Previous Article | Next Article 
J Virol, August 1998, p. 6822-6831, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
p53 Protein Is a Suppressor of Papillomavirus DNA
Amplificational Replication
Dina
Lepik,1
Ivar
Ilves,1
Arnold
Kristjuhan,2
Toivo
Maimets,2 and
Mart
Ustav1,*
Department of Microbiology and
Virology1 and
Department of Cell
Biology,2 Institute of Molecular and Cell
Biology, Tartu University and Estonian Biocentre, Tartu EE2400, Estonia
Received 9 March 1998/Accepted 12 May 1998
 |
ABSTRACT |
p53 protein was able to block human and bovine papillomavirus DNA
amplificational replication while not interfering with Epstein-Barr virus oriP once-per-cell cycle replication. Oligomerization, intact DNA-binding, replication protein A-binding, and proline-rich domains of
the p53 protein were essential for efficient inhibition, while the
N-terminal transcriptional activation and C-terminal regulatory domains
were dispensable for the suppressor activity of the p53 protein. The
inhibition of replication was caused neither by the downregulation of
expression of the E1 and E2 proteins nor by cell cycle block or
apoptosis. Our data suggest that the intrinsic activity of p53 to
suppress amplificational replication of the papillomavirus origin may
have an important role in the virus life cycle and in virus-cell
interactions.
| |
INTRODUCTION |
Human papillomaviruses (HPVs) are
small DNA viruses clearly associated with the induction of cancer. The
papillomavirus life cycle can be divided into three stages (7,
20). First, following initial entry, the papillomavirus genome is
amplified in the nucleus and viral copy number is increased up to 1,000 per haploid cell genome. During the second, maintenance stage, the
viral DNA replicates in synchrony with the cellular DNA, at a constant
copy number per cell. The third, vegetative replication stage of the
viral genome occurs in the terminally differentiated cells.
Papillomaviruses have developed an efficient system for modulating the
activity of cellular tumor suppressor genes. HPV type 16 (HPV-16) and
HPV-18 E6 proteins are capable of interacting with p53 and directing its degradation (50), while the E7 protein forms a complex
with retinoblastoma protein (pRB) (15). These events lead to
the loss of cell control over crucial events
DNA replication, repair and apoptosistherefore creating favorable conditions for rapid viral
DNA amplification and establishment of infection. In addition, expression of the E6 and E7 proteins may be an indication that some
stages of papillomavirus replication during the three-step life cycle
are susceptible to the action of p53 or pRB.
The tumor suppressor protein p53 is believed to be one of the key
players in the control of the genomic stability of the cells (25,
27, 32). It is structured as a typical eukaryotic transcription activator which contains DNA-binding and transactivation domains and is
able to activate or repress the transcription of certain genes (for a
review, see reference 25). Exposure of normal cells to different stress conditions induces both an intracellular increase in the steady-state level of p53 and direct activation of the protein
(23). As a result, the transition of cells in the cell cycle
may be prevented, and apoptotic death of the cells with damaged DNA may
be induced (reviewed in reference 32).
Several studies found that the mutation or loss of one or both alleles
of p53 was sufficient to allow gene amplification to occur in the cells
(36, 67), thus indicating that the p53 protein is involved
in the control of events leading to the amplification of genomic
sequences. The p53 protein seems to be directly involved in the control
of DNA replication and repair (for reviews, see references in reference
25). It has been demonstrated that the p53 protein
is capable of interacting with several proteins and enzymes involved in
DNA repair or replication, such as single-stranded DNA (ssDNA)-binding
replication protein A (RPA) (14, 33), cellular DNA helicases
(47), and homologous recombination factor RAD51/RecA
(53). The p53 protein lacking its C-terminal regulatory part
blocks nuclear DNA replication in the transcription-free Xenopus egg extracts (13). Immunostaining studies
show colocalization of the p53 protein with proliferating cell nuclear
antigen (PCNA), DNA polymerase 
, DNA ligase, and RPA at the sites of
DNA replication in herpes simplex virus-infected cells (62).
Replication of simian virus 40 (SV40) DNA can be prevented by binding
to and inactivating the large T antigen by the p53 protein (52,
60). Replication of the polyomavirus origin is inhibited by p53
in vitro when up to 16 copies of the p53-specific binding sites have been inserted into the plasmid (39), while replication of
the polyomavirus origin in vivo is activated by the same protein in a
sequence-dependent manner (22).
We studied the effect of the p53 protein on the replication of
papillomavirus origins in vivo in different cell lines and found that
the p53 protein is a potent repressor of bovine and human
papillomavirus amplificational replication. The repression of
replication was dependent on the p53 protein concentration in the
cells. We show that the intact central DNA-binding domain and the
oligomerization domain of the p53 protein, as well as a part of the
N-terminal domain containing the RPA-binding and proline-rich
sequences, are essential for this activity. In the same time, the p53
protein and its mutants were unable to interfere with the once-per-cell
cycle replication of Epstein-Barr virus (EBV) oriP. Repression of
papillomavirus DNA amplification is neither an indirect consequence of
the p53-dependent cell cycle block or apoptosis nor mediated by the
transactivation or transrepression activities of the p53 protein.
Possible implications of the observed phenomena on virus-cell
interactions will be discussed.
| |
MATERIALS AND METHODS |
Plasmids.
Bovine papillomavirus type 1 (BPV-1) E1 expression
vector pCGEag, E2 expression vector pCGE2, minimal replication origin
plasmid pUCAlu, HPV-11 E1 expression vector pMT2-E1, HPV-11 E2
expression vector pMT2-E2, and HPV-11 upstream regulatory region
(URR)-containing plasmid p7072-99 have been described previously
(11, 57). pNeoBgl40 contains the BPV-1-URR from nucleotides
6946 to 63 and has been described previously (44). The BPV-1
origin constructs pUC12B and pUC18A have been described previously
(55). The HPV-18 E1 and E2 expression vector pCGE1B and
origin plasmid pLCR have been reported earlier (45). Plasmid
p994 harboring the EBV latent oriP is a kind gift of B. Sugden
(24). Bcl-2 expression plasmid pcDBCL2 has been described by
Mah et al. (37).
Human p53 cDNAs were cloned into expression vector pCG (54).
pCGwtp53 and pCGtrp248 encode wild-type (wt) and Arg248Trp mutant p53
proteins, respectively. The mutant Arg248Trp p53 cDNA was kindly
provided by Bert Vogelstein. All deletion mutants were created by PCR
and expressed from the pCG vector. pCG
N39 encodes wt p53
protein with deletion of the first 39 amino acids. pCGC362 and
pCG305 encode truncated proteins with stop codons at positions 362 and 305, respectively. pCG324-355 encodes p53 with deletion of amino
acids at residues 324 to 355. pCGN39C362 and
pCGN39C362trp248 encode wild-type or Arg248Trp mutant p53
starting from amino acid 40 and containing a stop codon at position
362. N61C362 and N92C362 lack the first 61 and 92 N-terminal amino acids, respectively, and contain a stop codon at
position 362. ProC362 and N39ProC362 lack amino acids 63 to 91 and contain the stop codon at position 362; N39ProC362
lacks also the N-terminal 39 amino acids. The correctness of the
endpoints and all mutated sites of the p53 coding regions were verified
by sequencing.
Cells and transfections.
The cell line CHO and its
derivatives CHO4.15 (expressing BPV-1 E1 and E2 proteins), CHOBgl40 (in
addition containing latent BPV-1 origin plasmid), and CHO212
(expressing BPV-1 E1) (44) were maintained in Ham's F12
medium supplemented with 10% fetal calf serum. Human osteosarcoma 143 (66), Cos7, and SAOS-2 cells were maintained in Iscove's
modified Dulbecco's medium with 10% fetal bovine serum.
Electroporation experiments were carried out as described earlier,
using an Invitrogen ElectroPorator at capacitance setting 960 µF.
Voltage settings were 230 V for CHO, CHO4.15, and CHOBgl40 cells, 170 V
for human osteosarcoma 143 cells, 180 V for Cos7 cells, and 210 V for
SAOS-2 cells. Transfection efficiencies were determined by in situ
staining of the cells transfected in parallel with the
-galactosidase-expressing plasmid pON260 (56). Transient
replication assays were performed as described previously (56).
Immunoblotting and DNA binding assays.
The expression level
of p53 mutant proteins was estimated by Western blot analysis of
CHO4.15 cells transfected with 500 ng of p53 expression plasmid and
processed 24 or 48 h after transfection according to standard
methods (48). Equal amounts of total protein were analyzed
in each experiment. Antibodies pAb240, pAb421, and pAb1801 were used
for detection of p53 proteins. The E2 protein level in CHO4.15 cells in
the presence of expressed p53 constructs was analyzed in the same way,
using a mixture of purified monoclonal E2-specific antibodies 1E2,
3F12, 1H10, 1E4, and 3C1 (2). Goat anti-mouse antibody
conjugated to alkaline phosphatase was used as a secondary antibody.
The effect of p53 expression on E2-specific DNA-binding activity in
CHO4.15 cells was measured as described earlier (
2).
Analysis was performed 48 h after transfection with p53 expression
plasmids. p53-specific DNA binding was tested by an analogous
protocol,
using the artificial p53-binding double-stranded oligonucleotide
5'AGACATGCCTAGACATGCCT3' (
21). Monoclonal
antibodies pAb421
and 3F12 were added for supershifting the
p53-specific and E2-specific
complexes, respectively. Monoclonal
antibody HO7.1 was used for
p53 deletion mutants lacking the pAb421
epitope.
Northern blotting of E1 mRNA.
CHO4.15 cells were transfected
with 500 ng of p53 expression constructs, and 48 h later the total
RNA was extracted by using an RNeasy Total RNA kit supplied by Qiagen.
Northern blot analysis of the extracted RNA was performed according to
standard methods (48). E1-specific radioactive probe was
generated by random priming using the 1.8-kb
XbaI-Eco91I BPV-1 E1-encoding fragment from
pCGEag (57) as a template. E1-specific signals were
quantitated on a PhosphorImager SI (Molecular Dynamics), and the
results were normalized to S7- and -actin-specific signals. Human
ribosomal protein S7 (3) and -actin cDNA plasmids used as
a templates to generate radioactive probes were kind gifts of Tarmo
Annilo and Mati Reeben, respectively.
Analysis of cell cycle distribution and sub-G1 DNA
content of p53-transfected CHO4.15 cells.
Both floating and
adherent cells were collected 48 h posttransfection, washed once
with phosphate-buffered saline (PBS), and fixed in 5 ml of ice-cold
70% ethanol for flow cytometric analysis. The propidium iodide
fluorescent staining of nuclei was analyzed in an ATC3000 flow
cytometer (Odam-Brucker, Wissembourg, France) equipped with a
Spectraphysics argon laser. Cells were pelleted prior to the analysis,
washed once in PBS, suspended in 500 µl of PBS with 1 mM
MgCl2 and 30 µg of RNase A per ml, and incubated at
37°C for 1 h to digest cellular RNA. Propidium iodide was added to a final concentration of 10 µg/ml, and samples were incubated on
ice for at least 15 min to stain the nuclear DNA. The signals from
50,000 cells were collected from each sample and analyzed by the method
of Dean and Jett (13a), using the standard software provided
by the manufacturer of the flow cytometer. Cells for the parallel
replication assay were processed as described above. The terminal
deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling
(TUNEL) assay was performed as described in reference
17.
| |
RESULTS |
p53 protein inhibits amplificational replication of papillomavirus
origins.
We have developed an efficient model system to study the
replication of papillomavirus origins in tissue culture (11, 44, 45, 56). To determine whether the p53 protein has any effect on
the replication, we performed transient replication assays in CHO-K1
cells, where BPV-1 and HPV origin-containing plasmids replicate in the
presence of homologous and heterologous E1 and E2 proteins (11,
57). CHO cells have been used extensively for DNA amplification
studies and have been shown to carry the defective p53 gene with
substitution Thr211Lys (28). Inspection of these cells with
a mixture of p53-specific antibodies did not reveal any detectable
endogenous expression of the p53 protein in our hands (data not shown).
Cotransfection of the BPV-1 E1 and E2 expression plasmids with the
BPV-1 origin plasmid into CHO cells resulted in robust
replication
(Fig.
1A, lane 1). Coexpression of human
wt p53 protein
suppressed BPV-1 origin replication almost completely in
this
system (Fig.
1A, lane 2). The extent of suppression was
proportional
to the amount of introduced p53 expression plasmid (Fig.
1B) and
was detected at 25 ng of the cotransfected plasmid DNA. The
effects
of p53 protein expression on the replication of the HPV-11
(Fig.
1A, lanes 3 and 4) and HPV-18 (lanes 5 and 6) origin plasmids
in
the presence of the homologous E1 and E2 replication proteins
were
identical. The replication signal of the HPV origins in CHO
cells
decreased for the third time point (96 h posttransfection),
possibly as
a result of the less intense replication and the loss
of E1 and E2
expression plasmids from the cells upon cell division.
Cotransfection
with the vector carrying no p53 sequences did not
affect replication of
the papillomavirus origin (Fig.
1A, lane
7), which indicates that the
block of replication is not caused
by promoter competition between the
p53, E1, and E2 expression
cartridges. Experiments carried out with
mouse wt p53 protein
gave identical results (data not shown).
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 1.
Southern blot analyses. p53 suppresses the
amplificational replication of different papillomavirus replication
origins. Episomal DNA was extracted from cells at 48, 72, and 96 h
after transfection and digested with restriction endonucleases
PstI and DpnI. Filters were probed with
radiolabeled HPV-11 URR containing plasmid p7072-99. M, 200 pg of the
linear HPV-11 origin plasmid marker; carrier, mock-transfected cells.
Arrows indicate the bands generated after digestion of the episomal
BPV-1 origin plasmid with PstI. (A) Effect of wt p53
expression on the transient replication of BPV-1, HPV-11, and HPV-18
full-length origin plasmids in CHO cells. In this assay, 100 ng of
BPV-1 origin pNeoBgl40 (lanes 1 and 2), HPV-11 origin p7072-99 (lanes 3 and 4), or HPV-18 origin pLCR (lanes 5 and 6), with (+) or without ( )
100 ng of wt p53 expression construct pCGwtp53, was transfected.
pCGE5AS, control with plasmid producing no p53 (lane 7). Amounts of E1
and E2 expression vectors used were 250 ng for BPV-1 (pCGEag and
pCGE2), 500 ng for HPV-11 (pMT2-E1 and pMT2-E2), and 650 ng for HPV-18
(pCGE1B). (B) The inhibition of replication of the BPV-1 replication
origin is proportional to the amount of introduced p53. The replication
signals of two independent experiments (72 h posttransfection) were
quantified with a PhosphorImager, and signals from cells transfected
with origin plasmid only were used as a control to normalize the
results. (C) Effect of wt p53 expression on the transient replication
of plasmids containing different BPV-1 origin constructs in CHO4.15
cells. In this assay, 100 ng of wt p53 expression plasmid and 100 ng of
each BPV-1 replication origin construct were transfected into the
cells. Lanes: 1 and 2, replication of full-length BPV-1 origin plasmid
pNeoBgl40; 3 and 4, origin plasmid pUCAlu; 5 and 6, origin plasmid
pUC12B; 7 and 8, origin plasmid pUC18A. (D) Schematic representation of
the papillomavirus replication origin inserts used. The specific
transcription enhancer region in HPV replication origins (enhancer),
the BPV-1 origin A/T-rich region (A/T), and E1 protein (E1BS; unfilled
boxes)- and E2 protein (E2BS9, E2BS11, and E2BS12; shadowed
boxes)-binding sites are indicated. Numbers indicate positions on the
HPV-11, HPV-18, or BPV-1 nucleotide sequence.
|
|
In the next step, we studied the effect of p53 on the replication of
different BPV-1 origin deletion mutants in the cell line
CHO4.15. This
cell line exhibits constitutive expression of BPV-1
E1 and E2
replication proteins from the integrated expression
vectors
(
44). Figure
1C represents replication of the BPV-1
full-length origin plasmid pNeoBgl40 and of origin deletion variants
pUCAlu, pUC12B, and pUC18A in the absence and presence of overexpressed
p53 protein. Our data show that the replication of plasmids pNeoBgl40,
pUCAlu, pUC12B, and pUC18A (depicted schematically in Fig.
1D)
is
efficiently blocked by the overexpressed p53 protein (Fig.
1C, lanes 2, 4, 6, and 8) and suggest that there are no defined
p53-specific
cis elements in the BPV-1 origin of replication that
could
mediate the effect, unless it is the minimal replication
origin itself:
A/T-rich region and E1- and E2-binding sites.
Structural determinants of the p53 protein responsible for
inhibition of amplificational replication of the BPV-1 origin.
To
map the domains of the p53 protein responsible for the inhibition of
papillomavirus replication, a set of p53 mutants was constructed
(schematically depicted in Fig. 2A). The
stability, expression level, and activity of the mutant proteins were
tested in CHO4.15, Cos7, and SAOS-2 cell lines by Western blot and
specific DNA band shift analysis. The mutant proteins with the deleted N-terminal activation domain were expressed at an approximately fivefold-higher level than proteins with the intact N terminus, wt p53,
C305, C362, and ProC362. The N-terminal activation domain
contains the binding site of the Mdm2 protein, which has been shown to
facilitate degradation of the p53 protein in vivo and therefore reduce
the half-life and steady-state level of the p53 protein in cells
(19, 26). All of the mutants except those with point
mutation Trp248 and deletions C305 and 324-355, gave a specific
complex with the double-stranded oligonucleotide corresponding to the
artificial p53-binding site (21). The intensity of the band
shift correlated with the expression level of the p53 proteins in the
extract (data not shown).
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 2.
Mapping of the p53 domains necessary for suppression of
papillomavirus amplificational replication. (A) Schematic
representation of p53 mutants. Numbers indicate positions on the amino
acid sequence. (B) Southern blot analysis of the transient replication
of BPV-1 origin plasmid pNeoBgl40 in the presence of different p53
mutants in the CHO4.15 cell line. Episomal DNA was extracted from cells
at 48, 72, and 96 h after transfection and digested with
restriction endonucleases PstI and DpnI. Filters
were probed with radiolabeled HPV-11 URR containing plasmid p7072-99;
100 ng of pNeoBgl40 together with 250 ng of p53 expression plasmid was
transfected into the cells. Lanes 1 to 8 correspond to the
transfections with p53 mutants in the same order as depicted in panel
A. Carrier, mock-transfected cells; BPV1 ori, control with no added
p53. (C) Relative inhibition of replication of the BPV-1 replication
origin by different p53 mutants. The replication signals of three
independent experiments (72 h posttransfection) were quantified with a
PhosphorImager and signals from the cells transfected with origin
plasmid only were used as a control to normalize the results. (D)
Southern blot analysis of transient replication of the BPV-1 origin
plasmid pUCAlu in the presence of additional N-terminal p53 deletion
mutants in the CHO4.15 cell line. Episomal DNA was extracted from cells
at 72 and 96 h after transfection and digested with restriction
endonucleases PstI and DpnI. Filters were probed
with radiolabeled pUCAlu plasmid. Lanes 1, 7, 9, 10, and 11 correspond
to transfections with p53 mutants as depicted in panel A.
|
|
The BPV-1 origin plasmid and the different mutant p53 protein
expression plasmids were cotransfected into CHO4.15 cells; episomal
DNA
was harvested and analyzed by Southern blotting (Fig.
2B).
wt p53, the
C-terminal regulatory domain-defective mutant
C362,
the N-terminal
deletion mutant
N39 lacking the transcription
activation domain, and
the double-deletion mutant
N39
C362 all
retained the ability to
suppress replication (Fig.
2B; compare
lanes 1, 2, 4, and 7 with lane
BPV1 ori). The replication signals
from three independent experiments
were measured with a PhosphorImager,
and the data are presented in Fig.
2C. The mutants with a deleted
oligomerization domain (
324-355) or
the whole C-terminal part
of the protein up to amino acid 305 (
C305)
(Fig.
2B, lanes 3
and 5; Fig.
2C) had little or no effect on
replication. The point
mutation Arg248Trp in the DNA-binding domain of
the p53 protein
abolished the suppressor activity of the full-size p53
protein
(Fig.
2B, lane 6) and even seemed to convert the
double-deletion
mutant
N39
C362 to an activator of replication
(Fig.
2B, lane
8; Fig.
2C). These data indicate that intact DNA-binding
and oligomerization
domains are both necessary for the p53 protein
activity to suppress
papillomavirus DNA amplificational replication,
while the N-terminal
transcription activation and C-terminal regulatory
domains are
dispensable for this activity.
The active p53 deletion mutant
N39
C362 contains, in addition to
the DNA-binding core region (residues 100 to 300), flexible
linker
region (residues 301 to 320), and oligomerization domain
(residues 320 to 360) (
25), also the RPA-binding domain (residues
40 to
60) (
1,
14,
30) and a proline-rich putative binding
site for
proteins with the SH3 domain (residues 61 to 91) (
59).
We
constructed four additional p53 deletion variants and tested
their
stability and DNA-binding activity. The constructed mutants
were stable
in CHO4.15 cells and bound DNA sequence specifically,
as measured by
DNA gel shift assay (data not shown). These mutants
were used for the
suppression of replication of the minimal origin
plasmid pUCAlu in
CHO4.15 cells (Fig.
2D). None of the newly constructed
deletion mutants
was able to block replication of the pUCAlu origin
plasmid comparably
to wt p53 or
N39
C62. These data indicate
that four domains of the
p53 protein
oligomerization (residues
320 to 360), DNA-binding
(residues 100 to 300), proline-rich (residues
61 to 92), and
RPA-binding (residues 40 to 61) domains
are necessary
for the
replication suppressor activity of the protein.
p53 protein suppresses only amplificational DNA replication.
The action of p53 and its mutants on different replication modes was
studied in human osteosarcoma cell line 143. The 143 cell line
expresses constitutively EBNA-1, the only viral protein necessary for
the replication of EBV latent oriP. These cells are also permissive for
the E1- and E2-dependent replication of the papillomavirus origin. In
contrast to papillomaviruses, which quickly amplify their genome after
viral entry into the cell, EBV oriP probably makes use of the cellular
control mechanisms that guarantee once-per-cell cycle replication
(65). We cotransfected the plasmids encoding p53 and HPV-11
E1 and E2 proteins together with the HPV-11 origin plasmid and EBV oriP
plasmid into the 143 cells and studied their replication by Southern
blot analysis. The replication assay conditions were adjusted so that
relative replication signals of oriP and HPV-11 origin had comparable
intensities on the same Southern blot. Once-per-cell cycle replication
of the oriP-containing plasmid was not suppressed by wt p53, while amplificational replication of the papillomavirus origin was abolished in the same cells (Fig. 3; compare lanes
1 and 2). The mutant p53 proteins affected papillomavirus replication
similarly in the 143 cells and CHO cells. Mutants N39 and C362,
which suppressed replication of the BPV-1 full-length origin in CHO4.15
cells, also blocked replication of the HPV-11 origin in the 143 cell line and at the same time had little effect on the replication of oriP
(lanes 3 and 5). Mutants C305 and 324-355 influenced the
replication of neither HPV-11 origin nor oriP (lanes 4 and 6).
View larger version (55K):
[in this window]
[in a new window]
|
FIG. 3.
Southern blot analysis of coreplication of oriP and
HPV-11 origin plasmids in human osteosarcoma 143 cells. p53 blocks
replication of the papillomavirus origin but not EBV oriP. Episomal DNA
was extracted at 48, 72, and 96 h posttransfection, digested with
BamHI and DpnI, and probed with radiolabeled
origin plasmid p7072-99. One microgram of oriP plasmid p994 and 250 ng
of HPV-11 origin plasmid p7072-99 together with HPV-11 E1 and E2
expression plasmids pMT-E1 and pMT-E2 (1 µg of each) were transfected
into the cells; 250 ng of wt or mutant p53 expression plasmid was added
as indicated (lanes 2 to 6). Other lanes: oriP and HPV-11 ori, 200 pg
of the marker plasmids linearized with BamHI; carrier,
negative control with carrier DNA only; 1, positive control with no
added p53.
|
|
p53 inhibits amplificational replication of the BPV-1 origin in
SAOS-2 cells.
Replication of the papillomavirus origin was tested
also in human osteosarcoma SAOS-2 cells that lack endogenous p53 and
pRB expression. The expression of exogenous wt p53 and several
transactivation-competent mutants in SAOS-2 cells is sufficient to lead
the cells to apoptosis (10, 68). To avoid these side
effects, we used p53 mutants deficient in transcription activation
activity. Cotransfection of the BPV-1 E1 and E2 expression plasmids
together with the replication origin and p53 expression plasmids into
SAOS-2 cells and subsequent analysis of the episomal DNA showed that
mutants N39 and N39C362 inhibited replication of the
papillomavirus origin in SAOS-2 cells (Fig.
4, lanes 3 and 4), while mutants Trp248,
N39C362 Trp248, and 324-355 (lanes 2, 5, and 6, respectively)
had no effect on replication. These data are similar to the results of
experiments with the cell lines CHO4.15 (using BPV-1 origin) and 143 (using HPV-11 origin) and suggest that the suppression of
papillomavirus replication is a direct intrinsic property of the
exogenously expressed p53 protein and is neither influenced by the
endogenous p53 nor achieved through the pRB-regulated pathways.
View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Southern blot analysis of the BPV-1 origin plasmid
pUCAlu in SAOS-2 cells (radiolabeled origin plasmid pUCAlu used as a
probe). p53 mutant proteins inhibit replication of the BPV-1 minimal
origin in SAOS-2 cells lacking endogenous p53 and pRB proteins. BPV-1
minimal origin plasmid pUCAlu (500 ng) together with BPV-1 E1 and E2
expression plasmids pCGEag and pCGE2 (1 µg of each) was transfected
into the cells; 500 ng of p53 mutant proteins was cotransfected as
indicated (lanes 2 to 6). Other lanes: M, 200 pg of the pUCAlu marker
linearized with PstI; carrier, control transfection with
carrier DNA only; 1, positive control with no p53 construct added.
|
|
p53 does not cause downregulation of expression of the E1 and E2
proteins.
The E1 and E2 proteins are absolutely necessary for
papillomavirus replication. The p53 protein has been shown to possess transcription repressor activity in certain cases. Therefore, the
inhibition of papillomavirus replication could, in principle, be
achieved by downregulation of the expression level or activity of these
proteins. We studied the expression level and activity of the BPV-1
replication proteins in CHO4.15 cells in the presence of the
overexpressed wt and mutant p53 proteins. E2 protein expression is
directed by the HSP70 promoter, and E1 protein expression is directed by the SR promoter in CHO4.15 cells (44). These
cells are very efficiently transfected by electroporation (about 70%, based on parallel -galactosidase expression vector pON260
transfections), and this fact served as a rationale for the
measurements described below. The transfected CHO4.15 cells were
studied for the expression level of the E2 protein by Western blot
analysis of the cell lysates. Transfection efficiencies were determined
in parallel in all experiments. Western blot analysis did not reveal
any reproducible effects of the expression of wt or mutant p53 proteins
on the steady-state level of the E2 protein in CHO4.15 cells (Fig.
5A). A possibility remained that p53
could modulate the activities of the E2 protein, for example, the
ability to bind DNA.
View larger version (48K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of p53 does not affect the level of E1 and E2
expression. A p53 expression construct (500 ng) was electroporated into
CHO4.15 cells. In panels B and C, lanes and columns 1 to 8 represent
transfections with different p53 mutants in the same order as in panel
A. carrier, control with carrier DNA only; CHO, mock-transfected CHO
cells (lacking both E1 and E2 expression). All analyses were performed
48 h posttransfection. (A) Western blot analysis of the E2 protein
levels in p53-transfected CHO4.15 cells, using a mixture of five
different E2-specific monoclonal antibodies (see Materials and
Methods). (B) Northern blot analysis of the endogenous E1 mRNA levels
in total RNA preparations from transfected CHO4.15 cells. CHO212, total
RNA from E1-expressing cell line CHO212. The same filter was probed
first with radiolabeled E1- and -actin-specific probes and then
reprobed with ribosomal protein S7-specific probe. Approximate lengths
for mRNAs are 700 bp for S7, 2.0 kb for -actin and 2.3 kb for E1.
(C) Quantitation of the E1 Northern blots and E2 gel shift assay with a
PhosphorImager. The E1 mRNA-specific signals in the total RNA
preparations were normalized to the -actin (open columns) and
ribosomal protein S7 (shaded columns) mRNA signals in the RNA samples.
Black columns represent the E2 gel shift data. The E2-specific signal
in the lysates of the mock-transfected cells and the normalized E1
mRNA-specific signal from carrier-transfected control cells were set at
1.0 in each experimental series. Each column represents the average of
two independent experiments.
|
|
We performed a DNA mobility shift assay of CHO4.15 cell lysates
transfected with p53 expression constructs. The lysates were
tested for
E2-specific DNA binding with the oligonucleotide corresponding
to
E2-binding site 9 of the BPV-1 genome (
34). To increase the
specificity of the assay, we supershifted the E2-DNA complex with
an
excess of the E2-specific monoclonal antibody 3F12. E2-specific
radioactive signals were measured with a PhosphorImager, and the
results were normalized to the total amount of protein in the
lysate,
as determined by the Bradford assay (
8). As in the
case of
measuring the steady-state level of the E2 protein, we
were unable to
detect any significant changes in the levels of
active E2 protein in
response to the expression of wt or mutant
p53 proteins in CHO4.15
cells (Fig.
5C).
The low expression level of the E1 protein in CHO4.15 cells made
it impossible to detect E1 by quantitative Western blot analysis
or
immunoprecipitation. Instead, we performed Northern blot analysis
and
analyzed the steady-state level of the E1 mRNA in response
to p53
expression (Fig.
5B). The transcription level of the E1
protein coding
sequence was determined relative to
-actin and
ribosomal protein S7
mRNA levels on the same blots (Fig.
5B and
C), and E1 mRNA-specific
hybridization signals were measured with
a PhosphorImager.
Quantitation of the E1 mRNA level normalized
to
-actin and S7 mRNA
levels showed no downregulation of the
E1 mRNA level in response to wt
and mutant p53 expression in CHO4.15
cells (Fig.
5C).
These data suggest that the effect of p53 on papillomavirus
amplificational replication is not caused by downregulation of
expression of the E1 or E2 proteins, although these experiments
do not
exclude the possibility that p53 interferes with E1 or
E2 (or both)
activities at some stage of initiation or elongation
of replication.
The inhibition of papillomavirus replication is not the consequence
of p53-induced cell cycle block or apoptosis.
p53 is a mediator of
cell cycle block and apoptotic cell death. To examine the possibility
that the suppression of papillomavirus amplification is an
indirect consequence of any (or both) of these effects, we analyzed the
p53-transfected CHO4.15 cells by flow cytometry. Overexpression of wt
p53 protein in CHO4.15 cells induced detectable apoptosis in the
culture, as shown by the appearance of the sub-G1
DNA-containing fraction in the cell cycle profile 48 h
posttransfection (Fig. 6A, panel 4). To
examine the possible connection between p53-induced apoptosis and the
suppression of replication, we made use of the ability of the Bcl2
protein to prevent the p53-induced apoptosis of cells (51).
Increasing amounts of the Bcl2 expression plasmid were transfected into
the cells. The expression of Bcl2 considerably reduced the amount of
cells in the sub-G1 DNA-containing fraction of the cells
transfected with wt p53 (compare panels 4, 5, and 6). The cells
transfected with p53 deletion mutant N39C362 as well as with the
same deletion mutant with the Arg248Trp point mutation had some small
sub-G1 fraction, probably induced by electroporation, which
was not influenced by the expression of Bcl2 in the cells (panels 7 to
12). The percentage of the apoptotic cells in these experiments was
measured also by the TUNEL assay (Table
1), which gave essentially the same result and showed that Bcl2 expression in CHO4.15 cells reduced considerably the number of the p53-induced apoptotic cells in the
culture. The distribution of CHO4.15 cells in
G1/G0, S, and G2/M stages of the
cell cycle was not influenced by the expression of Bcl2 or p53. We also
analyzed if the Bcl2 rescues the replication suppression induced by p53
or its mutants. Expression of Bcl2 in CHO4.15 cells did not influence
the replication of the BPV-1 origin itself, nor did it abrogate the
inhibitory effects of wt p53 and deletion mutant N39C362 on
replication of the origin (Fig. 6B, lanes 1 to 9). These data support
the conclusion that the effect of the p53 protein on papillomavirus
amplificational replication is not an indirect consequence of cell
cycle block or apoptotic cell death.
View larger version (51K):
[in this window]
[in a new window]
|
FIG. 6.
Suppression of BPV-1 amplificational replication by p53
proteins is not the consequence of the p53-induced apoptosis or cell
cycle block. (A) Flow cytometric analysis of the cell cycle
distribution and the sub-G1 DNA-containing apoptotic
fraction of the p53-transfected CHO4.15 cells. In this assay, 250 ng of
the p53 expression constructs without Bcl2 or together with 100 or 250 ng of the Bcl2 expression plasmid pcDBCL2 was transfected into the
CHO4.15 cells; 100 ng of BPV-1 full-length origin plasmid pNeoBgl40 was
used in each transfection. control, cells with no p53 expression
constructs added. Cells were fixed 48 h after transfection. The
percentage of apoptotic sub-G1 DNA-containing signals and
the calculated percentages of cells in G0/G1,
S, and G2/M phases (from total of 50,000 cells) are
indicated on the each graph. y axis, cell number;
x axis, DNA content. The sub-G1 DNA fraction was
not considered in the cell cycle calculations. Standard software
provided by the manufacturer (Odam-Brucker) was used for the cell cycle
calculations. (B) Southern blot analysis of the episomal DNA in the
cells cotransfected with p53, Bcl2, and the BPV-1 origin plasmid
pNeoBgl40. Episomal DNA was extracted at 72 and 96 h after
transfection, digested with HindIII and DpnI,
and probed with radiolabeled origin plasmid pUCAlu. Lanes: M, 200 pg of
the marker plasmid linearized with HindIII; 1 to 12, transfections 1 to 12 in panel A.
|
|
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Apoptotic fraction in total population of CHO4.15
cells transfected with p53 and Bcl2 constructs (as measured by
TUNEL assay)
|
|
| |
DISCUSSION |
p53 as a suppressor of papillomavirus amplificational replication:
possible implications for virus-cell interactions.
Amplificational
replication of papillomavirus DNA is initiated after entry of the viral
genome into the cell nucleus, which leads to a rapid increase in copy
number of the virus genome during S phase (20).
Papillomaviruses rely on cellular replication factors and enzymes
(40) and coordinate the initiation of replication by two
viral origin recognition and initiation proteins, E1 and E2 (11,
45, 56, 57, 64). The same viral proteins are used at the
following latent replication stage. The mechanism of switching from
amplificational to controlled-maintenance replication is unknown. Our
data show that amplificational replication of bovine and different
human papillomaviruses in the short-term replication assay can be
suppressed by the p53 protein in all cell lines studied. It seems not
to require any response elements in the origin of replication. It also
does not require any activities carried by the C-terminal regulatory
and N-terminal transactivation domains of the p53 protein, including
the ability to activate transcription. The DNA-binding domain of p53
has been shown to be the target for most of the missense mutations
which inactivate the tumor suppressor function of this protein in cells
(12). Incidentally, the very same mutations inactivated p53
in the replication system studied.
p53 has been shown to block the replication of SV40 by interacting with
large T antigen. The binding of SV40 large T antigen
by the p53 protein
downregulates the helicase function of the
T antigen (
52);
in addition, p53 competes with DNA polymerase
for the binding of
SV40 large T antigen at the initiation of
SV40 DNA synthesis
(
16). Mouse polyomavirus replication was
shown not to be
inhibited by the p53 protein (
22,
39) unless
additional (up
to 16) p53-specific RGC sites were included in
the plasmid
(
39). This shows that sensitivity of the viruses
within the
papovavirus family to the action of tumor suppressor
protein p53 is
variable and obviously reflects the differences
in the viral life
cycles and different strategies for the utilization
of cellular control
mechanisms by these viruses. Papillomaviruses
must infect basal
epithelial cells in order to establish productive
infection of basal
and suprabasal epithelial cells. Amplificational
replication of the
viral genome in these cells is essential for
the establishment of
infection. The oncoproteins encoded by the
E5, E6, and E7 open reading
frames of papillomaviruses are essential
for providing the cellular
environment for the replication of
viral DNA. However, amplificational
replication has to be controlled
in order to avoid overreplication and
unscheduled death of basal
or suprabasal cells, because the synthesis
of late genes and the
production of infectious particles takes place
only in the terminally
differentiated epithelial cells. It is tempting
to speculate that
the ability of p53 to block the papillomavirus
amplificational
replication characterized in the model system studied
is actually
used by the virus to control the productive infection of
basal
cells. The E6 proteins of the high-risk (
50) and
low-risk (
35)
HPVs have been shown to interact with p53;
however, only E6 from
the high-risk HPVs directs p53 to degradation
(
50). It can be
speculated that the binding of p53 by the E6
proteins of either
high-risk or low-risk human and animal viruses
reduces the replication
suppressor activity of p53. Other important
players in this regulatory
mechanism are the replication proteins E1
and E2, which determine
the efficiency of initiation of replication.
The expression level
of these proteins would certainly depend on the
copy number of
the viral genome, therefore providing the positive
feedback for
amplification. The papillomavirus replication proteins E1
and/or
E2 have been shown to repress the promoter which is closest to
the replication origin and directs E6 expression (
31,
38,
49,
58). Therefore, higher levels of the E1 and E2 proteins
would
reduce the level of E6, which in turn results in the higher
level of
the active p53 protein capable of suppressing replication.
These
interrelationships among p53, E6, E1, and/or E2 proteins
could provide
a regulatory loop which can be used by some papillomaviruses
to keep
viral genome amplification in optimal limits (Fig.
7).
The proposed regulatory loop could
further serve as one of the
mechanisms for the copy number control of
the replication of papillomavirus
genome during the latent infection of
the basal cells. However,
the mechanism may be different with different
papillomavirus types,
as, for example, attempts to find any interaction
between BPV-1
E6 and p53 have appeared to be unsuccessful. It is still
possible
that in this case some other step in the cellular control
pathways,
up- or downstream of p53 itself, may be neutralized by viral
regulatory
proteins.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 7.
A putative p53-controlled regulatory loop in the
amplificational replication step of the papillomavirus life cycle.
|
|
The putative mechanism of action of the p53 protein.
The p53
protein, in principle, could suppress papillomavirus DNA replication in
vivo by a number of different mechanisms, such as by arresting the cell
cycle, inducing apoptotic death of cells, downregulating the expression
or activity of the E1 and E2 proteins, or interfering with viral and
cellular replication proteins at the stages of initiation or elongation
of DNA replication.
The induction of apoptosis or cell cycle block is an unlikely mechanism
for the apparent suppression of replication by p53
or its mutants in
the cells studied, as shown by the measurement
of apoptosis and
distribution of cells in the cell cycle. In addition,
the efficient
rescue of CHO4.15 cells from the wt p53-induced
apoptosis by Bcl2
expression did not affect the suppression of
BPV-1 origin replication
in the same cells. Mutant
N39
C362 efficiently
blocked replication
of the papillomavirus origin in all of the
studied cells but was unable
to induce any detectable apoptosis.
Additional convincing data come
from the coreplication assay of
the EBV and HPV-11 origins, which show
that in the same cells
two origins have differing sensitivity to the
expression of p53
or its mutants. Replication of EBV oriP
(
65) and the papillomavirus
origin (
18) takes
places during the S phase of the cell cycle,
and intensive apoptotic
death of the cells or cell cycle block
should have also considerably
reduced the replication of EBV oriP.
Therefore, these experiments
exclude several indirect and obvious
explanations for the observed
suppression of papillomavirus amplificational
replication. It also
seems unlikely in the light of these data
that the replication block
could have been achieved through the
inactivation of general
replication factors such as RPA, PCNA,
and others by the expression of
p53 or its mutants, because those
factors are presumably used for the
replication of EBV oriP and
chromosomal DNA as well.
Another simple explanation is that the p53-induced suppression of
papillomavirus replication could have been achieved through
negatively
modulating the activity of essential viral replication
proteins
(similarly to the case of SV40 virus) or through downregulating
the
expression of these proteins. However, we could not detect
any
significant p53-induced drop of the expression level and DNA-binding
activity of the E2 protein and transcription level of E1 in CHO4.15
cells. Also, there are no data in the literature showing the
interaction
of the p53 protein with the E1 or E2 proteins of any
papillomaviruses
or demonstrating the modulation of activities of these
proteins
by p53. Therefore, the p53 protein has to act at later stages
of replication initiation process, i.e., loading of the replication
complex on the origin, unwinding of DNA, or elongation of the
replication fork.
Our findings are substantiated by the fact that the C-terminally
truncated form of the p53 protein (analogous to our mutant
C362) is
able to block nuclear DNA replication in vitro in the
transcription-free DNA replication extract from
Xenopus
laevis activated eggs (
13). As for the suppression of
amplificational
replication of papillomavirus origin in the somatic
cells, the
DNA-binding activity of p53 was needed for the block of
nuclear
DNA replication in the transcription-free
Xenopus
extracts. It
is possible that these two replication systems have
similar p53-sensitive
steps. Mapping of the p53 protein domains
necessary for the repression
of papillomavirus amplificational
replication demonstrated that
the intact DNA-binding core and
oligomerization domains are clearly
necessary. Several activities have
been mapped to the core domain,
including the sequence-specific
DNA-binding (
6,
43,
61),
ssDNA-binding (
4), and
3'-to-5' exonuclease (
41) activities
of the p53 protein. All
these activities, as well as the ability
to suppress papillomavirus
amplificational replication, are inactivated
by point mutations which
either abolish the direct contact of
the protein with DNA or induce
inactive conformation of the protein
(
12,
41). It is
unlikely that the sequence-specific double-stranded
DNA-binding
function of p53 could be responsible for the suppression
of
amplificational replication, while sequence-nonspecific ssDNA-binding
activity could be used by the p53 protein in this process.
Full-length p53 protein DNA-binding activity is regulated, sterically
or allosterically, by the C-terminal domain of the protein
(for a
review, see reference
25). In addition, the
C-terminal
domain binds to DNA bulges resulting from DNA
deletion/insertion
mismatches (
29) and also to the ends of
short ssDNA molecules
(
5), promoting the reannealing of
complementary strands (
9,
42). Deletion of the last 30 residues, which has previously
been shown to remove the above-mentioned
activities of the p53
protein, did not affect its ability to suppress
papillomavirus
amplification in our assays. However, it is possible
that both
the ssDNA-binding and reannealing functions of the C terminus
additionally contribute to the amplification suppressor activity
of p53
in the case of the full-length protein.
Core and oligomerization domains, though necessary, are not sufficient
for the replication suppressor activity. An additional
N-terminal
sequence that has been shown to contain two intriguing
determinants,
RPA-binding (residues 40 to 60) and proline-rich
(residues 61 to 90)
domains, is also needed. Deletion of any or
both of these domains
crippled the p53 protein in the replication
suppression assay. It is
highly likely that p53 coordinates its
replication suppressor activity
with other proteins bound on the
ssDNA, such as through the interaction
with RPA (
14). RPA facilitates
DNA unwinding and DNA
synthesis in the initiation and elongation
stages of DNA replication
(
63). The interaction of p53 with
RPA could be important in
two respects. First, ssDNA-bound RPA
could be the target for p53
action, and its interaction with p53
could sequester RPA from the
ssDNA; second, interaction between
RPA and p53 on the stabilized ssDNA
facilitates recognition of
the amplifying DNA by p53. Interaction of
p53 and RPA in solution
does not require an intact DNA-binding domain
(
1,
14,
30),
while it is needed for the suppression of
replication. This suggests
the possibility that p53-RPA interaction
takes place on the ssDNA.
Deletion mapping of p53 activity showed that
also the proline-rich
putative signalling domain in the N-terminal part
of the protein
is required for the suppression of papillomavirus
replication.
This domain contains several copies of the PXXP motif (P
represents
proline; X represents any amino acid), which constitute a
binding
site for the proteins with the SH3 domain (
59). It
has been
suggested that this domain plays a critical role in the
transmission
of transactivation-independent antiproliferative signals
and presumably
links p53 directly to the appropriate signal
transduction pathways
(
46,
59).
However, despite the findings provided here pointing to an attractive
putative mechanism, additional experimental data are
needed to
determine in detail the mechanism of action of p53 in
the suppression
of papillomavirus amplificational replication.
| |
ACKNOWLEDGMENTS |
D.L. and I.I. contributed equally to this work.
We thank Bill Sugden for providing human osteosarcoma cell line 143 and
EBV oriP plasmid; Bert Vogelstein for providing the Trp248 mutant of
p53 cDNA; Jo Milner and Thierry Soussi for p53 antibodies; Anne
Kalling, Jevgeni Popov, and Ilvi Rimm for excellent technical
assistance; and Alar Karis, Juhan Sedman, Tõnis Örd, Richard Villems, and Tanel Tenson for critical reading of the manuscript.
This study was supported by grants 2496, 2497, 2315, and 2316 from the
Estonian Science Foundation, grant HHMI 75195-541301 from the Howard
Hughes Medical Institute, and grants and CIPA930257, ERBCIPD 94002, and CIPA-CT94-0154 from the EU.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Virology, Institute of Molecular and Cell Biology,
Tartu University, 23 Riia St., Tartu EE2400, Estonia. Phone:
372-7-465047. Fax: 372-7-420286. E-mail: ustav{at}ebc.ee.
| |
REFERENCES |
| 1.
|
Abramova, N. A.,
J. Russell,
M. Botchan, and R. Li.
1997.
Interaction between replication protein A and p53 is disrupted after UV damage in a DNA repair-dependent manner.
Proc. Natl. Acad. Sci. USA
94:7186-7191[Abstract/Free Full Text].
|
| 2.
|
Abroi, A.,
R. Kurg, and M. Ustav.
1996.
Transcriptional and replicational activation functions in the bovine papillomavirus type 1 E2 protein are encoded by different structural determinants.
J. Virol.
70:6169-6179[Abstract].
|
| 3.
|
Annilo, T.,
M. Laan,
J. Stahl, and A. Metspalu.
1995.
The human ribosomal protein S7-encoding gene: isolation, structure and localization in 2p25.
Gene
165:297-302[Medline].
|
| 4.
|
Bakalkin, G.,
G. Selivanova,
T. Yakovleva,
E. Kiseleva,
E. Kashuba,
K. P. Magnusson,
L. Szekely,
G. Klein,
L. Terenius, and K. G. Wiman.
1995.
p53 binds single-stranded DNA ends through the C-terminal domain and internal DNA segments via the middle domain.
Nucleic Acids Res.
23:362-369[Abstract/Free Full Text].
|
| 5.
|
Bakalkin, G.,
T. Yakovleva,
G. Selivanova,
K. P. Magnusson,
L. Szekely,
E. Kiseleva,
G. Klein,
L. Terenius, and K. G. Wiman.
1994.
p53 binds single-stranded DNA ends and catalyzes DNA renaturation and strand transfer.
Proc. Natl. Acad. Sci. USA
91:413-417[Abstract/Free Full Text].
|
| 6.
|
Bargonetti, J.,
J. J. Manfredi,
X. Chen,
D. R. Marshak, and C. Prives.
1993.
A proteolytic fragment from the central region of p53 has marked sequence-specific DNA-binding activity when generated from wild-type but not from oncogenic mutant p53 protein.
Genes Dev.
12:2565-2574.
|
| 7.
|
Botchan, M. R.,
L. Berg,
J. Reynolds, and M. Lusky.
1986.
The bovine papillomavirus replicon, p. 53-67.
In
D. Evered, and S. Clark (ed.), Papillomaviruses. John Wiley & Sons, New York, N.Y.
|
| 8.
|
Bradford, M. M.
1976.
A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal. Biochem.
72:248-254[Medline].
|
| 9.
|
Brain, R., and J. R. Jenkins.
1994.
Human p53 directs DNA strand reassociation and is photolabelled by 8-azido ATP.
Oncogene
9:1775-1780[Medline].
|
| 10.
|
Chen, X.,
L. J. Ko,
L. Jayaraman, and C. Prives.
1996.
p53 levels, functional domains, and DNA damage determine the extent of the apoptotic response of tumor cells.
Genes Dev.
10:2438-2451[Abstract/Free Full Text].
|
| 11.
|
Chiang, C. M.,
M. Ustav,
A. Stenlund,
T. F. Ho,
T. R. Broker, and L. T. Chaw.
1992.
Viral E1 and E2 proteins support replication of homologous and heterologous papillomaviral origins.
Proc. Natl. Acad. Sci. USA
89:5799-5803[Abstract/Free Full Text].
|
| 12.
|
Cho, Y.,
S. Gorina,
P. D. Jeffrey, and N. P. Pavletich.
1994.
Crystal structure of a p53 tumor suppressor-DNA complex: understanding tumorigenic mutations.
Science
265:346-355[Abstract/Free Full Text].
|
| 13.
|
Cox, L. S.,
T. Hupp,
C. A. Midgley, and D. P. Lane.
1995.
A direct effect of activated human p53 on nuclear DNA replication.
EMBO J.
14:2099-2105[Medline].
|
| 13a.
|
Dean, P. N., and J. H. Jett.
1974.
Mathematical analysis of DNA distributions derived from flow microfluorometry.
J. Cell Biol.
60:523-527[Free Full Text].
|
| 14.
|
Dutta, A.,
S. M. Ruppert,
J. C. Aster, and E. Winchester.
1993.
Inhibition of DNA replication factor RPA by p53.
Nature
365:79-82[Medline].
|
| 15.
|
Dyson, N.,
P. M. Howley,
K. Münger, and E. Harlow.
1989.
The human papilloma virus-16 E7 oncoprotein is able to bind to the retinoblastoma gene product.
Science
243:934-937[Abstract/Free Full Text].
|
| 16.
|
Gannon, J. V., and D. P. Lane.
1987.
p53 and DNA polymerase alpha compete for binding to SV40 T antigen.
Nature
329:456-458[Medline].
|
| 17.
|
Gavrieli, Y.,
Y. Sherman, and S. A. Ben-Sasson.
1992.
Identification of programmed cell-death in situ via specific labeling of nuclear DNA fragmentation.
J. Cell Biol.
119:493-501[Abstract/Free Full Text].
|
| 18.
|
Gilbert, D. M., and S. N. Cohen.
1987.
Bovine papillomavirus plasmids replicate randomly in mouse fibroblasts throughout S-phase of the cell cycle.
Cell
50:59-68[Medline].
|
| 19.
|
Haupt, Y.,
R. Maya,
A. Kazaz, and M. Oren.
1997.
Mdm2 promotes the rapid degradation of p53.
Nature
387:296-299[Medline].
|
| 20.
|
Howley, P. M.
1996.
Papillomavirinae: the viruses and their replication, p. 2045-2076.
In
B. N. Fields, et al. (ed.), Virology, 2nd ed. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 21.
|
Hupp, T.,
D. Meek,
C. Midgley, and D. Lane.
1992.
Regulation of the specific DNA binding function of p53.
Cell
71:875-886[Medline].
|
| 22.
|
Kanda, T.,
K. Segawa,
N. Ohuchi,
S. Mori, and Y. Ito.
1994.
Stimulation of polyomavirus DNA replication by wild-type p53 through the DNA-binding site.
Mol. Cell. Biol.
14:2651-2663[Abstract/Free Full Text].
|
| 23.
|
Kastan, M. B.,
O. Onyekwere,
D. Sidransky,
B. Vogelstein, and R. W. Craig.
1991.
Participation of p53 protein in the cellular response to DNA damage.
Cancer Res.
51:6304-6311[Abstract/Free Full Text].
|
| 24.
|
Kirchmaier, A. L., and B. Sugden.
1995.
Plasmid maintenance of derivatives of oriP of Epstein-Barr virus.
J. Virol.
69:1280-1283[Abstract].
|
| 25.
|
Ko, L. J., and C. Prives.
1996.
p53: puzzle and paradigm.
Genes Dev.
10:1054-72[Free Full Text].
|
| 26.
|
Kubbutat, M.,
S. Jones, and K. Vousden.
1997.
Regulation of p53 stability by Mdm2.
Nature
387:299-303[Medline].
|
| 27.
|
Lane, D. P.
1992.
p53, guardian of the genome.
Nature
358:15-16[Medline].
|
| 28.
|
Lee, H.,
J. M. Larner, and J. L. Hamlin.
1997.
Cloning and characterization of Chinese hamster p53 cDNA.
Gene
184:177-183[Medline].
|
| 29.
|
Lee, S.,
B. Elenbaas,
A. Levine, and J. Griffith.
1995.
p53 and its 14 kDa C-terminal domain recognize primary DNA damage in the form of insertion/deletion mismatches.
Cell
81:1013-1020[Medline].
|
| 30.
|
Leiter, L. M.,
J. Chen,
T. Marathe,
M. Tanaka, and A. Dutta.
1996.
Loss of transactivation and transrepression function, and not RPA binding, alters growth suppression by p53.
Oncogene
12:2661-2668[Medline].
|
| 31.
|
Le Moal, M. A.,
M. Yaniv, and F. Thierry.
1994.
The bovine papillomavirus type 1 (BPV1) replication protein E1 modulates transcriptional activation by interacting with BPV1 E2.
J. Virol.
68:1085-1093[Abstract/Free Full Text].
|
| 32.
|
Levine, A. J.
1997.
P53, the cellular gatekeeper for growth and division.
Cell
88:323-331[Medline].
|
| 33.
|
Li, R., and M. R. Botchan.
1993.
The acidic transcriptional activation domains of VP16 and p53 bind the cellular replication protein A and stimulate in vitro BPV-1 DNA replication.
Cell
73:1207-1221[Medline].
|
| 34.
|
Li, R.,
J. D. Knight,
G. Bream,
A. Stenlund, and M. R. Botchan.
1989.
Specific recognition nucleotides and their DNA context determine the affinity of E2 protein for 17 binding sites in the BPV-1 genome.
Genes Dev.
3:510-526[Abstract/Free Full Text].
|
| 35.
|
Li, X., and P. Coffino.
1996.
High-risk human papillomavirus E6 protein has two distinct binding sites within p53, of which only one determines degradation.
J. Virol.
70:4509-4516[Abstract].
|
| 36.
|
Livingstone, L. R.,
A. White,
J. Sprouse,
E. Livanos,
T. Jacks, and T. D. Tlsty.
1992.
Altered cell-cycle arrest and gene amplification potential accompany loss of wild-type p53.
Cell
70:923-935[Medline].
|
| 37.
|
Mah, S. P.,
L. T. Zhong,
Y. Liu,
A. Roghani,
R. H. Edwards, and D. E. Bredesen.
1993.
The protooncogene bcl-2 inhibits apoptosis in PC12 cells.
J. Neurochem.
60:1183-1186[Medline].
|
| 38.
|
McBride, A. A.,
H. Romanczuk, and P. M. Howley.
1991.
The papillomavirus E2 regulatory proteins.
J. Biol. Chem.
266:18411-18414[Free Full Text].
|
| 39.
|
Miller, S. D.,
G. Farmer, and C. Prives.
1995.
p53 inhibits DNA replication in vitro in a DNA-binding-dependent manner.
Mol. Cell. Biol.
15:6554-6560[Abstract].
|
| 40.
|
Müller, F.,
Y.-S. Seo, and J. Hurwitz.
1994.
Replication of bovine papillomavirus type 1 origin-containing DNA in crude extracts and with purified proteins.
J. Biol. Chem.
269:17086-17094[Abstract/Free Full Text].
|
| 41.
|
Mummenbrauer, T.,
F. Janus,
B. Müller,
L. Wiesmüller,
W. Deppert, and F. Grosse.
1996.
P53 protein exhibits 3'-to-5' exonuclease activity.
Cell
85:1089-1099[Medline].
|
| 42.
|
Oberosler, P.,
P. Hloch,
U. Ramsperger, and H. Stahl.
1993.
p53-catalyzed annealing of complementary single-stranded nucleic acids.
EMBO J.
12:2389-2396[Medline].
|
| 43.
|
Pavletich, N. P.,
K. A. Chambers, and C. D. Pabo.
1993.
The DNA-binding domain of p53 contains the four conserved regions and the major mutation hot spots.
Genes Dev.
12:2556-2564.
|
| 44.
|
Piirsoo, M.,
E. Ustav,
T. Mandel,
A. Stenlund, and M. Ustav.
1996.
Cis and trans requirements for stable episomal maintenance of the BPV-1 replicator.
EMBO J.
15:1-11[Medline].
|
| 45.
|
Remm, M.,
R. Brain, and J. R. Jenkins.
1992.
The E2 binding sites determine the efficiency of replication for the origin of human papillomavirus type 18.
Nucleic Acids Res.
20:6015-6021[Abstract/Free Full Text].
|
| 46.
|
Ruaro, E. M.,
L. Collavin,
G. Del Sal,
R. Haffner,
M. Oren,
A. J. Levine, and C. Schneider.
1997.
A proline-rich motif in p53 is required for transactivation-independent growth arrest as induced by Gas1.
Proc. Natl. Acad. Sci. USA
94:4675-4680[Abstract/Free Full Text].
|
| 47.
|
Sakurai, T.,
M. Suzuki,
T. Sawazaki,
S. Ishii, and S. Yoshida.
1994.
Anti-oncogene product p53 binds DNA helicase.
Exp. Cell Res.
215:57-62[Medline].
|
| 48.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 49.
|
Sandler, A. B.,
S. B. Vande Pol, and B. A. Spalholz.
1993.
Repression of bovine papillomavirus type 1 transcription by the E1 replication protein.
J. Virol.
67:5079-5087[Abstract/Free Full Text].
|
| 50.
|
Scheffner, M.,
B. A. Werness,
J. M. Huibregtse,
A. J. Levine, and P. M. Howley.
1990.
The E6 oncoprotein encoded by human papillomavirus types 16 and 18 promotes the degradation of p53.
Cell
63:1129-1136[Medline].
|
| 51.
|
Strasser, A.,
A. W. Harris,
T. Jacks, and S. Cory.
1994.
DNA damage can induce apoptosis in proliferating lymphoid cells via p53-independent mechanisms inhibitable by Bcl-2.
Cell
79:329-339[Medline].
|
| 52.
|
Stürzbecher, H.-W.,
R. Brain,
T. Maimets,
C. Addison,
K. Rudge, and J. R. Jenkins.
1988.
Mouse p53 blocks SV40 DNA replication in vitro and downregulates T antigen DNA helicase activity.
Oncogene
3:405-413[Medline].
|
| 53.
|
Stürzbecher, H.-W.,
B. Donzelmann,
W. Henning,
U. Knippschild, and S. Buchhop.
1996.
P53 is linked directly to homologous recombination processes via RAD51/RecA protein interaction.
EMBO J.
15:1992-2002[Medline].
|
| 54.
|
Tanaka, M., and W. Herr.
1990.
Differential transcriptional activation by Oct-1 and Oct-2: interdependent activation domains induce Oct-2 phosphorylation.
Cell
60:375-386[Medline].
|
| 55.
|
Ustav, E.,
M. Ustav,
P. Szymanski, and A. Stenlund.
1993.
The bovine papillomavirus origin of replication requires a binding site for the E2 transcriptional activator.
Proc. Natl. Acad. Sci. USA
90:898-902[Abstract/Free Full Text].
|
| 56.
|
Ustav, M., and A. Stenlund.
1991.
Transient replication of BPV-1 requires two viral polypeptides encoded by the E1 and E2 open reading frames.
EMBO J.
10:449-457[Medline].
|
| 57.
|
Ustav, M.,
E. Ustav,
P. Szymanski, and A. Stenlund.
1991.
Identification of the origin of replication of bovine papillomavirus and characterization of the viral origin recognition factor E1.
EMBO J.
10:4321-4329[Medline].
|
| 58.
|
Vande Pol, S. B., and P. M. Howley.
1994.
Negative regulation of the bovine papillomavirus E5, E6, and E7 oncogenes by the viral E1 and E2 genes.
J. Virol.
69:395-402[Abstract].
|
| 59.
|
Walker, K. K., and A. J. Levine.
1996.
Identification of a novel p53 functional domain that is necessary for efficient growth suppression.
Proc. Natl. Acad. Sci. USA
93:15335-15340[Abstract/Free Full Text].
|
| 60.
|
Wang, E. H.,
P. N. Friedman, and C. Prives.
1989.
The murine p53 protein blocks replication of SV40 DNA in vitro by inhibiting the initiation functions of SV40 large T antigen.
Cell
57:379-392[Medline].
|
| 61.
|
Wang, Y.,
M. Reed,
P. Wang,
J. E. Stenger,
G. Mayr,
M. E. Anderson,
J. F. Schwedes, and P. Tegtmeyer.
1993.
p53 domains: identification and characterization of two autonomous DNA-binding regions.
Genes Dev.
7:2575-2586[Abstract/Free Full Text].
|
| 62.
|
Wilcock, D., and D. P. Lane.
1991.
Localization of p53, retinoblastoma and host replication proteins at sites of viral replication in herpes-infected cells.
Nature
349:429-431[Medline].
|
| 63.
|
Wold, M. S.
1997.
Replication protein A: a heterotrimeric, single-stranded DNA-binding protein required for eukaryotic DNA metabolism.
Annu. Rev. Bichem.
66:61-91[Medline].
|
| 64.
|
Yang, L.,
R. Li,
I. J. Mohr,
R. Clark, and M. R. Botchan.
1991.
Activation of BPV-1 replication in vitro by the transcription factor E2.
Nature
353:628-632[Medline].
|
| 65.
|
Yates, J. L., and N. Guan.
1991.
Epstein-Barr virus-derived plasmids replicate only once per cell cycle and are not amplified after entry into cells.
J. Virol.
65:483-488[Abstract/Free Full Text].
|
| 66.
|
Yates, J. L.,
N. Warren, and B. Sugden.
1985.
Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells.
Nature
313:812-815[Medline].
|
| 67.
|
Yin, Y.,
M. A. Tainsky,
F. Z. Bischoff,
L. C. Strong, and G. M. Wahl.
1992.
Wild-type p53 restores cell cycle control and inhibits gene amplification in cells with mutant p53 alleles.
Cell
70:937-948[Medline].
|
| 68.
|
Yonish-Rouach, E.,
V. Deguin,
T. Zaitchouk,
C. Breugnot,
Z. Mishal,
J. R. Jenkins, and E. May.
1996.
Transcriptional activation plays a role in the induction of apoptosis by transiently transfected wild-type p53.
Oncogene
12:2197-2205.
|
J Virol, August 1998, p. 6822-6831, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, H.-K., Duffy, A. A., Broker, T. R., Chow, L. T.
(2009). Robust production and passaging of infectious HPV in squamous epithelium of primary human keratinocytes. Genes Dev.
23: 181-194
[Abstract]
[Full Text]
-
Chang, S.-S., Lo, Y.-C., Chua, H.-H., Chiu, H.-Y., Tsai, S.-C., Chen, J.-Y., Lo, K.-W., Tsai, C.-H.
(2008). Critical Role of p53 in Histone Deacetylase Inhibitor-Induced Epstein-Barr Virus Zta Expression. J. Virol.
82: 7745-7751
[Abstract]
[Full Text]
-
Zhou, J., Prives, C.
(2003). Replication of damaged DNA in vitro is blocked by p53. Nucleic Acids Res
31: 3881-3892
[Abstract]
[Full Text]
-
Mannik, A., Runkorg, K., Jaanson, N., Ustav, M., Ustav, E.
(2002). Induction of the Bovine Papillomavirus Origin "Onion Skin"-Type DNA Replication at High E1 Protein Concentrations In Vivo. J. Virol.
76: 5835-5845
[Abstract]
[Full Text]
-
Courcelle, J., Hanawalt, P. C.
(2001). Participation of recombination proteins in rescue of arrested replication forks in UV-irradiated Escherichia coli need not involve recombination. Proc. Natl. Acad. Sci. USA
98: 8196-8202
[Abstract]
[Full Text]
-
Lepik, D., Ustav, M.
(2000). Cell-Specific Modulation of Papovavirus Replication by Tumor Suppressor Protein p53. J. Virol.
74: 4688-4697
[Abstract]
[Full Text]
Top
Abstract
Introduction
