother and the
letter I indicates the infant in each mother-infant pair, and the
numbers are the clone number. In the alignment, the top sequence
(CON-B) is the consensus sequence of the clade or subtype B as defined
elsewhere (37). In the sequences, amino acids identical to
those in the CON-B sequence (.), gaps introduced to maximize alignment
( ), and stop codons (asterisks) are shown. The number of identical
clones is indicated in parentheses. Above the alignment, the asterisks
indicate the amino acids essential for Vpr function, including virion
incorporation, cytoskeleton function, nuclear transport, and cell cycle
arrest (10, 28-30).
|
|
Comparison of vpr sequences of epidemiologically linked
mother-infant isolates.
To determine the degree of variability of
the vpr gene from six mother-infant pairs, we analyzed
variation in nucleotide and amino acid sequences as shown in Table
1. The nucleotide sequences of the
vpr gene within mothers (A, B, C, D, E, and F) differed by
2.2, 0.6, 0.8, 0.6, 2.5, and 0.7 (median values), respectively, ranging
from 0 to 5.3%. The variability in sequences from the infants (A, B,
C, D, E, and F) was very similar to the variability in the sequences
from the mothers and differed by 0.8, 0.5, 1, 1.1, 1.5, and 1.5%
(median values), respectively, ranging from 0 to 3.7%. Interestingly,
the variability between mother-and-infant sets (epidemiologically
linked pairs A, B, C, D, E, and F) was also on the same order of 2.4, 0.8, 1.2, 1.1, 2.9, and 1.6% (median values), respectively, ranging
from 0 to 5.3%. For mother-infant pairs A, B, C, D, E, and F, the
median values of amino acid sequence variability of vpr were
as follows: within mothers, 3.5, 1.6, 1.3, 0.6, 3.5, and 1.1%,
respectively; within infants, 2.1, 0.9, 2.2, 2.0, 2.1, and 3.8%,
respectively; and between epidemiologically linked mother-infant pairs,
3.0, 1.3, 1.2, 1.3, 3.4, and 3.2%, respectively. Moreover, there was
no difference in variability of vpr sequences with
increasing infants' age. We also determined whether low variability of
the vpr gene from mother-infant pair isolates is due to the
errors made by TaKaRa LA polymerase used in our study. We rarely
found any errors made by TaKaRa LA polymerase when using a known
sequence of HIV-1 NL 4-3 for PCR amplifications and DNA
sequencing of the vpr gene. The median distributions of distances for sequences from the same mother and the same infant, between epidemiologically linked mother-infant pairs, and between two
epidemiologically unlinked mothers were 1.1, 1.0, 1.8, and 5.8%,
respectively (not shown). Thus, by using the sequence distances of a
conserved region, such as vpr, we were able to easily
differentiate the epidemiologically unlinked individuals from
epidemiologically linked mother-infant pairs. The selective pressure on
mother-infant pair vpr sequences was determined
by calculating the ratios of nonsynonymous and synonymous substitutions
and showed no evidence for positive selection pressure for
change. Comparisons of infant sequences with mother sequences
from pairs A, B, C, D, E, and F gave ratios of nonsynonymous to
synonymous substitution, dn/ds, of
0.07, 0.08, 0.1, 0.2, 0.08, and 0.3, respectively. Thus, there was very
little selection pressure (a ratio of <1) on vpr sequences to change.
Phylogenetic analysis of vpr sequences of mother-infant
isolates.
To determine the similarity relationships among the 166 vpr sequences from six mother-infant pairs and 195 other
vpr sequences from infected individuals present in HIV
databases, we performed phylogenetic analyses as shown in Fig. 2 and 3.
The phylogenetic tree traced for 166 vpr sequences revealed
that the six mother-infant pairs were well discriminated, separated,
and confined within subtrees (Fig. 2),
indicating the absence of PCR product cross-contamination (21,
24). These subtrees were equidistant from each other. The average
distance between two sequences from different pairs (intersubtree
distance) ranged from 5% between pairs C and E to 8.8% between pairs
C and F. High bootstrap values further emphasized the separation
between the subtrees as distinct clusters. Bootstrap analysis performed
on resampling the data sets 100 times formed the same clusters of the
sequences 87 to 100 times in the six mother-infant pairs. Furthermore,
the six subtrees showed homogeneous vpr sequences in which
some sequences were intermingled.

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic analysis of vpr sequences from
six mother-infant pairs (A, B, C, D, E, and F). The distances were
calculated between the nucleotide sequences from the six mother-infant
pairs. Each leaf of the tree represents one vpr sequence.
The mother sequences in each pair are labeled with the number of the
clones (Fig. 1), whereas the infant sequences are unlabeled. The tree
was rooted by using the reference HIV-1 sequence, NL 4-3 (37). The numbers at branch points indicate the occurrence
number of branches over 100 bootstrap resampling of the data sets. The
mother-infant pairs formed a distinct cluster and are discriminated,
separated, and confined within subtrees, indicating the absence of PCR
product cross-contamination (21, 24).
|
|
In the second phylogenetic analysis (Fig.
3), 166
vpr sequences from six
mother-infant pairs and 195 other available
vpr sequences
were included. These additional
vpr sequences from several
independent
studies analyzing
vpr genes from infected
individuals (
14,
22,
41,
47,
51) and 48 other sequences
belonged to two main
HIV-1 groups, group M (M for major) and group O (O
for outlier).
Group M includes at least 10 distinct HIV-1 subtypes
designated
A to J, and we included subtypes A, B, C, and D and
recombinants
A/C, A/E, A/G, and A/D. The tree grouped the 361 sequences
in
a manner similar to that for the
env,
gag, and
vif genes (
2,
42,
49,
50). The largest, starlike
cluster, contained all
subtype B sequences, including the six
mother-infant pair sequences.
Although diverging independently from the
center of the subtype
B, subtype D (ELI, NDK, MAL, and 84ZR085)
appeared as distant
from subtype B sequences as two subtype B
sequences. Subtype C,
subtype A/C, and subtypes A, A/E, and A/G were
more distant from
subtype B and diverged in three separate lineages. In
subtype
B, sets of sequences from the same individuals and from each
mother-infant
pair were closely grouped in subtrees. Subtype B
sequences from
different individuals were shown approximately
equidistant from
the others as if arising from a common ancestor. The
genetic distances
among subtype B sequences, intra- and interindividual
distances
included, was 6% on average, ranging from 0 to 18%. This
value
did not change when subtype D was included. The average distance
between subtypes A and C and recombinant sequences was 10%, ranging
from 0 to 17%. We measured the global variability of subtype B
by
generating a consensus sequence, supposedly at the center of
the
subtree B, and comparing all subtype B sequences to it. We
generated
the consensus sequence from the most frequent nucleotide
at each
position of the alignment. The genetic distances between
the 335 subtype B sequences and the consensus B sequence was 4%,
ranging from
0.1 to 8%. When subtype D sequences were included
in the calculation,
the variability around the consensus B sequence
was up to 10%.
Subtypes A, C, and recombinants had genetic distances
of 10 to 15%
from the consensus B sequence, and group O had 21%
genetic distance
from the consensus B sequence on average.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 3.
Phylogenetic analysis of 166 mother-infant pair (A, B,
C, D, E, and F) sequences and 195 other vpr sequences from
HIV-1 databases. The sequences from Kuiken et al. (22) are
labeled Dutch (samples from Amsterdam Cohorts) and Scott (from Scottish
samples). The sequences from Michael et al. (33) were
obtained from a long-term survivor, 3799, and two control patients
CONTRL1 and CONTRL2. The sequences from Saksena et al. (41)
were obtained from Australian patients Aus890 and Aus1149. The
sequences from Ge et al. (14) and Wang et al.
(47) were obtained from two long-term nonprogressors (LTNPs)
and drug users (IVDUs). The other 45 sequences from the HIV databases
belong to the following subtypes (accession numbers shown in
parentheses): subtype B, MN (M17449), JRcsf (M38429), PNL4-3 (U26942),
NY5 (M19921), clade B (U26546), PV22 (K02083), SF2 (K02007), HAN
(U43141), D31 (U43096), WEAU (U21135), UK-Manchester (UK-Man) (U23487),
F12 (Z11530), 89.6 (U39362), and C18MBC (U37270); subtype A, U455
(M62320), Z321 (U76035), IbNg (L39106), and 92UG027 (U51190); subtype
C, 92BR025 (U52953) and ETH C2220 (U46016); subtype D, ELI (K03454),
NDK (M27323), and 84ZR085 (U88822); subtype A/C recombinant, ZAM184
(U86780) and ZAM174 (U86768); subtype A/D recombinant, MAL (X04415);
subtype A/E recombinants CM240 (U54771), 93TH253 (U51189), and 90CR402
(U51188); and subtype A/G recombinant, 92NG0003 (U88825) and 92NG083
(U88826). The largest, starlike cluster contained all subtype B
sequences. Subtypes other than B are indicated in parentheses after the
isolate names. The six mother-infant pair sequences clustered with
subtype B sequences.
|
|
Conservation of functional domains required for Vpr protein
function in mother-infant isolates.
Three domains have been
classified in the Vpr protein (37) that are involved in
virion incorporation, oligomerization, nuclear transport, cell cycle
arrest, and differentiation. The first domain includes amino acids 1 to
42 containing an oligomerization domain and a putative
-helix (amino
acid residues 17 to 34) required for virion incorporation. The second
domain encompasses an H(S/F)RIG motif related with cytoskeleton
function (28), a leucine/isoleucine-rich sequence (LR motif
from amino acids 60 to 81) important for nuclear localization
(30), a conserved dipeptide (GC residues 75 and 76) and a
potential
-helical motif (residues 46 to 74) postulated to play a
role in virion incorporation and in the stability of Vpr
(29). The third domain (residues 77 to 96) contains highly charged amino acids and is suggested to be involved in cell cycle arrest and differentiation (10). The
NH2-terminal domain of the Vpr contains five negatively
charged amino acids that are highly conserved and predicts an
amphipathic
-helix (30, 31). Examination of
vpr sequences from six mother-infant pairs showed that the
five negatively charged amino acids at the same positions were highly
conserved (Fig. 1). In addition, the HFRIG motif related with
cytoskeleton function (25) was present in most of the
sequences. Based on mutational analysis, several studies (10,
30) have identified specific domains in Vpr required for virion
incorporation, nuclear import, and cell cycle arrest and
differentiation. The two glutamic acids at positions 21 and 24, the
hydrophobic polar leucines at positions 20, 22, 23, and 26, and the
alanine at position 59 that are required for virion incorporation of
Vpr (30) were highly conserved in most of the 166 vpr sequences analyzed. In six clones from pair D (2MD, 3MD,
6ID, 14ID, 15ID, and 16ID), alanine was substituted with valine. We
then examined the nuclear transport properties of Vpr that comprises
glutamic acid at positions 21 and 24, leucine at positions 20, 22, 23, 26, 67, and 68, and alanine at position 59 (30) and found
them to be highly conserved in most of the mother-infant pairs'
vpr sequences analyzed (Fig. 1, pairs A to F). The cell
cycle arrest properties of Vpr that require glutamic acid at positions
21 and 24, alanine at positions 30 and 59, leucine at positions 64 and
67, histidine at position 71, glycine at position 75, and cysteine at
position 76 (30) as well as arginine at positions 73 and 80 (10) were conserved in mother-infant pairs' vpr
sequences (Fig. 1).
We have provided evidence for maintenance of an intact
vpr
open reading frame with functional domains conserved following
mother-to-infant HIV-1 transmission. The
vpr sequences
directly
derived from uncultured PBMC DNA of six mother-infant pairs
revealed
a 92.17% frequency of conserved
vpr open reading
frames. The functional
domains required for Vpr function,
including virion incorporation
(
10,
30), predicted

-helix
formation (
29), nuclear localization
(
10,
30),
and cell cycle arrest and differentiation (
10,
28,
30), were
highly conserved in most of the
vpr sequences
from the
mother-infant pairs. Our results also show a low degree
of variability
of
vpr sequences following mother-to-infant transmission.
However, the epidemiologically linked mother-infant pair
vpr
sequences
were easily distinguishable from epidemiologically unlinked
individuals.
Taken together, these findings suggest that there is a
selection
mechanism in vivo that maintains intact and functional
vpr open
reading frames (
15), making
vpr necessary for HIV-1 infection
and replication in mothers
and infants during perinatal transmission.
The data presented here demonstrated that the coding potential of the
vpr open reading frame was maintained in most of the
sequences in 47,808 bp sequenced, except for seven sequences containing
stop codons, five lacking initiation codons, and one having a
deletion (Fig.
1). Our results are consistent with the earlier
published limited analyses of
vpr sequences from one
infected
patient (
33), the C terminus of Vpr from
several infected patients
(
48), and some long-term
progressors (
8,
52). In contrast,
defective
vpr
genes clustering at the C terminus have been shown
in some long-term
nonprogressors (
42,
48). The frequency of
defective
vpr genes in our six mother-infant pairs was 7.83% and
was
comparable to but lower than
vif (10.2%) (
50)
and higher
than those observed for
gag (1.5%)
(
26) and
nef (3.3%) (
39)
genes.
Interestingly, the Vpr amino acid sequences of each mother-infant
pair
displayed a pattern that was not seen in epidemiologically
unlinked
pairs (Fig.
1), as also observed in the analyses of V3
region
(
2) and
vif (
50) sequences of the same
mother-infant
pairs. In addition, several amino acid motifs, beside the
functional
domains, were conserved in most of sequences at positions
28,
55, and 77, including an aspargine (N) at position 28 that is
highly conserved in most of the macrophage-tropic but not in all
lymphotropic clones and consensus clade B sequences (
37).
Phylogenetic analysis performed on the
vpr sequences from
the six mother-infant pairs clearly demonstrated that the six pairs
were well discriminated, separated, and confined within
subtrees
(Fig.
2), indicating the absence of PCR product
cross-contamination
(
21,
24). In addition, these
vpr sequences formed distinct
clusters and grouped with
subtype B sequences when subjected to
a phylogenetic analysis with 195
vpr sequences of several subtypes
present in HIV databases
(Fig.
3). These results are consistent
with the phylogenetic analyses
of other genes such as
vif (
50)
and
env (
2,
49). Our data also suggest that the low
variability
of
vpr sequences was not due to errors made by
TaKaRa polymerase
but to persistence in vivo and was in agreement with
those reported
for infected individuals (
22) and for
vif (
50) and
gag (
26,
32)
genes. There was no evidence for a positive selection pressure
for
changes in
vpr sequences by immune responses
(
38). In contrast,
the
env V3 region sequence
from the same mother-infant pairs'
isolates showed a positive
selection pressure for change (
2),
thus harboring variable
sequence population containing several
variants or genotypes (
2,
35,
49). HIV-1
vpr (as
vif
[
50]
or
gag [
26]) evolves
with little selection pressure for change,
and the mothers' variants
persist in their infants. Evidence for
this conclusion is provided by a
low variability of and little
selection pressure for change in
mother-infant
vpr sequences.
There seems to be a selection for Vpr function in mother-infant
vpr sequences, consistent with data from a recent published
report that suggested a selection of Vpr function in vivo
(
15).
The functional domains required for Vpr function,
including the
two glutamic acids at positions 21 and 24, four leucines
at positions
20, 22, 23, and 26, and an alanine at position 59 required
for
virion incorporation of Vpr (
10,
30), were highly
conserved,
indicating that Vpr is required early in viral replication.
The
other functional domains, such as HFRIG related to cytoskeleton
function (
28), the glutamic acid at positions 21 and 24, leucine
at positions 20, 22, 23, 26, 67, and 68, and alanine at
position
59 required for nuclear transport (
29), and the
glutamic acid
at positions 21 and 22, alanine at positions 30 and 59, leucine
at positions 64 and 67, histidine at position 71, glycine at
position
75 and cysteine at position 76 (
30) as well as
arginine at positions
73 and 80 (
10) essential for cell
cycle arrest, were also conserved
in most of the 166
vpr
sequences (Fig.
1). Mutational analysis
of Vpr has revealed that these
amino acids at the positions described
above are critical for Vpr
function (
10,
28,
30). Our data
on
vpr sequences
from six mother-infant pairs, the closest in
vivo situation, is
consistent with earlier reports on Vpr functional
analysis performed in
vitro (
10,
30). Furthermore, we have
recently shown a
similar conservation of the functional domains
for another accessory
gene,
vif, derived from the same mother-infant
pairs
following perinatal transmission (
50).
Although maternal-fetal transmission of HIV-1 may be multifactorial in
nature, identification of viral factors or determinants
involved in
maternal transmission may provide insights toward
the development of
strategies for prevention and treatment. Since
vpr is
conserved among primate immunodeficiency viruses (
15,
44,
46) and required for efficient HIV-1 replication in primary
monocytes/macrophages (
4,
5,
7), it may have a role in
transmission because macrophage-tropic isolates are believed to
be
involved in transmission (
31,
53). The data presented here
on 92.17% frequency of intact
vpr open reading frames and
conserved
functional domains for Vpr activity support the notion that
vpr is important for HIV-1 pathogenesis in maternal-fetal
isolates
and may be one of the viral determinants of perinatal
transmission.
Nucleotide sequence accession numbers.
The 166 vpr
sequences from six mother-infant pairs have been submitted to GenBank
with accession no. AF042864 to AF043029.
 |
ACKNOWLEDGMENTS |
We thank Raymond C. Baker, Children's Hospital Medical Center,
Cincinnati, Ohio, for providing blood samples from HIV-1-infected mother-infant pairs; Scott Martin and Ulrike Philippar for technical help; and John J. Marchalonis, Erik Matala, Tobias Hahn, and
Mohammad Husain of the University of Arizona for reviewing the
manuscript.
This work was supported in part by grants to N.A. from the National
Institute of Allergy and Infectious Diseases (AI 40378) and the Arizona
Disease Control Research Commission (9601).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, College of Medicine, The University of
Arizona Health Sciences Center, Tucson, AZ 85724. Phone: (520)
626-7022. Fax: (520) 626-2100. E-mail:
nafees{at}u.arizona.edu.
 |
REFERENCES |
| 1.
|
Ahmad, N.
1996.
Maternal-fetal transmission of human immunodeficiency virus.
J. Biomed. Sci.
2:238-250.
|
| 2.
|
Ahmad, N.,
B. M. Baroudy,
R. C. Baker, and C. Chappey.
1995.
Genetic analysis of human immunodeficiency virus type 1 envelope V3 region isolates from mothers and infants after perinatal transmission.
J. Virol.
69:1001-1012[Abstract].
|
| 3.
|
Ahmad, N.,
G. M. Schiff, and B. M. Baroudy.
1993.
Detection of viremia by a one step polymerase chain reaction method in hepatitis C virus infection.
Virus Res.
30:303-315[Medline].
|
| 4.
|
Balliet, J. W.,
D. L. Kolson,
G. Eiger,
F. M. Kim,
K. A. Megann,
A. Srinivasan, and R. C. Collman.
1994.
Distinct effects in primary macrophages and lymphocytes of human immunodeficiency virus type 1 accessory genes vpr, vpu and nef: mutational analysis of a primary HIV-1 isolate.
Virology
200:623-631[Medline].
|
| 5.
|
Ballota, C.,
P. Lusso,
R. Crowley,
R. C. Gallo, and G. Franchini.
1993.
Antisense phosphorothioate oligonucleotides targeted to the vpr gene inhibit human immunodeficiency virus type 1 replication in primary human macrophages.
J. Virol.
67:4409-4414[Abstract/Free Full Text].
|
| 6.
|
Cohen, E. A.,
G. Dehni,
J. G. Sodroski, and W. A. Haseltine.
1990.
Human immunodeficiency virus vpr product is a virion-associated regulatory protein.
J. Virol.
64:3097-3099[Abstract/Free Full Text].
|
| 7.
|
Connor, R. L.,
B. K. Chen,
S. Chen, and N. R. Landau.
1995.
Vpr is required for efficient replication of human immunodeficiency virus type 1 in mononuclear phagocytes.
Virology
206:935-944[Medline].
|
| 8.
|
Cornelissen, M.,
C. Kuiken,
F. Zorgdrager,
S. Hartman, and J. Goudsmit.
1997.
Gross defects in the vpr and vpu genes of HIV type 1 cannot explain the differences in RNA copy number in long-term asymptomatics and progressors.
AIDS Res. Hum. Retroviruses
13:247-252[Medline].
|
| 9.
|
Dedera, D.,
W. Hu,
N. Vander Heyden, and L. Ratner.
1989.
Viral protein R of human immunodeficiency virus types 1 and 2 is dispensable for replication and cytopathogenicity in lymphoid cells.
J. Virol.
63:3205-3208[Abstract/Free Full Text].
|
| 10.
|
DiMarzio, P.,
S. Choe,
M. Elbright,
R. Knoblauch, and N. R. Landau.
1995.
Mutational analysis of the cell cycle, nuclear localization, and virion packaging of human immunodeficiency virus type 1 Vpr.
J. Virol.
69:3205-3208.
|
| 11.
|
European Collaborative Study.
1988.
Mother to child transmission of HIV-1.
Lancet
ii:1039-1042.
|
| 12.
|
Felsenstein, J.
1989.
PHYLIP phylogenetic inference package.
Cladiatice
5:164-166.
|
| 13.
|
Furtado, M. R.,
L. A. Kingsley, and S. M. Wolinsky.
1995.
Changes in the viral mRNA expression pattern correlate with a rapid rate of CD4+ T-cell number decline in human immunodeficiency virus type 1-infected individuals.
J. Virol.
69:2092-2100[Abstract].
|
| 14.
|
Ge, Y. C.,
B. Wang,
D. E. Dwyer,
A. L. Cunningham, and N. Saxena.
1996.
Length polymorphism of the viral protein R of human immunodeficiency virus type 1 strains.
AIDS Res. Hum. Retroviruses
12:351-354[Medline].
|
| 15.
|
Goh, W. C.,
M. E. Rogel,
C. M. Kinsey,
S. C. Michael,
P. N. Fultz,
M. A. Nowak,
B. H. Hahn, and M. Emerman.
1998.
HIV-1 Vpr increases viral expression by manipulation of the cell cycle: a mechanism for selection of Vpr in vivo.
Nat. Med.
4:65-71[Medline].
|
| 16.
|
Heinzinger, N. K.,
M. L. Bukrinsky,
S. A. Haggerty,
A. M. Ragland,
V. Kewalramani,
M. A. Lee,
H. E. Gendelman,
L. Ratner,
M. Stevenson, and M. Emmereman.
1994.
The Vpr protein of human immunodeficiency virus type 1 influences nuclear localization of viral nucleic acids in non-dividing host cells.
Proc. Natl. Acad. Sci. USA
91:7311-7315[Abstract/Free Full Text].
|
| 17.
|
Italian Multiculture Study.
1988.
Epidemiology, clinical features and prognostic factors of pediatric HIV infection.
Lancet
ii:1043-1046.
|
| 18.
|
Jowett, J. B. M.,
V. Planelles,
B. Poon,
N. P. Shah,
M.-L. Chen, and I. S. Y. Chen.
1995.
The human immunodeficiency virus type 1 vpr gene arrests infected T cells in the G2 + M phase of the cell cycle.
J. Virol.
69:6304-6313[Abstract].
|
| 19.
|
Kans, J. A.
1996.
Sequin, p. 114.
In
Conference Proceedings of the Cold Spring Harbor Laboratory Genome Mapping and Sequencing Meeting.
|
| 20.
|
Kishi, M.,
Y.-H. Zheng,
M. K. Bahmani,
K. Tokunaga,
H. Takahahi,
M. Kakinuma,
P. K. Lai,
M. Nonoyama,
R. B. Luftig, and K. Ikuta.
1995.
Naturally occurring accessory gene mutations lead to persistent human immunodeficiency virus type 1 infection of CD4-positive T cells.
J. Virol.
69:7507-7518[Abstract].
|
| 21.
|
Korber, B. T. M.,
G. Learn,
J. I. Mulins,
B. H. Hahn, and S. M. Wolinsky.
1995.
Protecting HIV databases.
Nature
378:242-243[Medline].
|
| 22.
|
Kuiken, C. L.,
M. T. E. Cornelissen,
F. Zorgdrager,
S. Hartman,
A. J. Gibbs, and J. Goudsmit.
1996.
Consistent risk group-associated differences in human immunodeficiency virus type 1 vpr, vpu and V3 sequences despite independent evolution.
J. Gen. Virol.
77:783-792[Abstract/Free Full Text].
|
| 23.
|
Lang, S. M.,
M. Weeger,
C. Stahl-Hening,
C. Coulibaly,
G. Hunsmann,
J. Muller,
H. Muller-Hermelink,
D. Fuchs,
H. Wachter,
M. M. Daniel,
R. C. Desrosiers, and B. Fleckenstein.
1993.
Importance of vpr for infection of rhesus monkeys with simian immunodeficiency virus.
J. Virol.
67:902-912[Abstract/Free Full Text].
|
| 24.
|
Learn, G. H., Jr.,
B. T. M. Korber,
B. Foley,
B. H. Hahn,
S. M. Wolinsky, and J. I. Mullins.
1996.
Maintaining the integrity of human immunodeficiency virus sequence databases.
J. Virol.
70:5720-5730[Abstract/Free Full Text].
|
| 25.
|
Levy, D. N.,
L. S. Fernandes,
W. V. Williams, and D. B. Weiner.
1993.
Induction of cell differentiation by human immunodeficiency virus 1 vpr.
Cell
72:541-550[Medline].
|
| 26.
|
Louwagie, J.,
F. E. McCutchan,
M. Peeters,
T. P. Brennan,
E. Sanders-Buell,
E. Eddy,
G. van der Groen,
K. Fransen,
G.-M. Gershy-Damet,
R. Deleys, and D. S. Burke.
1993.
Phylogenetic analysis of gag genes from 70 international HIV-1 isolates provides evidence of multiple genotypes.
AIDS
7:769-780[Medline].
|
| 27.
|
Lu, Y. L.,
P. Spearman, and L. Ratner.
1993.
Human immunodeficiency virus type 1 viral protein R localization in infected cells and virions.
J. Virol.
67:6542-6550[Abstract/Free Full Text].
|
| 28.
|
Macreadie, I. G.,
L. A. Castelli,
D. R. Hewish,
A. Kirkpatrick,
A. C. Ward, and A. A. Azad.
1995.
A domain of human immunodeficiency virus type 1 Vpr containing repeated H(S/F)RIG amino acid motifs causes growth arrest and structural defects.
Proc. Natl. Acad. Sci. USA
92:2770-2774[Abstract/Free Full Text].
|
| 29.
|
Mahalingam, S.,
S. A. Khan,
M. A. Jabbar,
C. E. Monken,
R. G. Collman, and A. Srinivasan.
1995.
Identification of residues in the N-terminal acidic domain of HIV-1 Vpr essential for virion incorporation.
Virology
207:297-302[Medline].
|
| 30.
|
Mahalingam, S.,
V. Ayyavoo,
M. Patel,
T. Kieber-Emmons, and D. B. Weiner.
1997.
Nuclear import, virion incorporation, and cell cycle arrest/differentiation are mediated by distinct functional domains of human immunodeficiency virus type 1 Vpr.
J. Virol.
71:6339-6347[Abstract].
|
| 31.
| Matala, E., V. R. K. Yedavalli, and N. Ahmad. Unpublished data.
|
| 32.
|
McNearny, T.,
Z. Hornickora,
R. Markham,
A. Birdnell,
M. Arnes,
A. Saah, and L. Ratner.
1992.
Relationship of human immunodeficiency virus type 1 sequence heterogeneity to stage of disease.
Proc. Natl. Acad. Sci. USA
89:10247-10251[Abstract/Free Full Text].
|
| 33.
|
Michael, N. L.,
G. Chang,
L. A. D'Arcy,
P. K. Ehrenberg,
R. Mariani,
M. P. Busch,
D. L. Brix, and D. H. Schwartz.
1995.
Defective accessory genes in a human immunodeficiency virus type 1-infected long-term survivor lacking recoverable virus.
J. Virol.
69:4228-4236[Abstract].
|
| 34.
|
Mok, J. Q.,
C. Giaquinto,
A. DeRossi,
I. Gruch-Worner,
A. E. Ades, and C. S. Pekham.
1987.
Infants born to mothers seropositive for human immunodeficiency virus preliminary findings from a multiculture European study.
Lancet
i:1164-1168.
|
| 35.
|
Mulder-Kampinga, G. A.,
A. Simonon,
C. L. Kuiken,
J. Dekker,
H. J. Scherpbier,
P. van de Perre,
K. Boer, and J. Goudsmit.
1995.
Similarity in env and gag genes between genomic RNAs of human immunodeficiency virus type 1 (HIV-1) from mother and infant is unrelated to time of HIV-1 RNA positivity in the child.
J. Virol.
69:2285-2296[Abstract].
|
| 36.
|
Mustafa, F., and H. L. Robinson.
1993.
Context-dependent role of human immunodeficiency virus type 1 auxillary genes in the establishment of chronic virus producers.
J. Virol.
67:6909-6915[Abstract/Free Full Text].
|
| 37.
|
Myers, G.,
B. Korber,
B. H. Hahn,
K.-T. Jeang,
J. W. Mellors,
F. E. McCutchan,
L. E. Henderson, and G. N. Pavlakis.
1995.
Human retroviruses and AIDS database.
Theoretical Biology, Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 38.
|
Nei, M., and T. Gojobori.
1986.
Simple methods for estimating the number of synonymous and nonsynonymous nucleotide substitutions.
Mol. Biol. Evol.
3:418-426[Abstract].
|
| 39.
|
Pearson, W. R., and D. J. Lipman.
1988.
Improved tools for biological sequence comparison.
Proc. Natl. Acad. Sci. USA
85:2444-2448[Abstract/Free Full Text].
|
| 40.
|
Rogel, M. E.,
L. I. Lu, and M. Emerman.
1995.
The human immunodeficiency virus type 1 vpr gene prevents cell proliferation during chronic infection.
J. Virol.
69:882-888[Abstract].
|
| 41.
|
Saksena, N. K.,
Y. C. Ge,
B. Wang,
S. H. Xiang,
D. E. Dwyer,
C. Randle,
P. Palasanthiran,
J. Ziegler, and A. L. Cunningham.
1996.
An HIV-1 infected long-term non-progressor (LTNP): molecular analysis of HIV-1 strains in the vpr and nef genes.
Ann. Acad. Med. Singapore
25:848-854[Medline].
|
| 42.
|
Scarlatti, G.,
T. Leitner,
E. Hapi,
J. Wahlberg,
P. Marchisi,
M. A. Clerici-Schoeller,
H. Wigzell,
E. M. Fenyo,
J. Albert,
M. Uhlen, and P. Rossi.
1993.
Comparison of variable region 3 sequences of human immunodeficiency virus type 1 from infected children with RNA/DNA sequences of virus population of their mothers.
Proc. Natl. Acad. Sci. USA
90:1721-1725[Abstract/Free Full Text].
|
| 43.
|
Scott, G. B.,
M. A. Fischl,
N. Khmas,
M. A. Fletcher,
G. M. Dickinson,
R. S. Levine, and W. P. Parks.
1985.
Mothers of infants with acquired immunodeficiency syndrome: evidence for both symptomatic and asymptomatic carriers.
JAMA
253:363-366[Abstract/Free Full Text].
|
| 44.
|
Sharp, P. M.,
E. Balles,
M. Stevenson,
M. Emerman, and B. H. Hahn.
1996.
Gene acquisition in HIV and SIV.
Nature
383:586-587[Medline].
|
| 45.
|
Shuler, G. D.,
J. A. Epstein,
H. Ohkawa, and J. A. Kans.
1996.
Entrez: molecular biology database and retrieval system.
Methods Enzymol.
266:141-162[Medline].
|
| 46.
|
Stivahtis, G. L.,
M. A. Soares,
M. A. Vodicka,
B. H. Hahn, and M. Emerman.
1997.
Conservation and host specificity of Vpr-mediated cell cycle arrest suggest a fundamental role in primate lentivirus evolution and biology.
J. Virol.
71:4331-4338[Abstract].
|
| 47.
|
Wang, B.,
Y. C. Ge,
P. Palasanthiran,
S.-H. Xiang,
J. Ziegler,
D. E. Dwyer,
C. Randle,
D. Dowton,
A. Cunningham, and N. K. Saxena.
1996.
Gene defects clustered at the C-terminus of the vpr gene of HIV-1 in long-term nonprogressing mother and child pair: in vivo evolution of vpr quasispecies in blood and plasma.
Virology
223:224-232[Medline].
|
| 48.
|
Wolfs, T.,
G. Zwart,
M. Bakker, and J. Goudsmit.
1992.
HIV-1 genomic RNA diversification following sexual and parental virus transmission.
Virology
189:103-110[Medline].
|
| 49.
|
Wolinsky, S. M.,
C. M. Wike,
B. T. M. Korber,
C. Hutto,
W. P. Parks,
L. L. Rosenblum,
K. J. Kuntsman,
M. R. Furtado, and I. L. Munoz.
1992.
Selective transmission of human immunodeficiency virus type 1 variants from mother to infants.
Science
255:1134-1137[Abstract/Free Full Text].
|
| 50.
|
Yedavalli, V. R. K.,
C. Chappey,
E. Matala, and N. Ahmad.
1998.
Conservation of an intact vif gene of human immunodeficiency virus type 1 during maternal-fetal transmission.
J. Virol.
72:1092-1102[Abstract/Free Full Text].
|
| 51.
|
Zhang, L.,
Y. Huang,
H. Yuan,
S. Tuttleton, and D. D. Ho.
1997.
Genetic characterization of vif, vpr, and vpu sequences from long-term survivors of human immunodeficiency virus type 1 infection.
Virology
228:340-349[Medline].
|
| 52.
|
Zhang, L. Q.,
P. MacKenzie,
A. Cleland,
E. C. Holmes,
A. J. Leigh Brown, and P. Simmonds.
1993.
Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection.
J. Virol.
67:3345-3356[Abstract/Free Full Text].
|
| 53.
|
Zhu, T.,
H. Mo,
N. Wang,
D. S. Nam,
Y. Cao,
R. A. Koup, and D. D. Ho.
1993.
Genotypic and phenotypic characterization of HIV-1 in patients with primary infection.
Science
261:1179-1181.
|
J Virol, August 1998, p. 6937-6943, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sherman, M. P., de Noronha, C. M. C., Eckstein, L. A., Hataye, J., Mundt, P., Williams, S. A. F., Neidleman, J. A., Goldsmith, M. A., Greene, W. C.
(2003). Nuclear Export of Vpr Is Required for Efficient Replication of Human Immunodeficiency Virus Type 1 in Tissue Macrophages. J. Virol.
77: 7582-7589
[Abstract]
[Full Text]
-
Arganaraz, E., Cortes, M. J., Leibel, S., Lama, J.
(2002). Human Immunodeficiency Virus Type 1 Vpr Protein Does Not Modulate Surface Expression of the CD4 Receptor. J. Virol.
76: 4125-4130
[Abstract]
[Full Text]
-
Eckstein, D. A., Sherman, M. P., Penn, M. L., Chin, P. S., De Noronha, C. M.C., Greene, W. C., Goldsmith, M. A.
(2001). HIV-1 Vpr Enhances Viral Burden by Facilitating Infection of Tissue Macrophages but Not Nondividing CD4+ T Cells. JEM
194: 1407-1419
[Abstract]
[Full Text]
-
Sherman, M. P., de Noronha, C. M. C., Heusch, M. I., Greene, S., Greene, W. C.
(2001). Nucleocytoplasmic Shuttling by Human Immunodeficiency Virus Type 1 Vpr. J. Virol.
75: 1522-1532
[Abstract]
[Full Text]
-
Sherman, M. P., de Noronha, C. M. C., Pearce, D., Greene, W. C.
(2000). Human Immunodeficiency Virus Type 1 Vpr Contains Two Leucine-Rich Helices That Mediate Glucocorticoid Receptor Coactivation Independently of Its Effects on G2 Cell Cycle Arrest. J. Virol.
74: 8159-8165
[Abstract]
[Full Text]