Previous Article | Next Article 
J Virol, August 1998, p. 6851-6857, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Kinetics of Antiviral Activity by Human Immunodeficiency
Virus Type 1-Specific Cytotoxic T Lymphocytes (CTL) and Rapid
Selection of CTL Escape Virus In Vitro
C. A.
Van
Baalen,1
M.
Schutten,1
R. C.
Huisman,1
P. H. M.
Boers,1
R. A.
Gruters,1,2 and
A. D. M. E.
Osterhaus1,*
Institute of Virology, Erasmus University,
Rotterdam, The Netherlands,1 and
UMR103, CNRS/Biomerieux, ENS de Lyon, Lyon,
France2
Received 9 February 1998/Accepted 28 April 1998
 |
ABSTRACT |
The antiviral activity of a CD8+ cytotoxic T-lymphocyte
(CTL) clone (TCC108) directed against a newly identified
HLA-B14-restricted epitope, human immunodeficiency virus type 1 (HIV-1)
Rev(67-75) SAEPVPLQL, was analyzed with respect to its kinetics of
target cell lysis and inhibition of HIV-1 production. Addition of
TCC108 cells or CD8+ reverse transcriptase-specific CTLs to
HLA-matched CD4+ T cells at different times after infection
with HIV-1 IIIB showed that infected cells became susceptible to
CTL-mediated lysis before peak virus production but after the onset of
progeny virus release. When either of these CTLs were added to part of
the infected cells immediately after infection, p55 expression and
virus production were significantly suppressed. These data
support a model in which CTLs, apart from exerting cytolytic activity
which may prevent continued virus release, can interfere with viral
protein expression during the eclipse phase via noncytolytic
mechanisms. TCC108-mediated inhibition of virus replication in
peripheral blood mononuclear cells caused rapid selection of a virus
with a mutation (69E
K) in the Rev(67-75) CTL epitope which abolished
recognition by TCC108 cells. Taken together, these data suggest that
both cytolytic and noncytolytic antiviral mechanisms of CTLs can be
specifically targeted to HIV-1-infected cells.
 |
INTRODUCTION |
Identification of immune responses
that may limit progression toward AIDS and may eliminate infected cells
that persist despite effective antiviral therapy (6, 20, 30)
is a major goal for current research aimed at the development of
vaccines and immunotherapies against AIDS (1). It is
generally assumed that an effective vaccine against human
immunodeficiency virus type 1 (HIV-1) should elicit an antiviral immune
response which includes virus-specific major histocompatibility complex
class I-restricted CD8+ cytotoxic T lymphocytes (CTL),
because their presence is associated with the control of primate
lentivirus replication and they have been detected in individuals
exposed to but apparently uninfected with HIV (reviewed in reference
8). Furthermore, CTL have been shown to exert
pressure on virus replication in vivo (2, 9) and in vitro
(3, 27, 32). CTL clones directed against the late viral
proteins Gag, reverse transcriptase (RT), and Env, have been shown to
lyse HIV-1-infected cells before peak virus production (31)
and to suppress HIV-1 replication in immortalized CD4+
T-cell lines such as H9 and T1 (32). Env-specific CTL have been shown to eliminate HIV-1-infected CD4+ peripheral
blood mononuclear cells (PBMC) and H9 cells (32), indicating
that inhibition of HIV-1 replication involved cytolytic mechanisms. In
addition to exerting cytolytic activity, HIV-specific CTL have been
shown to suppress virus replication by the excretion of soluble factors
(3, 32). Although CTL against late viral proteins do exhibit
antiviral activity, elimination of nonproductively infected cells with
still incomplete protein expression (18) and suppression of
low-level virus replication (20) may require CTL directed
against the regulatory viral proteins Tat and Rev. These proteins are
translated early in the replication cycle of HIV-1 and are necessary
for transcription (Tat) or expression of the intermediate and late
proteins (Rev) (14, 15). Consistent with such a protective
role of CTL against Rev and Tat, we have shown previously that CTL with
these specificities were preferentially found in individuals who
experienced a long-term asymptomatic course of disease progression
(28). In contrast, CTL responses against the late proteins
Gag and RT did not correlate with the rate of disease progression
(28).
Here we present a detailed analysis of the Rev-specific CTL response in
one individual who has been infected for more than 12 years without
developing symptoms. Rev-specific CTL clones were generated, and a
minimal epitope as well as the HLA class I restriction of its
recognition were identified. It is shown that both Rev- and RT-specific
CTL can suppress HIV-1 production before they exert cytolytic activity
and that Rev-specific CTL-mediated inhibition of virus replication in
PBMC leads to the rapid selection of virus mutated in the CTL epitope.
 |
MATERIALS AND METHODS |
Cells.
All cells were maintained in RPMI 1640 (BioWhittaker,
Verviers, Belgium) supplemented with L-glutamine (2 mM),
penicillin (100 U/ml), streptomycin (10 µg/ml), and 10% pooled human
serum (R10H) for PBMC and T cells or 10% fetal bovine serum
(BioWhittaker) (R10F) for B-LCL cells. CTL clones and the
CD4+ TCL2H7 cells were stimulated at 2-week intervals with
phytohemagglutinin-L (PHA-L) (1 µg/ml; Boehringer Mannheim, Germany)
and gamma-irradiated (3,000 rads) allogenic feeder cells and maintained
in R10H containing recombinant interleukin-2 (rIL2) (50 U/ml;
Eurocetus, Amsterdam, The Netherlands). International
Histocompatibility Workshop B-LCL cells were obtained from the European
Collection of Cell Cultures (Salisbury, United Kingdom).
Generation of CTL clones.
HIV-1 Rev-specific T-cell lines
obtained from individual L709, HLA-A1,28;
B14,57, were seeded at 0.3, 1, and 3 cells per well in 60-well Terasaki plates (Greiner, Alphen a/d
Rijn, The Netherlands) in a final volume of 20 µl per well containing
PHA-L (1 µg/ml), rIL2 (50 U/ml), and irradiated allogenic feeder
cells. The plates were incubated at 37°C in a humidified chamber with
5% CO2. After 10 to 14 days, growing cell cultures from
plates showing growth in 10 to 15% of wells were restimulated. Cell
samples from these cultures were analyzed for Rev-specific CTL activity
on autologous B-LCL cells infected with recombinant vaccinia virus
(rVV) containing the HIV-1LAI rev gene (TG4113;
rVV-rev) in chromium release assays as described below. The
Rev-specific TCC108 clone expressed T-cell receptor VB14S1 uniformly
(data not shown), confirming its clonality. Since the five Rev-specific
CTL clones were restricted by the same HLA class I allele, recognized
the same 20-mer peptide, and were established from the same
Rev-specific cell line, these clones most likely originated from the
same cell. For practical reasons, further analyses were performed with
one of these CTL clones, TCC108.
Chromium release assays.
Target cells were labelled for
1 h with 100 µCi of Na2
51CrO4 (Amersham, Buckinghamshire, United
Kingdom), washed three times, and adjusted to a concentration of 2 × 105 cells per ml in R5F. A volume of 50 µl
(104 cells) was plated in 96-well V-bottom plates. Effector
cells were added at ratios of between 3:1 and 10:1 in a final volume of
150 µl. The spontaneous and maximum chromium releases were determined
by the incubation of the target cells with R5F only or with 5% Triton
X-100, respectively. Triplicate incubations were performed in all
assays. After incubation at 37°C for 4 h, supernatants were
harvested with a harvesting device (Skatron, Oslo, Norway), and
radioactivity was counted in a gamma counter (LKBWallac, Turku,
Finland). The percent specific lysis was calculated as (experimental
release
spontaneous release)/(maximum release
spontaneous release) × 100. To ensure sufficient HIV-1-infected cells
at each time point, TCL2H7 cells were infected at a multiplicity of
infection (MOI) of approximately 1.0.
Flow cytometry.
The expression of CD4, CD8, and HLA-A2 was
analyzed by incubation of viable cells with CD4-fluorescein
isothiocyanate (CD4-FITC) or CD8-phycoerythrin (Becton Dickinson,
Leiden, The Netherlands) or HLA-A2 specific monoclonal antibody BB7.2
(kindly provided by W. Biddison). FITC-conjugated goat anti-mouse
immunoglobulin (Becton Dickinson) was used as a second antibody for
detection of expression of HLA-A2. For detection of HIV-1 p55
expression, cells were incubated subsequentially with
paraformaldehyde-lyso-lecithin, cold absolute methanol, Nonidet
P-40 (Sigma), and FITC- or phycoerythrin-labelled anti-HIV-1
p55 monoclonal antibody (clone KC57) according to the instructions of
the manufacturer (Coulter, Mijdrecht, The Netherlands).
Peptides.
The 20-mer peptides with 10 residues of overlap,
together spanning the entire HIV-1 Rev sequence were kindly provided by
H. Holmes (Medical Research Council, South Mimms, Potters Bar, United Kingdom). For the preparation of target cells, 0.5 × 106 to 1 × 106 B-LCL cells were incubated
with these peptides at 20 µM in 100 µl of R0. After 1 h, 900 µl of R5F was added and cells were incubated overnight. The peptides
used for fine mapping of the CTL epitope recognized by TCC108 cells
were manufactured at the European Veterinary Laboratory (Woerden, The
Netherlands). Chromium-labelled B-LCL cells were incubated with these
shorter peptides for 1 h at concentrations ranging from 1 × 10
9 to 3 × 10
4 M, washed twice, and
used as target cells.
Virus stocks.
rVV-rev and rVV containing the polylinker
without insert (186-poly; rVV-control) were kindly provided by M. P. Kieny (Transgène, Strasbourg, France). Stocks were prepared on
RK13 cells and stored at concentrations of 1 × 108 to
3 × 108 PFU/ml at
70°C. For the preparation of
rVV-infected target cells, B-LCL cells were incubated with 10 PFU per
cell at 107 cells per ml for 1 h. Subsequently, the
cells were diluted to 106/ml with R10F and incubated
overnight.
An HIV-1 IIIB stock was prepared on freshly infected PHA-activated
CD4+ TCC cells and stored at
70°C. The RT activity of
this stock was 105 RT cpm/ml. The infectious viral titer
was determined by infection of PHA-activated PBMC or TCL2H7 cells with
serial fivefold dilutions of this stock in quadruplicate. With both
cell types an estimated titer of 105 infectious particles
per ml was found.
RT assay.
RT activity was assayed in a microassay as
previously described by Gregersen et al. (10) and adapted by
Siebelink et al. (25). Culture supernatants were
precipitated with 32% polyethylene glycol 6000-1.5 M NaCl. The
pellets were resuspended in 15 µl of lysis buffer (50 mM Tris [pH
8.3], 20 mM dithiothreitol, 0.25% Triton X-100) and mixed with 35 µl of H2O and 50 µl of RT cocktail [100 mM Tris (pH
7.9), 150 mM KCl, 10 mM MgCl2, 4 mM dithiothreitol, 0.6 U
of poly(rA)-oligo(dT), 60 µCi of [3H]TTP per ml].
After incubation at 37°C for 1 h, the DNA was precipitated with
20 µl of 120 mM Na4P2O7 · 10H2O in 60% trichloroacetic acid for 15 min at 4°C. The
DNA was harvested on glass fiber filters with a Skatron cell harvester
and washed with 12 mM
Na4P2O7 ·10H2O in 5% trichloroacetic acid. The filters were dried at 80°C, and [3H]TTP incorporation was measured in a beta
scintillation counter (LKBWallac).
Kinetics of target cell recognition.
Three days after their
most recent stimulation with PHA-L, 1.2 × 106
CD4+ TCL2H7 cells were incubated with IIIB at 1.2 × 106 RT cpm (MOI of approximately 1) for 3 h at 37°C.
The cells were washed three times and cultured at 3 × 105 cells per ml in R10H supplemented with rIL2 (50 U/ml).
At various time points, a volume of 0.6 ml, including cells, was
harvested. After centrifugation, the supernatants were stored at
70°C for RT assays, part of the cells were fixed for flow
cytometric analysis of p55, CD4, and CD8 expression, and part of the
cells were labelled with chromium for analysis in chromium release
assays.
Coculture of CTL and acutely infected PBMC.
PBMC (2 × 107) isolated from a buffy coat were incubated with HIV-1
IIIB at 105 RT cpm for 3 h at 37°C. The cells were
washed three times and cultured at 5 × 106 cells per
10 ml of R10H supplemented with PHA-L (1 µg/ml) and rIL2 (50 U/ml) in
25-cm2 flasks. Effector cells were added at a ratio of
0.1:1. At various time points, 2 ml of the culture was harvested and
centrifuged (250 × g). The supernatants were stored at
70°C for analyses of RT activity and viral RNA sequences, and the
cells were fixed with paraformaldehyde-lyso-lecithin for flow
cytometric analysis of HIV-1 p55, CD4, CD8, and HLA-A2 expression. At
days 6 and 11 postinfection, part of the cells were not fixed but were
separated into a CD8+ fraction and a CD8
fraction with an anti-CD8 monoclonal antibody covalently conjugated to
magnetic beads (Becton Dickinson) according to the manufacturer's instructions. After treatment of the CD8+ fraction with
DetachaBead (Becton Dickinson) and overnight incubation at 37°C,
these cells were analyzed for cytolytic activity against rVV-rev- and
rVV-control-infected autologous B-LCL cells. CD8+ PBMC
could be discriminated from TCC108 and TCC112 cells by flow cytometric
analysis of the expression of HLA-A2, which was present on the PBMC
only.
Sequencing.
Viral RNA was isolated from supernatants
harvested from cultures of HIV-1-infected PBMC with and without the
Rev-specific TCC108 cells. The second exon of rev was
amplified by RT-PCR. After reverse transcription with random primers,
cDNA was amplified with primers GTACTTTCTATAGTGAATAGAGTTAGGC
and CCTATCTGTCCCCTCAGCTACT. PCR conditions were as
follows: 30 s at 95°C, 30 s at 50°C, and 30 s at
72°C for 30 cycles and then 7 min of extension at 72°C. Amplified
fragments were sequenced directly on both strands by using the PCR
primers with the Taq Dye Deoxy Terminator sequencing kit on
a 373A sequencing system from Applied Biosystems (Foster City, Calif.).
Sequences were analyzed with Geneworks (Intelligenetics, Mountain View,
Calif.).
 |
RESULTS |
HLA restriction and fine specificity of Rev-specific CTL
clones.
To analyze the Rev-specific CTL response of a long-term
asymptomatic individual in more detail, we cloned a Rev-specific T-cell line generated in a previous study from PBMC of individual L709 (28). Five CD4
CD8+ Rev-specific
CTL clones, TCC102, TCC104, TCC106, TCC108, and TCC110, and one
CD4
CD8+ non-HIV-specific CTL clone, TCC112,
were obtained (Tables 1 and
2).
The HLA restriction of the Rev-specific CTL clones was determined
with a panel of partially HLA class I-matched B-LCL cells
infected with
rVV-rev or rVV-control in standard chromium release
assays (Fig.
1A). All Rev-specific CTL clones lysed
the four rVV-rev-infected
heterologous target cells that
shared HLA-B14 (Fig.
1A shows the
results obtained with TCC108 cells).
Heterologous target cell
lines that were matched for HLA-A1 (four
cell lines), HLA-A28
(three cell lines), or HLA-B57 (three cell lines)
were not lysed
by the Rev-specific CTL clones (Fig.
1A). These data
indicate
that recognition of Rev by the CTL clones was restricted by
HLA-B14.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 1.
HLA restriction and fine specificity of HIV-1
Rev-specific CTL clone TCC108. (A) Autologous and partially HLA class
I-matched B-LCL cells were infected with rVV-rev (filled bars) or
rVV-control (open bars) and analyzed for recognition by TCC108 cells in
a standard chromium release assay (upper panel). Additional B-LCL cells
were analyzed in a separate assay to confirm HLA-B14 restriction (lower
panel). (B to D) Peptide-pulsed autologous B-LCL cells were analyzed
for recognition by TCC108 cells in standard chromium release assays.
Chromium-labelled target cells were incubated overnight with one of the
11 20-mer peptides together spanning the entire Rev sequence (B) or for
1 h with the N- and C-terminally truncated peptides before the
addition of effector cells (C and D, respectively). Effector-to-target
ratios were between 3:1 and 10:1 in all assays. The average percent
specific lysis (with standard error) for triplicates is shown. Results
similar to those presented in panels A and B were obtained with the
Rev-specific CTL clones TCC102, TCC104, TCC106, and TCC110 (data not
shown). The non-Rev-specific clone TCC112 did not lyse any of the
rVV-infected or peptide-pulsed target cells (data not shown).
|
|
The location of the CTL epitope within the Rev protein was
estimated by using 11 20-mer peptides with 10 amino acid residues
of overlap, together spanning the entire Rev sequence. All five
clones
specifically lysed autologous B-LCL cells pulsed with the
peptide
Rev(62-81) TYLGRSAEPVPLQLPPLERL but not
those pulsed with
the other peptides (Fig.
1B). Truncated peptides
lacking the N-terminal
residues 62T, 63Y, 64L, 65G, and 66R were
recognized by TCC108
cells, but those without 67S were not (Fig.
1C),
indicating that
67S defines the N terminus of the minimal epitope.
TCC108 cells
recognized peptides truncated C terminally at 75L but not
peptides
truncated at 74Q or 73L (Fig.
1D). These data show that
Rev(67-75)
SAEPVPLQL is the minimal epitope recognized by TCC108
cells. The
amino acid arginine (R) has been described to serve as an
anchor
at position 2 in HLA-B14 binding peptides (
5), and it
flanks
the minimal epitope at position 66 of Rev. Titration of
the peptides
SAEPVPLQL, RSAEPVPLQL, and GRSAEPVPLQL on autologous
B-LCL cells
revealed that all three peptides required a concentration
of at
least 1 µM to be recognized by TCC108 cells and showed a
similar
increase in specific lysis with increasing concentrations (Fig.
2). Thus, the additional residues 66R and
65G did not contribute
to the optimal recognition of the CTL
epitope.

View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Titration of peptides recognized by the Rev-specific
clone TCC108. Chromium-labelled autologous B-LCL cells were incubated
with the peptide Rev(65-75) GRSAEPVPLQL, Rev(66-75) RSAEPVPLQL, or
Rev(67-75) SAEPVPLQL for 1 h at the concentrations indicated.
Subsequently, the target cells were washed and cocultivated with TCC108
cells for 4 h. The effector-to-target cell ratios were 10:1. The
average percent specific lysis (with standard error) for triplicates is
shown. No lysis of B-LCL cells without peptide was observed (data not
shown).
|
|
Kinetics of target cell lysis and suppression of HIV-1 production
by Rev- and RT-specific CTL.
To evaluate the temporal relationship
between protein expression in infected cells and the antiviral activity
of CTL, we compared the kinetics of cytolysis of infected cells
by CTL against the early protein Rev (TCC108 cells) and by CTL
against the late protein RT [TCL1C11 cells; specific for RT(244-252)
IVLPEKDSW in the context of HLA-B57 (29)]. Both TCC108 and
TCL1C11 cells were shown to lyse an HIV-1 IIIB-infected
CD4+ T-cell line, TCL2H7, obtained from individual L709
(Table 2). At 12 h after infection of TCL2H7 cells with HIV-1 IIIB
(MOI of approximately 1.0), no significant population of p55-expressing cells was detected (Fig. 3A). The
percentage of p55-expressing cells increased slightly between 12 and
24 h and increased rapidly thereafter: from 18% at 30 h to
50% at 36 h, 68% at 48 h, and 89% at 72 h.
Significant virus production was found at 30 h after infection, in
agreement with previous reports on the replication cycle of HIV-1
(14, 21), and production was increased at 36, 48, and
72 h (Fig. 3A). These data indicate that all cells expressing detectable levels of p55 at 48 h (here 68% of the cells) had been infected by the initial inoculum. Since Rev-encoding mRNA and Rev
protein have been detected at between 16 and 18 h after infection in IIIB-infected CD4+ T cells (14, 22), we
expected to find significant specific lysis by TCC108 cells added
between 26 and 30 h or between 32 and 36 h after infection.
Although the percentage of specific lysis was higher at these time
points than at 14 to 18 h, it did not exceed 10% (Fig. 3A). At 38 to 42 h it was still only 15%, and at 50 to 54 h it was
42%, reaching a maximum of 55% after 74 to 78 h (Fig. 3A). The
RT-specific CTL lysed the infected cells at similar levels and with
similar kinetics as the Rev-specific CTL (Fig. 3A). As expected, the
infected cells were not lysed by the non-HIV-specific TCC112 cells at
any time (Fig. 3A). In a parallel experiment, part of the infected
TCL2H7 cells were cocultured with the CTL immediately after infection.
In cultures containing TCC108 or TCL1C11 cells, p55 expression and
virus production were significantly suppressed at all times (Fig. 3B).
The presence of the TCC112 cells did not affect p55 expression or virus
production (Fig. 3B).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 3.
Kinetics of HIV-1 production and lysis of infected cells
by Rev- and RT-specific CTL. (A) CD4+ TCL2H7 cells were
infected as described in Materials and Methods, and culture
supernatants were harvested at the indicated times for analysis of
virus production. The TCL2H7 cells were analyzed for p55 expression and
for susceptibility to CTL-mediated lysis by Rev-specific clone TCC108,
RT-specific clone TCL1C11, and non-HIV-specific clone TCC112. The
effector-to-target ratios were 10:1. Lysis of uninfected
CD4+ TCL2H7 cells was below 5% in all assays (data not
shown). The chromium release data are plotted as the average (with
standard error) for triplicates at the time point at which the chromium
release assay was terminated, i.e., 6 hours after the addition of
chromium. This time was required for the chromium labelling (1 h),
washing of the target cells and preparing the cocultures of the
effector and target cells (1 h), and incubation (4 h). (B) p55
expression (closed symbols) and virus production (open symbols) by
TCL2H7 cells in the presence of TCC108 cells, TCL1C11 cells, or TCC112
cells. Effector and target cells were discriminated by flow cytometric
analyses of CD8 and CD4 expression, respectively. The population of
p55-expressing TCL2H7 cells is expressed as a percentage of the
CD8 cells and not of the CD4+ cells, since
CD4 was down-regulated in a major fraction of the infected cells. (C)
Infected TCL2H7 cells were analyzed in chromium release assays after
incubation without peptide or with the relevant peptides at 10 µM:
SAEPVPLQL for TCC108 cells and IVLPEKDSW for TCL1C11 cells. The average
specific lysis (with standard error) for triplicates is shown. The
dashed line shows the percentage of p55-expressing cells at 48 h
after infection. Lysis of uninfected TCL2H7 cells without peptides was
always below 5% (data not shown), and peptide-pulsed uninfected TCL2H7
cells were lysed as efficiently as peptide-pulsed infected cells (data
not shown).
|
|
That TCC108 and TCL1C11 cells were cytolytic at all time points was
verified in a separate assay: early after infection, target
cells
loaded with the relevant synthetic peptides were indeed
lysed
efficiently (Fig.
3C). Later, at 47 to 51 h, specific lysis
of
infected cells not loaded with the peptides also was observed
(Fig.
3C), confirming the results shown in Fig.
3A.
Together these data indicate that infected cells cultured in the
absence of HIV-specific CTL are not susceptible to cytolysis
before
they produce virus. Furthermore, they suggest that mechanisms
other
than cytolysis caused the observed CTL-mediated inhibition
of virus
production in the cocultures of effector and target cells.
In vitro inhibition of HIV-1 replication by TCC108 cells.
Subsequently, we investigated the longevity of the TCC108-mediated
antiviral activity with freshly isolated PBMC. HLA-B14-matched PBMC
were infected with HIV-1 IIIB (MOI of approximately 0.05) and
cocultured with TCC108 cells or the non-HIV-1-specific TCC112 cells for
11 days. The TCC-to-CD4 cell ratio was 0.2 at the start of the
experiment. Virus production was detected in cultures without TCC108
cells on days 6, 9, and 11 (Fig. 4A). In
the coculture with TCC108 cells, only a low level of RT activity was
detected on day 9. On day 11 this level was similar to that in the
control cultures. Flow cytometric analyses showed that the number of
TCC108 and TCC112 cells increased 100-fold during the culture period (Fig. 4B). Furthermore, CD8+ cells, recovered from the
culture containing TCC108 cells on days 6 and 11 by magnetic bead
selection, showed significant Rev-specific CTL activity (Fig. 4C).
These data indicate that the lack of control of virus replication could
not have been due to the disappearance of the clone from the culture or
to impairment of CTL function.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Inhibition of HIV-1 replication by Rev-specific CTL.
HLA-B14-expressing PBMC from an HIV-seronegative individual were
infected with HIV-1 IIIB as indicated in Materials and Methods. PBMC
(5 × 106) were cocultivated without CTL, with 5 × 105 Rev-specific TCC108 cells, or with 5 × 105 non-HIV-specific TCC112 cells. Both types of TCC cells
had been stimulated 7 days before addition to the PBMC. (A) Virus
production was analyzed by quantification of the RT activity in culture
supernatants. The average RT activity (with standard error) for
triplicates is shown. (B) The fates of the CD4+ PBMC and
the CD8+ TCC108 and TCC112 cells were determined by
counting of the cells and flow cytometric analysis of
membrane-expressed CD4, CD8, and HLA-A2. HLA-A2 was included to
discriminate between CD8+ PBMC (expressing HLA-A2) and the
added TCC108 and TCC112 cells (both expressing HLA-A1 and -A28). (C)
CD8+ cells were recovered from the cultures on days 6 and
11 by magnetic bead selection and analyzed for Rev-specific CTL
activity on autologous B-LCL cells infected with rVV-rev or
rVV-control. The average percent specific lysis (with standard error)
for triplicates is shown.
|
|
To test whether the virus had escaped CTL recognition by mutation in
the epitope, we sequenced the second exon of Rev directly
on the
amplicons from the total virus pool produced in the presence
or absence
of TCC108 cells. Sequencing was performed on samples
from day 11 only,
since amplifications carried out with earlier
samples did not yield PCR
products. Only the virus from the coculture
with TCC108 cells was found
to have a mutation, 69E

K, located
in the third residue of the
minimal epitope recognized by TCC108
cells (Fig.
5). The sequence signal was uniform,
indicating that
>90% of the virus population contained the mutation.
The mutant
peptide SAKPVPLQL was not recognized by TCC108 cells at
concentrations
ranging from 10 nM to 300 µM (data not shown),
indicating that
the new virus was indeed an escape variant.

View larger version (7K):
[in this window]
[in a new window]
|
FIG. 5.
Sequence analysis of the second-exon Rev from virus
cultured in the absence or presence of Rev-specific TCC108 cells. Viral
RNA was isolated from culture supernatants from the experiment shown in
Fig. 4 on day 11 postinfection. The second-exon Rev sequences of virus
cultured in the absence or presence of TCC108 cells are shown below the
sequences of three known IIIB clones (19) for reference
purposes. The CTL epitope region is in boldface.
|
|
To assess whether escape from a Rev-specific CTL response had occurred
in vivo, we attempted to amplify the plasma virus of
individual L709 at
different times after seroconversion. Primers
and PCR conditions were
the same as for the amplification of the
in vitro-cultured virus.
However, no PCR products were obtained,
most likely due to the low
viral load in this individual.
 |
DISCUSSION |
The fine specificity, kinetics of target cell lysis, and capacity
to inhibit HIV-1 replication of Rev-specific CTL from an individual
infected with HIV-1 for more than 12 years without developing symptoms
were analyzed. CTL clones generated from this individual's PBMC
recognized the 9-mer peptide Rev(67-75) SAEPVPLQL as their minimal
epitope in the context of HLA-B14. The presence of residue L75 at
position 9 is consistent with the reported motif for HLA-B14 binding
peptides (5). Other predicted anchor residues were not
present. Two longer peptides containing a potential anchor, 66R, were
recognized at similar levels of efficiency as the minimal epitope,
indicating that this residue did not enhance presentation to the CTL.
Analysis of the interactions between HIV-1-specific CTL and
HIV-1-infected target cells, i.e., immortalized polyclonal CD4+ T cells (TCL2H7 cells) infected with HIV-1 IIIB,
showed target cell lysis by both Rev- and RT-specific CTL. This
indicates that their respective epitopes, as defined by rVV and
synthetic peptide analyses, were indeed generated in these
HIV-1-infected cells. The kinetics of Rev- and RT-specific CTL-mediated
cytolysis, first observed well before peak virus production, indicate
that CTL may prevent a significant quantity of virus from being
produced. This is in agreement with the kinetics of Gag-, RT-, and
Env-specific CTL-mediated lysis of HIV-1-infected immortalized H9 and
T1 cells, as reported by Yang et al., who sampled at 24, 48, 72, and
96 h after infection (31). As a result of frequent
sampling between 24 and 48 h after infection, we were able to
extend their findings by showing that infected cells, in the absence of
CTL, produce virus before they become susceptible to CTL-mediated
lysis. A peptide-pulsing experiment revealed that limited target cell
lysis during the first 42 h after infection could not be explained
by insufficient effector cell numbers or impaired effector cell
function. Also, the possibility that limiting antigen levels had
affected the efficiency of cytolysis (26) is probably not
relevant for our system, considering the extent of viral protein
expression and virus production observed at 30 to 36 h after
infection. The similarity in the kinetics of cytolysis targeted at the
early protein Rev and at the late protein RT suggests that HIV-1
infection had interfered, transiently, with a general aspect of the
antigen processing and presentation pathway. A 20 to 50% reduction of HLA class I surface expression after HIV-1 infection has been reported
(13, 23, 31). This down-regulation was shown to decrease
cytolysis by HLA-specific CTL (13, 23) but had no appreciable effect on the capacity of infected cells to present synthetic peptides (31). The latter finding is consistent
with our observation that TCL2H7 cells were susceptible to CTL-mediated lysis early after infection when pulsed with the relevant peptides. The
presentation of endogenous epitopes, however, may be affected when
the intracellular expression of new HLA class I molecules is impaired.
Indeed, recently it has been shown that HIV-1 Nef is involved in
protecting infected cells from specific CTL-mediated lysis by affecting
the HLA class I surface expression (4). Also, other
mechanisms, such as Tat-mediated interference with the proteasome
function (24), may have impeded the generation of HLA class
I presentable peptides early after infection.
If lysis of infected cells were the only inhibitory mechanism of the
CTL, one would expect a steady increase of the levels of p55 expression
and virus production by infected cells, even in the presence of CTL,
until the time at which they became susceptible to CTL-mediated lysis.
However, when the Rev- or RT-specific CTL were added to the infected
cells immediately after infection, viral protein expression and virus
production were suppressed without delay during the entire coculture
period. These results suggest that early antiviral activity involved
noncytolytic mechanisms. Indeed, CD8+ T cells have been
shown to inhibit HIV-1 replication by the production of soluble factors
(3, 16, 32), to inhibit hepatitis B virus gene expression by
a noncytolytic mechanism (11), and to exert antiviral
effects against murine rotavirus and VV by perforin- and
Fas-independent mechanisms (7, 12). Because the Rev- and
RT-specific CTL were added to the target cells after infection, factors
that prevent binding or entry of HIV-1 could not have been involved in
the observed suppression of HIV-1 production. It is possible that the
suppression was mediated by CD8+-T-cell-derived factors
that interfere with viral transcription, like IL-16 (17, 33)
or CD8+ T-cell antiviral factor (16). If
noncytolytic antiviral mechanisms of TCC108 cells also contributed to
the observed suppression of viral replication in HLA-B14-matched PBMC,
they must have been specifically targeted toward the infected cells
expressing the appropriate HLA epitope complex, since the
replication of virus that had escaped CTL recognition by a mutation in
the HLA-B14-restricted epitope was not significantly affected.
Noncytolytic interference with transcription and translation may, like
cytolysis, require that CTL are targeted to infected cells via major
histocompatibility complex-epitope complexes, for this would be a
safeguard against harming bystander cells. To determine the relative
contributions of CTL against different proteins to the control of viral
replication, further characterization of (i) CTL against late proteins
with respect to their capacity to inhibit viral replication, (ii) the affinities of the different epitopes for their HLA restriction elements, and (iii) the affinity of each clone for its HLA peptide complex is required.
In summary, the present data show that CTL against early and late viral
proteins can lyse acutely HIV-1-infected cells efficiently, but only
after the production of progeny virus has started. Yet, virus
replication in freshly isolated PBMC was significantly suppressed by
CTL against the Rev protein, which resulted in the rapid selection of
CTL escape virus in vitro. It is important to realize that the
antiviral effect of CTL responses in vivo is determined by multiple
factors, including the breadth of the CTL response. Such factors will
be difficult to address in vitro with a limited set of CTL clones.
However, studies on the kinetics of viral protein-mediated interference
with target cell killing and on the relative contributions of CTL
against early and late viral proteins to the inhibition of viral
replication will shed new light on complications which the immune
system encounters in clearing virus and accordingly may contribute to
the development of vaccines and immunotherapies against AIDS.
 |
ACKNOWLEDGMENTS |
We acknowledge the participants of the Amsterdam Cohort Studies
on AIDS; O. Pontesilli for providing cell cultures; K. Sintnicolaas, E. F. Prsespolewsky, and the donors of the Rotterdam Blood Bank for providing HLA-typed PBMC; R. S. de Swart, G. M. G. M. Verjans, and F. C. G. M. UytdeHaag for
stimulating discussions; C. S. A. Guillon, H. W. Vos, B. van't Land, and M. E. M. Dings for technical support; and
C. W. H. M. Kruyssen, G. J. G. M. Osterop, J. M. Rimmelzwaan, and G. L. van der Water for
continued management support.
This work was supported by grant no. 1314 from the Dutch AIDS
Foundation.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Erasmus
University Rotterdam, Institute of Virology, Room EE17-26, P.O. Box
1738, 3000 DR Rotterdam, The Netherlands. Phone: 31 10 4088066. Fax: 31 10 4365145. E-mail: Osterhaus{at}viro.fgg.eur.nl.
 |
REFERENCES |
| 1.
|
Bloom, B. R.
1996.
A perspective on AIDS vaccines.
Science
272:1888-1890[Free Full Text].
|
| 2.
|
Borrow, P.,
H. Lewicki,
X. Wei,
M. S. Horwitz,
N. Peffer,
H. Meyers,
J. A. Nelson,
J. E. Gairin,
B. H. Hahn,
M. B. A. Oldstone, and G. M. Shaw.
1997.
Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus.
Nat. Med.
3:205-211[Medline].
|
| 3.
|
Buseyne, F.,
M. Fevrier,
S. Garcia,
M. L. Gougeon, and Y. Riviere.
1996.
Dual function of a human immunodeficiency virus (HIV)-specific cytotoxic T-lymphocyte clone: inhibition of HIV replication by noncytolytic mechanisms and lysis of HIV-infected CD4+ cells.
Virology
225:248-253[Medline].
|
| 4.
|
Collins, K. L.,
B. K. Chen,
S. A. Kalams,
B. D. Walker, and D. Baltimore.
1998.
HIV-1 Nef protein protects infected primary cells against killing by cytotoxic T lymphocytes.
Nature
391:397-401[Medline].
|
| 5.
|
DiBrino, M.,
K. C. Parker,
D. H. Margulies,
J. Shiloach,
R. V. Turner,
W. E. Biddison, and J. E. Coligan.
1994.
The HLA-B14 peptide binding site can accommodate peptides with different combinations of anchor peptides.
J. Biol. Chem.
269:32426-32434[Abstract/Free Full Text].
|
| 6.
|
Finzi, D.,
M. Hermankova,
T. Pierson,
L. Carruth,
C. Buck,
R. E. Chaisson,
T. C. Quinn,
K. Chadwick,
J. Margolick,
R. Brookmeyer,
J. Gallant,
M. Markowitz,
D. D. Ho,
D. D. Richman, and R. F. Siliciano.
1997.
Identification of a reservoir for HIV-1 in patients on highly active antiretroviral therapy.
Science
278:1295-1300[Abstract/Free Full Text].
|
| 7.
|
Franco, M. A.,
G. Tin,
L. S. Rott,
J. L. VanCott,
J. R. McGhee, and H. B. Greenberg.
1997.
Evidence for CD8+ T-cell immunity to murine rotavirus in the absence of perforine, Fas and gamma interferon.
J. Virol.
71:479-486[Abstract].
|
| 8.
|
Gotch, F. M.,
R. A. Koup, and J. T. Safrit.
1997.
New observations on cellular immunoresponses to HIV and T-cell epitopes.
AIDS
11:S99-S107.
|
| 9.
|
Goulder, P. J. R.,
R. E. Phillips,
R. A. Colbert,
S. McAdam,
G. Ogg,
M. Nowak,
P. Giangrande,
G. Luzzi,
B. Morgan,
A. Edwards,
A. J. McMichael, and S. Rowland-Jones.
1997.
Late escape from an immunodominant cytotoxic T-lymphocyte response associated with progression to AIDS.
Nat. Med.
3:212-217[Medline].
|
| 10.
|
Gregersen, J. P.,
H. Wege,
L. Preiss, and K. D. Jentsch.
1988.
Detection of human immunodeficiency virus and other retroviruses in cell culture supernatants by a reverse transcriptase microassay.
J. Virol. Methods
19:161-168[Medline].
|
| 11.
|
Guidotti, L. G.,
K. Ando,
M. V. Hobbs,
T. Ishikawa,
L. Runkel,
R. D. Schreiber, and F. V. Chisari.
1994.
Cytotoxic T lymphocytes inhibit hepatitis B virus gene expression by a noncytolytic mechanism in transgenic mice.
Proc. Natl. Acad. Sci. USA
91:3764-3768[Abstract/Free Full Text].
|
| 12.
|
Kagi, D.,
B. Ledermann,
K. Burki,
R. M. Zinkernagel, and H. Hengartner.
1996.
Molecular mechanisms of lymphocyte-mediated cytotoxicity and their role in immunological protection and pathogenesis in vivo.
Annu. Rev. Immunol.
14:207-232[Medline].
|
| 13.
|
Kerkau, T.,
R. Schmitt Landgraf,
A. Schimpl, and E. Wecker.
1989.
Downregulation of HLA class I antigens in HIV-1-infected cells.
Aids Res. Hum. Retroviruses
5:613-620[Medline].
|
| 14.
|
Kim, S.,
R. Byrn,
J. Groopman, and D. Baltimore.
1989.
Temporal aspects of DNA and RNA synthesis during human immunodeficiency virus infection: evidence for differential gene expression.
J. Virol.
63:3708-3713[Abstract/Free Full Text].
|
| 15.
|
Kingsman, S. M., and A. J. Kingsman.
1996.
The regulation of human immunodeficiency virus type-1 gene expression.
Eur. J. Biochem.
240:491-507[Medline].
|
| 16.
|
Levy, J. A.,
C. E. Mackewicz, and E. Barker.
1996.
Controlling HIV pathogenesis: the role of the noncytotoxic anti-HIV response of CD8+ T cells.
Immunol. Today
17:217-224[Medline].
|
| 17.
|
Maciaszek, J. W.,
N. A. Parada,
W. W. Cruikshank,
D. M. Center,
H. Kornfeld, and G. A. Viglianty.
1997.
IL-16 represses HIV-1 promoter activity.
J. Immunol.
158:5-8[Abstract].
|
| 18.
|
McCune, J. M.
1995.
Viral latency in HIV disease.
Cell
82:183-188[Medline].
|
| 19.
|
Meyers, G.,
B. Foley,
J. W. Mellors,
B. Korber,
K. Jeang, and S. Wain-Hobson.
1997.
Human retroviruses and AIDS 1996: a compilation and analysis of nucleic acid and amino acid sequences.
Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 20.
|
Pantaleo, G.
1997.
How immune-based interventions can change HIV therapy.
Nat. Med.
3:483-486[Medline].
|
| 21.
|
Perelson, A. S.,
A. U. Neumann,
M. Markowitz,
J. M. Leonard, and D. D. Ho.
1996.
HIV-1 dynamics in vivo: virion clearance rate, infected cell life-span, and viral generation time.
Science
271:1582-1586[Abstract].
|
| 22.
|
Ranki, A.,
A. Lagerstedt,
V. Ovod,
E. Aavik, and K. J. Krohn.
1994.
Expression kinetics and subcellular localization of HIV-1 regulatory proteins Nef, Tat and Rev in acutely and chronically infected lymphoid cell lines.
Arch. Virol.
139:365-378[Medline].
|
| 23.
|
Scheppler, J. A.,
J. K. A. Nicholson,
D. C. Swan,
A. Ahmed-Ansari, and J. S. McDougal.
1989.
Down-modulation of MHC-I in CD4+ T cell line CEM-E5, after HIV-1 infection.
J. Immunol.
143:2858-2866[Abstract].
|
| 24.
|
Seeger, M.,
K. Ferrell,
R. Franck, and W. Dubiel.
1997.
HIV-1 Tat inhibits the 20 S proteasome and its 11 S regulator-mediated activation.
J. Biol. Chem.
272:8145-8148[Abstract/Free Full Text].
|
| 25.
|
Siebelink, K. H.,
I. H. Chu,
G. F. Rimmelzwaan,
K. Weijer,
A. D. Osterhaus, and M. L. Bosch.
1992.
Isolation and partial characterization of infectious molecular clones of feline immunodeficiency virus obtained directly from bone marrow of DNA of a naturally infected cat.
J. Virol.
66:1091-1097[Abstract/Free Full Text].
|
| 26.
|
Tsomides, T. J.,
A. Aldovini,
R. P. Johnson,
B. D. Walker,
R. A. Young, and H. N. Eisen.
1994.
Naturally processed viral peptides recognized by cytotoxic T lymphocytes on cells chronically infected by human immunodeficiency virus type 1.
J. Exp. Med.
180:1283-1293[Abstract/Free Full Text].
|
| 27.
|
Tsubota, H.,
C. I. Lord,
D. I. Watkins,
C. Morimoto, and N. L. Letvin.
1989.
A cytotoxic T lymphocyte inhibits acquired immunodeficiency syndrome virus replication in peripheral blood lymphocytes.
J. Exp. Med.
169:1421-1434[Abstract/Free Full Text].
|
| 28.
|
van Baalen, C. A.,
O. Pontesilli,
R. C. Huisman,
A. M. Geretti,
M. R. Klein,
F. De Wolf,
F. Miedema,
R. A. Gruters, and A. D. M. E. Osterhaus.
1997.
Human immunodeficiency virus type 1 Rev- and Tat-specific cytotoxic T lymphocyte frequencies inversely correlate with rapid progression to AIDS.
J. Gen. Virol.
78:1913-1918[Abstract].
|
| 29.
|
Van der Burg, S. H.,
M. R. Klein,
O. Pontesilli,
A. M. Holwerda,
J. W. Drijfhout,
W. M. Kast,
F. Miedema, and C. J. M. Melief.
1997.
HIV-1 reverse transcriptase-specific CTL against conserved epitopes do not protect against progression to AIDS.
J. Immunol.
159:3648-3654[Abstract].
|
| 30.
|
Wong, J. K.,
M. Hezareh,
H. F. Günthard,
D. V. Havlir,
C. C. Ignacio,
C. A. Spina, and D. D. Richman.
1997.
Recovery of replication-competent HIV despite prolonged suppression of plasma viremia.
Science
278:1291-1295[Abstract/Free Full Text].
|
| 31.
|
Yang, O. O.,
S. A. Kalams,
M. Rosenzweig,
A. Trocha,
N. Jones,
M. Koziel,
B. D. Walker, and R. P. Johnson.
1996.
Efficient lysis of human immunodeficiency virus type 1-infected cells by cytotoxic T lymphocytes.
J. Virol.
70:5799-5806[Abstract].
|
| 32.
|
Yang, O. O.,
S. A. Kalams,
A. Trocha,
H. Cao,
A. Luster,
R. P. Johnson, and B. D. Walker.
1997.
Suppression of human immunodeficiency virus type 1 replication by CD8+ cells: evidence for HLA class I-restricted triggering of cytolytic and noncytolytic mechanisms.
J. Virol.
71:3120-3128[Abstract].
|
| 33.
|
Zou, P.,
S. Goldstein,
K. Devadas,
D. Tewari, and A. L. Notkins.
1997.
Human CD4+ cells transfected with IL-16 cDNA are resistant to HIV-1 infection: inhibition of mRNA expression.
Nat. Med.
3:659-664[Medline].
|
J Virol, August 1998, p. 6851-6857, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sacha, J. B., Chung, C., Reed, J., Jonas, A. K., Bean, A. T., Spencer, S. P., Lee, W., Vojnov, L., Rudersdorf, R., Friedrich, T. C., Wilson, N. A., Lifson, J. D., Watkins, D. I.
(2007). Pol-Specific CD8+ T Cells Recognize Simian Immunodeficiency Virus-Infected Cells Prior to Nef-Mediated Major Histocompatibility Complex Class I Downregulation. J. Virol.
81: 11703-11712
[Abstract]
[Full Text]
-
Loffredo, J. T., Burwitz, B. J., Rakasz, E. G., Spencer, S. P., Stephany, J. J., Giraldo Vela, J. P., Martin, S. R., Reed, J., Piaskowski, S. M., Furlott, J., Weisgrau, K. L., Rodrigues, D. S., Soma, T., Napoe, G., Friedrich, T. C., Wilson, N. A., Kallas, E. G., Watkins, D. I.
(2007). The Antiviral Efficacy of Simian Immunodeficiency Virus-Specific CD8+ T Cells Is Unrelated to Epitope Specificity and Is Abrogated by Viral Escape. J. Virol.
81: 2624-2634
[Abstract]
[Full Text]
-
Sacha, J. B., Chung, C., Rakasz, E. G., Spencer, S. P., Jonas, A. K., Bean, A. T., Lee, W., Burwitz, B. J., Stephany, J. J., Loffredo, J. T., Allison, D. B., Adnan, S., Hoji, A., Wilson, N. A., Friedrich, T. C., Lifson, J. D., Yang, O. O., Watkins, D. I.
(2007). Gag-Specific CD8+ T Lymphocytes Recognize Infected Cells before AIDS-Virus Integration and Viral Protein Expression. J. Immunol.
178: 2746-2754
[Abstract]
[Full Text]
-
Fakruddin, J. M., Lempicki, R. A., Gorelick, R. J., Yang, J., Adelsberger, J. W., Garcia-Pineres, A. J., Pinto, L. A., Lane, H. C., Imamichi, T.
(2007). Noninfectious papilloma virus-like particles inhibit HIV-1 replication: implications for immune control of HIV-1 infection by IL-27. Blood
109: 1841-1849
[Abstract]
[Full Text]
-
Adnan, S., Balamurugan, A., Trocha, A., Bennett, M. S., Ng, H. L., Ali, A., Brander, C., Yang, O. O.
(2006). Nef interference with HIV-1-specific CTL antiviral activity is epitope specific. Blood
108: 3414-3419
[Abstract]
[Full Text]
-
Wilson, N. A., Reed, J., Napoe, G. S., Piaskowski, S., Szymanski, A., Furlott, J., Gonzalez, E. J., Yant, L. J., Maness, N. J., May, G. E., Soma, T., Reynolds, M. R., Rakasz, E., Rudersdorf, R., McDermott, A. B., O'Connor, D. H., Friedrich, T. C., Allison, D. B., Patki, A., Picker, L. J., Burton, D. R., Lin, J., Huang, L., Patel, D., Heindecker, G., Fan, J., Citron, M., Horton, M., Wang, F., Liang, X., Shiver, J. W., Casimiro, D. R., Watkins, D. I.
(2006). Vaccine-Induced Cellular Immune Responses Reduce Plasma Viral Concentrations after Repeated Low-Dose Challenge with Pathogenic Simian Immunodeficiency Virus SIVmac239.. J. Virol.
80: 5875-5885
[Abstract]
[Full Text]
-
Lauren, A., Thorstensson, R., Fenyo, E. M.
(2006). Comparative studies on mucosal and intravenous transmission of simian immunodeficiency virus (SIVsm): the kinetics of evolution to neutralization resistance are related to progression rate of disease.. J. Gen. Virol.
87: 595-606
[Abstract]
[Full Text]
-
Hel, Z., Tsai, W.-P., Tryniszewska, E., Nacsa, J., Markham, P. D., Lewis, M. G., Pavlakis, G. N., Felber, B. K., Tartaglia, J., Franchini, G.
(2006). Improved Vaccine Protection from Simian AIDS by the Addition of Nonstructural Simian Immunodeficiency Virus Genes. J. Immunol.
176: 85-96
[Abstract]
[Full Text]
-
Loffredo, J. T., Rakasz, E. G., Giraldo, J. P., Spencer, S. P., Grafton, K. K., Martin, S. R., Napoe, G., Yant, L. J., Wilson, N. A., Watkins, D. I.
(2005). Tat28-35SL8-Specific CD8+ T Lymphocytes Are More Effective than Gag181-189CM9-Specific CD8+ T Lymphocytes at Suppressing Simian Immunodeficiency Virus Replication in a Functional In Vitro Assay. J. Virol.
79: 14986-14991
[Abstract]
[Full Text]
-
Loffredo, J. T., Sidney, J., Wojewoda, C., Dodds, E., Reynolds, M. R., Napoe, G., Mothe, B. R., O'Connor, D. H., Wilson, N. A., Watkins, D. I., Sette, A.
(2004). Identification of Seventeen New Simian Immunodeficiency Virus-Derived CD8+ T Cell Epitopes Restricted by the High Frequency Molecule, Mamu-A*02, and Potential Escape from CTL Recognition. J. Immunol.
173: 5064-5076
[Abstract]
[Full Text]
-
Yokomaku, Y., Miura, H., Tomiyama, H., Kawana-Tachikawa, A., Takiguchi, M., Kojima, A., Nagai, Y., Iwamoto, A., Matsuda, Z., Ariyoshi, K.
(2004). Impaired Processing and Presentation of Cytotoxic-T-Lymphocyte (CTL) Epitopes Are Major Escape Mechanisms from CTL Immune Pressure in Human Immunodeficiency Virus Type 1 Infection. J. Virol.
78: 1324-1332
[Abstract]
[Full Text]
-
O'Connor, D. H., Mothe, B. R., Weinfurter, J. T., Fuenger, S., Rehrauer, W. M., Jing, P., Rudersdorf, R. R., Liebl, M. E., Krebs, K., Vasquez, J., Dodds, E., Loffredo, J., Martin, S., McDermott, A. B., Allen, T. M., Wang, C., Doxiadis, G. G., Montefiori, D. C., Hughes, A., Burton, D. R., Allison, D. B., Wolinsky, S. M., Bontrop, R., Picker, L. J., Watkins, D. I.
(2003). Major Histocompatibility Complex Class I Alleles Associated with Slow Simian Immunodeficiency Virus Disease Progression Bind Epitopes Recognized by Dominant Acute-Phase Cytotoxic-T-Lymphocyte Responses. J. Virol.
77: 9029-9040
[Abstract]
[Full Text]
-
Yang, O. O., Sarkis, P. T. N., Ali, A., Harlow, J. D., Brander, C., Kalams, S. A., Walker, B. D.
(2003). Determinants of HIV-1 Mutational Escape From Cytotoxic T Lymphocytes. JEM
197: 1365-1375
[Abstract]
[Full Text]
-
Allen, T. M., Mortara, L., Mothe, B. R., Liebl, M., Jing, P., Calore, B., Piekarczyk, M., Ruddersdorf, R., O'Connor, D. H., Wang, X., Wang, C., Allison, D. B., Altman, J. D., Sette, A., Desrosiers, R. C., Sutter, G., Watkins, D. I.
(2002). Tat-Vaccinated Macaques Do Not Control Simian Immunodeficiency Virus SIVmac239 Replication. J. Virol.
76: 4108-4112
[Abstract]
[Full Text]
-
Schutten, M., van Baalen, C. A., Guillon, C., Huisman, R. C., Boers, P. H. M., Sintnicolaas, K., Gruters, R. A., Osterhaus, A. D. M. E.
(2001). Macrophage Tropism of Human Immunodeficiency Virus Type 1 Facilitates In Vivo Escape from Cytotoxic T-Lymphocyte Pressure. J. Virol.
75: 2706-2709
[Abstract]
[Full Text]
-
Addo, M. M., Altfeld, M., Rosenberg, E. S., Eldridge, R. L., Philips, M. N., Habeeb, K., Khatri, A., Brander, C., Robbins, G. K., Mazzara, G. P., Goulder, P. J. R., Walker, B. D., the HIV Controller Study Collaboration,
(2001). The HIV-1 regulatory proteins Tat and Rev are frequently targeted by cytotoxic T lymphocytes derived from HIV-1-infected individuals. Proc. Natl. Acad. Sci. USA
98: 1781-1786
[Abstract]
[Full Text]
-
Sewell, A. K., Price, D. A., Oxenius, A., Kelleher, A. D., Phillips, R. E.
(2000). Cytotoxic T Lymphocyte Responses to Human Immunodeficiency Virus: Control and Escape. Stem Cells
18: 230-244
[Abstract]
[Full Text]
-
Goulder, P. J. R., Tang, Y., Pelton, S. I., Walker, B. D.
(2000). HLA-B57-Restricted Cytotoxic T-Lymphocyte Activity in a Single Infected Subject toward Two Optimal Epitopes, One of Which Is Entirely Contained within the Other. J. Virol.
74: 5291-5299
[Abstract]
[Full Text]
-
van der Ende, M. E., Guillon, C., Boers, P. H. M., Gruters, R. A., Racz, P., Tenner-Racz, K., Osterhaus, A. D. M. E., Schutten, M.
(2000). Broadening of coreceptor usage by human immunodeficiency virus type 2 does not correlate with increased pathogenicity in an in vivo model. J. Gen. Virol.
81: 507-513
[Abstract]
[Full Text]