Previous Article | Next Article 
J Virol, August 1998, p. 6785-6795, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Naturally Occurring Mutations Define a Novel
Function of the Hepatitis B Virus Core Promoter in Core Protein
Expression
Thomas F.
Baumert,
Aldo
Marrone,
John
Vergalla, and
T. Jake
Liang*
Liver Diseases Section, National Institute of
Diabetes and Digestive and Kidney Diseases, National Institutes of
Health, Bethesda, Maryland 20892
Received 20 February 1998/Accepted 6 May 1998
 |
ABSTRACT |
Functional analysis of naturally occurring hepatitis B virus (HBV)
mutations is crucial in understanding their impact on disease. We have
recently identified two mutations in the HBV core promoter of an HBV
strain associated with fulminant hepatitis leading to highly (15-fold)
enhanced replication as a result of increased viral encapsidation of
pregenomic RNA into the core particles (T. F. Baumert et al.,
J. Clin. Invest. 98:2268-2276, 1996). Functional studies in an
encapsidation assay had demonstrated that the increase in encapsidation
was largely independent of pregenomic RNA transcription. In this study,
we define the molecular mechanism whereby the two core promoter
mutations (C to T at nucleotide [nt] 1768 and T to A at nt 1770)
result in enhanced viral encapsidation and replication. The effect of
these mutations leading to increased encapsidation is mediated through
enhanced core protein synthesis (15-fold) by the mutant virus. The
marked increase in core protein synthesis is largely a result of
posttranscriptional or translational effect of the mutations because
the mutations resulted in only a twofold increase in pregenomic RNA
transcription. In addition, this effect appears to be selective for
core expression since reverse transcriptase-polymerase expression was
increased only twofold. trans-complementation analyses of
HBV replication demonstrated that enhanced replication occurred only
when the mutations were provided together with the core protein in
trans, confirming the functional association of the core
promoter mutations and core protein expression. In addition, the effect of the mutations appears to be quantitatively dependent on the strain
background to which the mutations were introduced. Our study suggests
that the HBV core promoter regulates core protein expression at both
transcriptional and posttranscriptional levels.
 |
INTRODUCTION |
Hepatitis B virus (HBV) is a
partially double stranded DNA virus that replicates through an RNA
intermediate (for reviews, see references 8 and
39). The virally encoded reverse transcriptase polymerase (RT-Pol) is essential for this unique form of genome replication. Viral replication occurs exclusively in the core particle,
which is assembled through complex interactions among pregenomic RNA,
core protein, and polymerase. A well-defined cis-acting element in the pregenomic RNA (encapsidation signal
) has been shown
to mediate the interaction of pregenomic RNA with the encapsidation complex (14, 27, 29, 30). The capsid containing the
replicative intermediate is then enveloped by HBV surface antigens
(HBsAg) in a lipid bilayer. Although the molecular mechanism of HBV
encapsidation and replication has been largely elucidated with the
identification of various essential elements (11, 14, 27, 30, 37,
41), it is not clear whether any other sequences outside these
elements may play a role in the replicative process. The core promoter contains multiple cis-acting elements with nuclear receptor
binding sites (32) and regulates the transcription of 3.5-kb
RNAs with heterogeneous 5' ends (42, 44). There are two
3.5-kb RNA species, the precore and core RNAs, which direct the
translation of HBV e and core antigens, respectively. The core RNA also
functions as the pregenomic RNA.
We have recently identified two mutations in the core promoter of a
viral strain associated with a fatal outbreak of fulminant hepatitis B
(FH strain) (10, 19) resulting in markedly enhanced viral
replication (2). These mutations comprised a C-to-T change at nucleotide (nt) 1768 as well as a T-to-A change at nt 1770 (MT5/6)
in the HBV basal core promoter (nucleotide numbering according to
reference 32). Functional characterization of these
mutations in a tissue culture model had demonstrated that the phenotype of enhanced replication was the result of enhanced viral encapsidation of pregenomic RNA into HBV nucleocapsids (2). The core
promoter mutations resulted in only minor changes of transcription of
pregenomic RNA and precore RNAs (2). In contrast,
encapsidation of pregenomic RNA into HBV core particles was increased
15-fold in the mutant strain compared to the wild-type strain
(2). Although the identified core promoter mutations
resulted in two amino acid changes of the overlapping HBX open reading
frame (ORF), the mutated HBX protein was not responsible for the
phenotype of enhanced encapsidation and replication (2). The
aim of this study was to identify the molecular mechanism of enhanced
encapsidation and replication induced by these mutations. The
identification of this mechanism may have important implications in
understanding the viral life cycle as well as in the pathogenesis of
fulminant hepatitis associated with these mutations.
 |
MATERIALS AND METHODS |
Constructs.
Replication-competent constructs of wild-type
adw (adwR9) and ayw (aywR9) and MT5/6 (MT5/6R9) mutant strains were
described previously (2). These constructs contained a 1.2×
genomic length of HBV. To generate a construct that is deficient in
encapsidating pregenomic RNA, the HBV encapsidation signal was altered
by introducing a single nucleotide change (G to A at nt 1882 without
affecting the precore ORF) into the stem-loop (loop 3) of the
pregenomic RNA encapsidation signal (29). The following
primers were used to generate mutant HBV DNA by PCR mutagenesis
(underlined nucleotides represent introduced mutations) (1):
5' AAGCCTCCAAGCTATGCCTTGGGTGG 3' (sense, nt 1868 to 1894) and 5' CGAGGGAGTTCTTCTTCTAG 3' (antisense outer
primer, nt 2359 to 2339) as well as 5' TCTCGGGGCCGCTTGGGGACTCTC (sense outer primer, nt 1464 to 1486) and 5'
ACCCAAGGCATAGCTTGGAGGC 3' (antisense, nt 1892 to
1870). The PCR products were combined, reannealed, and amplified by a
second PCR using the above-described outer primers. After subcloning of
the PCR-generated fragments into PCR II vector (Invitrogen, San Diego,
Calif.), an RsrII-BglII fragment (HBV nt 1525 to
1986) was subcloned into the replication-competent construct adwR9. To
inactivate the core gene, a frameshift mutation was introduced into the
core gene at nt 1986 by digesting adwR9 DNA with BglII,
treatment with Klenow enzyme, and subsequent religation. To inactivate
the polymerase gene, a BspEI-EcoRI (nt 2355 to
3200) fragment of wild-type adwR9 was replaced with the same fragment of HBV strain HBV5-15 (3). HBV 5-15 contains a naturally
occurring missense mutation (A to C at nt 2798) in the polymerase gene
terminating HBV replication. All constructs were analyzed structurally
by sequencing and restriction digestion as well as functionally by demonstrating their inability to replicate in HuH-7 cells (Fig. 1B).
The Altered Sites in vitro system (Promega, Madison, Wis.) was used to
introduce HBV core promoter mutations and to eliminate the precore ORF.
Various nucleotide changes (Table 1) at
positions 1764, 1766, 1768, and 1770 were generated by using
oligonucleotide 5'
AGGTTAANGNTNTNTGTATTAGGAG
3' (sense, nt 1757 to 1781). Wild-type HBV adw DNA was used as
the template for mutagenesis (plasmid pSelectHBVadw [2,
10]). The replication-competent mutant constructs were
generated by subcloning an RsrII-BglII fragment (nt 1525 to 1986) of pSelectHBVMutant into adwR9. To eliminate the
precore protein expression in the replication-competent R9 constructs,
the precore protein start codon at nt 1816 was mutated to GTG in
pSelectHBV, using the primer 5'
CACCAGCACCGTGCAACTTTTTCACC 3' (sense, nt 1802 to
1827) to generate the pre-C
. The replication-competent
constructs adwR9preC
and MT5/6preC
were
constructed by ligating the FspI-BspEI fragment
(nt 1802 to 2329) of pSelectHBVpreC
into adwR9 or
MT5/6R9. Replication-competent aywR9 constructs containing MT5/6 (C to
T at nt 1768 and A to T at nt 1770) and a stop codon in the precore ORF
(G to A at nt 1896) were generated by PCR mutagenesis (QuickChange
site-directed mutagenesis kit; Stratagene, La Jolla, Calif.), using
mutant sense and antisense primers and HBV ayw cDNA (a generous gift
from H. Schaller, University of Heidelberg, Heidelberg, Germany) as a
template. To generate MT5/6 in HBV ayw (nt 1768 and 1770), we used
primers 5'
GGAGGAGATTAGGTTAAAGGTTTATGTACTAGGAGG 3'
(sense, nt 1747 to 1782) and 5'
CCTCCTAGTACATAAACCTTTAACCTAATCTCCTCC 3'
(antisense, nt 1782 to 1747). To generate a precore stop codon mutation at nt 1896 in HBV ayw, the primers used were 5'
GGGTGGCTTTAGGGCATGGACATCG 3' (sense, nt 1886 to 1910)
and 5' CGATGTCCATGCCCTAAAGCCACCC 3' (antisense,
nt 1910 to 1886). Subsequently, an RsrII-BglII
fragment (HBV nt 1525 to 1986) of the PCR product containing either
MT5/6 or the precore stop codon mutation was subcloned into the
replication-competent aywR9 construct. All mutant constructs were
sequenced to confirm the correct mutations and ensure absence of other
mutations that could have been introduced during mutagenesis. Core
expression constructs were generated by subcloning the
ScaI-RsrII fragment (containing HBV nt 963 to
1526) of pGEM7HBXadw (2) and the RsrII-ApaI fragment (containing HBV nt 1526 to
2604) of wild-type or mutant (MT5/6) adwR9 (2) into the
ScaI and ApaI sites of a modified pGEM7 plasmid
(Promega) containing the simian virus 40 tIVS and poly(A) (subcloned as
a HindIII-AflIII fragment from pSV-SPORT1
[Gibco, Gaithersburg, Md.]) at the 3' end of its multiple cloning
site. To analyze polymerase expression, the
-galactosidase gene
(lacZ) was fused in frame with the polymerase at a
BglII site (HBV nt 2403) 99 nt after its start codon. The
BamHI fragment of pBSLacZ (24) containing the
lacZ gene with its 3' end blunt ended was subcloned into the
BglII (nt 2403; 5' end) and HpaI (nt 963; 3' end)
sites of the replication-competent constructs adwR9 and MT5/6R9 to
generate constructs padwpolLacZ and pMT5/6polLacZ. Correct orientation
of the inserted fragment was analyzed by restriction digestion and
sequencing of the RT-Pol-LacZ junction. The control LacZ expression
construct pCDLacZ was constructed by ligating a lacZ-cDNA
fragment into the mammalian expression vector pcDNA1 (Invitrogen,
Carlsbad, Calif.).
Tissue culture and transfection.
Human hepatoma HuH-7 cells
were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco)
plus 10% fetal bovine serum (Sigma, St. Louis, Mo.) at 37°C and 5%
CO2. HuH-7 were grown to 70% confluence and transfected
with DNA by a CaPO4 transfection kit (Calcium Phosphate
Mammalian Cell Transfection kit; 5 Prime-3 Prime Inc., Boulder, Colo.).
For analysis of transfection efficiency in all experiments, plasmid
pTKGH containing the human growth hormone gene (driven by the thymidine
kinase enhancer and promoter) was cotransfected with various HBV
constructs. Typically, 15 µg of HBV construct was cotransfected with
1 µg of plasmid pTKGH (Nichols Institute Diagnostics, San Juan
Capistrano, Calif.) into HuH-7 cells grown in 10-cm-diameter dishes.
From each transfection experiment, medium was harvested and human
growth hormone was measured with a radioimmunoassay from Nichols
Institute Diagnostics.
Analysis of viral nucleic acids and HBsAg and HBeAg
expression.
Three or four days after transfection, HuH-7 cells
were harvested for viral RNA and DNA analysis. RNA was prepared by the guanidium isothiocyanate-acid-phenol method (1), analyzed by formaldehyde agarose gel electrophoresis (10 µg of RNA), and
hybridized with an HBV-specific probe as described recently (2,
13). For primer extension analysis, an HBV primer (5'
TCTAAGGCTTCTCGATACAGAGCTG 3') spanning nt 2006 to 2030 in the
antisense orientation was end labeled with [
-32P]ATP
and then reacted with guanidium isothiocyanate-acid-phenol-purified HBV
RNA by a standard protocol (1). Primer extension products were separated on a 8% polyacrylamide-urea gel and subjected to autoradiography (2). Viral replicative DNA intermediates
associated with intracellular core particles were isolated by
ultracentrifugation of cell lysate through a 30% sucrose cushion and
then analyzed by Southern blot hybridization (2, 10). HBsAg
and HBV e antigen (HBeAg) synthesis was analyzed in the culture medium
of transfected HuH-7 cells by using commercially available
radioimmunoassays (for HBsAg, Ausria II from Abbott, North Chicago,
Ill.; for HBeAg, EBK from Sorin Biomedica, Saluggia, Italy).
Analysis of core expression and nucleocapsid assembly.
Three
days after transfection of HuH-7 cells with replication-competent or
core expression HBV constructs, the cells were lysed with lysis buffer
containing 1% Nonidet P-40, 50 mM Tris (pH 7.4), 50 mM NaCl, 5 mM
EDTA, 1 mM phenylmethylsulfonyl fluoride, 2 µg of aprotinin per ml,
and 2 µg of leupeptin per ml. The cell lysate was cleared of cell
debris and nuclei by low-speed centrifugation (15 min at 20,000 × g and 4°C). For immunoblotting, a fraction of the
supernatant was subjected to sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (PAGE) (15% gel). After gel
transfer to polyvinylidene difluoride membranes (Immobilon P; Millipore
Corp., Bedford, Mass.), the blots were probed with anticore (dilution
of 1:1,000) antibody (polyclonal rabbit antibody; generously provided
by J. Ou, University of Southern California, Los Angeles) followed by
horseradish peroxidase-conjugated anti-rabbit immunoglobulin G (IgG)
antibody (dilution of 1:4,000; Amersham Corp., Arlington Heights, Ill.)
and subsequent chemiluminescence detection (ECL kit; Amersham). The
analysis of core expression was reproduced by using a commercially
available anticore antibody (DAKO Corp., Carpinteria, Calif.). To
control for differences in sample processing and gel loading, the blot
was reprobed with antiactin antibody (dilution of 1:2,000; Sigma) and
analyzed as described above. For metabolic labeling of the core
protein, HuH-7 cells (day 3 posttransfection) were starved for 2 h
in methionine- and cysteine-free DMEM and then labeled for 15 min with
250 µCi of [35S]methionine and -cysteine (NEN Express
labeling mix; New England Nuclear, Boston, Mass.). The cells were then
washed with phosphate-buffered saline and lysed with a lysis buffer
containing 1% sodium deoxycholate, 0.1% SDS, 1% Triton X-100, 10 mM
Tris (pH 8.0), 140 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 2 µg
of aprotinin per ml, and 2 µg of leupeptin per ml. The cell lysate
was cleared of cell debris and nuclei by low-speed centrifugation (15 min at 20,000 × g and 4°C). Then 500 µl of the
cleared supernatant was incubated with 1 µl of anticore antibody for
16 h at 4°C, followed by incubation with 50 µl of protein
A-Sepharose 4B-CL beads (Pharmacia Biotech Inc., San Francisco, Calif.)
for 1 h at room temperature with mixing. The beads were washed
repeatedly, and the bound proteins were released and denatured by
heating for 5 min at 95°C in SDS sample buffer. The
immunoprecipitated proteins were subjected to electrophoresis on a 15%
polyacrylamide gel. After gel drying, the immunoprecipitated proteins
were analyzed by a phosphor imager (STORM; Molecular Dynamics,
Sunnyvale, Calif.) and quantified by using the ImageQuant program
(Molecular Dynamics). For analysis of nucleocapsid assembly lysates of
35S-labeled, transfected HuH-7 cells (labeling conditions,
1,000 µCi of [35S]methionine and -cysteine in DMEM
containing unlabeled methionine and cysteine at 5% of the standard
concentration; labeling time, 16 to 24 h) were lysed and subjected
to sucrose gradient centrifugation (10 to 60% sucrose step gradient)
as described previously (45). In brief, 700-µl aliquots of
lysates were layered onto a 10 to 60% sucrose step gradient (700-µl
steps of 10, 20, 30, 40, 50, and 60% sucrose in 50 mM Tris-100 mM
NaCl [wt/wt], pH 7.4). After ultracentrifugation (SW55 rotor for 2:30
h at 40,000 rpm and 4°C), 10 fractions were collected from the top
and the core protein was immunoprecipitated (45) from the
sucrose fractions, using an anticore specific antibody (DAKO) and
protein A-Sepharose 4B-CL beads. After extensive washing of the beads,
the bound proteins were released and denatured by heating for 5 min at
95°C in SDS sample buffer. The immunoprecipitated core protein was
then analyzed by SDS-PAGE and autoradiography.
Analysis of LacZ and polymerase-LacZ (Pol-LacZ) fusion
protein expression.
Three days after transfection of
HuH-7 cells with constructs pCDLacZ, padwpolLacZ, and
pMT5/6polLacZ, the cells were lysed as described above. The lysate was
subjected to SDS-PAGE (10% gel) and immunoblotting with a mouse
monoclonal anti-
-galactosidase antibody (dilution of 1:1,000;
Boehringer Mannheim, Indianapolis, Ind.) as described above.
 |
RESULTS |
Core promoter mutations result in enhanced replication when
provided with the core ORF in trans.
To map the HBV genetic
element mediating MT5/6-induced enhanced encapsidation, we
systematically analyzed the HBV elements known to be required for
encapsidation (encapsidation signal
, core, and polymerase protein)
and developed a trans-complementation assay as shown in Fig.
1A. Since the mutant constructs lacked one or more of the required elements for encapsidation, they did not
exhibit viral encapsidation or replication when transfected individually (Fig. 1B). However, when a pregenomic
RNA-generating construct (1, 2, or 3) was cotransfected with a core- or
polymerase-expressing construct (4, 5, or 6), viral encapsidation
and replication were restored by complementation in
trans (Fig. 1C). By providing MT5/6 together with
the various elements required for encapsidation, we were able to
functionally map the HBV element affected by MT5/6.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 1.
Mapping of the HBV genetic element targeted by MT5/6 to
induce enhanced replication in a trans-complementation
assay. (A) Constructs. For trans-complementation analysis, a
construct generating pregenomic RNA (1, 2, or 3) was cotransfected with
a trans-complementing protein expression construct (4, 5, or
6). CP, core promoter; c, core; p, polymerase; , RNA encapsidation
signal; WT, wild type; MT, mutant. (B) Lack of replication of
individual trans-complementation constructs. HuH-7 cells
were transfected with replication-competent constructs adwR9 and
MT5/6R9 or one of the knockout construct 1 to 6 (A). Four days
posttransfection, viral replicative intermediates were analyzed by
Southern blotting of core particle-associated viral DNA. SS,
single-stranded DNA. (C) trans-complementation analysis. A
pregenomic RNA-generating construct (1, 2, or 3 [A]) was
cotransfected with a protein expression construct (4, 5, or 6 [A])
into HuH-7 cells. MT5/6 was provided either in cis in the
RNA-generating construct (lane 2) or in trans together with
core and/or polymerase ORF (lanes 4, 6, and 8). Four days
posttransfection, replication was analyzed as described above.
Transfection efficiencies as monitored by pTKGH cotransfection were
similar among all samples. SS, single-stranded DNA.
|
|
When MT5/6 was provided in cis, modifying the transcription
of pregenomic RNA (construct 1), replication was not affected to
any major extent (Fig. 1C, lane 2 compared to lane 1),
indicating that the phenotype of enhanced replication was largely
independent of an effect of MT5/6 on the level of pregenomic RNA
transcription. In contrast, MT5/6, when provided together with the core
and polymerase proteins (construct 4) in trans, induced the
phenotype of enhanced replication (Fig. 1C, lane 4 compared to lane 3).
This experiment confirms our previous results of an encapsidation assay
in which MT5/6 exerted a major transcription-independent effect on
encapsidation when provided in trans (2). The
next experiment was designed to discern the effect of MT5/6 on either
the core or polymerase protein. Therefore, MT5/6 was provided in
trans with either the core or the polymerase protein (Fig.
1A, construct 5 or 6). Analysis of viral replication demonstrated that
MT5/6 was able to induce enhanced replication when provided together
with core in trans (Fig. 1C, lane 6) but not when provided
together with the polymerase (Fig. 1C, lane 8). These data suggest that
MT5/6 exerts on core protein a functional effect resulting in enhanced
viral encapsidation and replication.
Core promoter mutations led to enhanced core expression as a result
of increased synthesis.
To analyze the effect of MT5/6 on core
protein expression directly, wild-type and mutant replication-competent
constructs were transfected into HuH-7 cells and the steady-state level
of core protein expression was analyzed by immunoblotting of
transfected cell lysates. MT5/6 led to a 15-fold increase in core
protein expression compared to the wild type (Fig.
2A, lanes 2 and 3). The increase in core
protein expression was independent of pregenomic RNA encapsidation,
because elimination of the pregenomic RNA encapsidation signal
(construct 4 [Fig. 1A]) did not affect the increase in the core
protein level (Fig. 2A, lane 5). The increase in core protein
expression was much greater than the twofold increase of pregenomic RNA
(serving as the core mRNA) transcription induced by the mutations (Fig.
2B). Although it is possible that MT5/6 induced alternatively initiated
pregenomic RNA resulting in increased core translation, the primer
extension analysis did not reveal any unusual 5' ends of the pregenomic
RNA associated with MT5/6 (Fig. 2B, top).

View larger version (47K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Core protein expression in wild-type and mutant
virus. HuH-7 cells were transfected with replication-competent
wild-type adw (WTadw) or mutant constructs, and core expression was
analyzed by SDS-PAGE (15% gel) and immunoblotting of transfected cell
lysates with an anticore antibody (top). The blot was stripped and
reprobed with an antiactin antibody (bottom). Positions of molecular
weight (MW) markers (in kilodaltons) are indicated on the left. (B)
Transcription of wild-type and mutant viruses. HBV RNA was purified
from HuH-7 cells transfected either with adwR9 or MT5/6R9 and analyzed
by primer extension using an HBV-specific antisense primer (top) or
Northern blotting using an HBV-specific probe (bottom). Transfection
efficiencies as monitored by pTKGH cotransfection were similar among
all samples.
|
|
To distinguish between the possibilities of increased synthesis versus
decreased turnover resulting in enhanced core expression, transfected
HuH-7 cells were pulse-labeled with [35S]methionine and
-cysteine and cell lysates were examined by immunoprecipitation with
anticore antibodies. The replication-competent construct containing
MT5/6 displayed a markedly increased synthesis of core protein
(>15-fold) compared with the wild-type construct (Fig. 3). Subsequent chase in the presence of
excess nonradioactive methionine and cysteine revealed little or no
difference in the turnover rate of core protein between the two
transfected cells (not shown).

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 3.
Core protein synthesis in mutant and wild-type HBV.
HuH-7 cells were transfected with either a wild-type adw (WTadw) or
mutant replication-competent HBV DNA construct as indicated. Three days
after transfection, HuH-7 cells were subjected to metabolic labeling.
After pulse-labeling with [35S]methionine and -cysteine
for 15 min, HuH-7 cells were lysed and subjected to immunoprecipitation
(IP) with an core-specific antibody (anti-core) or nonimmune serum
(IgG). Immunoprecipitated proteins were analyzed by SDS-PAGE and
autoradiography. The identity of the core band was established by a
parallel Western immunoblot with anticore antibodies (not shown); the
band above the core band did not react with anticore antibodies and
therefore probably represents a nonspecific protein from
immunoprecipitation. Positions of molecular weight (MW) markers (in
kilodaltons) are indicated on the left. Quantitation of the core
protein with the ImageQuant program revealed a >15-fold-higher level
of signal intensity in the mutant- than in wild-type-transfected
cells.
|
|
We next examined whether the increase in core protein expression is
reflected in an increase in HBV nucleocapsid assembly. Lysates of
35S-labeled HuH-7 cells transfected with either wild-type
or mutant constructs were subjected to sucrose velocity centrifugation, and nucleocapsid formation was analyzed by immunoprecipitation of the
35S-labeled core protein in high-density fractions of the
sucrose gradient (Fig. 4A). The mutant
construct demonstrated an approximately 15-fold increase of
nucleocapsids (core protein in high-density sucrose fractions 5, 6, and
7 in Fig. 4A) compared to the wild type. The sedimentation coefficient
of the nucleocapsids from mutant and wild-type strains was 120S to 130S
(determined according to reference 22), similar to
what was reported in the literature (6). This result is
consistent with a much higher level of replicative intermediates in
cells transfected with the MT5/6 construct.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 4.
Nucleocapsid assembly in mutant and wild-type HBV. HuH-7
cells were transfected with either the wild-type adw (WTadw; left) or
mutant (MT5/6; right) replication-competent R9 construct. After
labeling with [35S]methionine and -cysteine for 16 h, cells were lysed and the lysates were subjected to 10 to 60%
sucrose velocity centrifugation. Ten fractions were collected from the
top and analyzed for core by immunoprecipitation with an anticore
antibody. The immunoprecipitated proteins were subjected to SDS-PAGE
and autoradiography (A). Nucleocapsid-associated core sedimented to
fractions 5 to 7, whereas unassembled core monomers and dimers did not
sediment and remained in fractions 1 and 2. Positions of molecular
weight (MW) markers (in kilodaltons) are indicated on the left. (B)
Quantitation of unassembled and nucleocapsid-associated core protein in
wild-type and mutant virus by phosphor imager (PI) analysis.
|
|
It is possible that a small increase in transcription can result in an
exponential increase in protein level due to a limitation in cellular
protein degradation. In particular, the capacity of core protein
degradation may be near saturation at the wild-type level of core
synthesis, and the substantial increase in steady-state level of core
protein disproportional to the minor increase of transcription in
mutant-transfected cells may represent this threshold phenomenon. To
investigate whether the observed accumulation was secondary to this
possibility under our experimental conditions, we transfected various
amounts of wild-type and mutant constructs in a 2-log range into HuH-7
cells and analyzed core protein levels as described before. The fold
increases in core expression were similar in all quantities of plasmids
transfected (Fig. 5). These data indicate
that the mutation-induced increase of core expression was not due to a
threshold effect of core protein degradation.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Increase in mutation-induced core expression is
independent of the amount of transfected plasmid DNA. HuH-7 cells were
transfected with 20 µg of the control plasmid pGEM7 (lane 1) or 1, 3, 10, and 20 µg of wild-type adwR9 (WTadw; lanes 2 to 5) or MT5/6R9
construct (lanes 6 to 9) together with 19, 17, 10, or 0 µg of pGEM7,
respectively (total amount of transfected DNA was 20 µg in all
experiments). Core expression was analyzed by SDS-PAGE (15% gel) and
immunoblotting of HuH-7 cell lysates with an anticore antibody (A).
Quantitation (optical density [O.D.]) of the core protein by using
the ImageQuant program is shown below (top row). Transfection
efficiencies of wild-type and mutant constructs were similar, as
indicated by similar amounts of secreted HBsAg (bottom row). S/N,
signal/noise. To demonstrate similar protein loading, the blot was
stripped and reprobed with an antiactin antibody (B). Positions of
molecular weight markers (in kilodaltons) are indicated on the left.
|
|
Effect of MT5/6 on HBV RT-Pol expression.
Since the core
(pregenomic) RNA also codes for the RT-Pol, it is conceivable that
MT5/6 could similarly increase the expression of RT-Pol as it did on
the core protein. To study the effect of MT5/6 on HBV RT-Pol
expression, lysates of transfected HuH-7 cells were subjected to
immunoprecipitation and immunoblotting with RT-Pol-specific antibodies.
However, none of the antibodies available to us detected RT-Pol
expression in transfected HuH-7 cells (not shown). Therefore, RT-Pol
was fused in frame with the
-galactosidase (lacZ) gene in
the wild-type and mutant constructs (Fig.
6A). The resulting constructs, although
no longer replication competent, should allow us to study the effect of
MT5/6 on RT-Pol expression. After transfection of wild-type and mutant
RT-Pol-LacZ constructs into HuH-7 cells, expression of the Pol-LacZ
fusion protein was analyzed by SDS-PAGE and immunoblotting with an
anti-LacZ antibody. MT5/6 increased the level of the RT-Pol-LacZ fusion
protein only 1.5- to 2-fold (Fig. 6B; quantitation after correction for
transfection efficiency and protein loading), indicating that MT5/6
affected RT-Pol expression to the same extent as would be expected from the twofold increase of the transcript. This result also confirmed the
trans-complementation experiment in which MT5/6 together
with the polymerase did not confer a high-replication phenotype (Fig. 1C, lanes 7 and 8).

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Effect of MT5/6 on Pol expression. (A) In the terminal
redundant R9 construct, an RT-Pol-LacZ fusion gene was generated by
exchanging a major part of the RT-Pol ORF with a cDNA fragment of
lacZ. (B) After transfection of the adw or MT5/6 RT-Pol
fusion construct into HuH-7 cells, expression of the RT-Pol-LacZ fusion
protein was analyzed by SDS-PAGE (10% gel) and immunoblotting with an
anti-LacZ antibody (top). Analysis of LacZ expression of plasmid
pCDLacZ served as positive control. The lower band of the pCDLacZ lane
probably represents a degradation product of the full-length LacZ
protein. The blot was stripped and reprobed with an antiactin antibody
(bottom). Positions of molecular weight (MW) markers (in kilodaltons)
are indicated on the left. Transfection efficiencies as monitored by
pTKGH cotransfection were similar among all samples.
|
|
Effect of MT5/6 on core expression is independent of HBV elements
outside the core promoter and core gene.
To study whether any
other virus-specific genetic elements outside the core promoter and
core protein were required for the observed enhanced core expression
and nucleocapsid assembly, we generated wild-type and mutant core
expression constructs as illustrated in Fig.
7A. Transfection of these constructs into
HuH-7 revealed enhanced core expression (Fig. 7B), core synthesis (Fig.
7C), and nucleocapsid assembly (Fig. 7D) similar to that seen with the
replication-competent, full-length constructs (Fig. 2 to 4). Interestingly, the nucleocapsids generated by the core expression constructs sedimented slightly differently (nucleocapsid peak in
fraction 5 of sucrose velocity gradient [Fig. 7B]) from the nucleocapsids generated from the replication-competent constructs (nucleocapsid peak in fraction 6 of sucrose velocity gradient [Fig.
4]). This difference is probably due to the lack of pregenomic RNA and
RT-Pol in the core particles generated from the core expression constructs, resulting in a difference in biophysical property from the
assembled nucleocapsids of the replication-competent constructs. Taken
together, these data demonstrate that the mutation-induced enhanced
nucleocapsid assembly and core protein expression are independent of
other HBV genetic elements outside the core promoter and core gene
sequences.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 7.
Effect of MT5/6 on core expression is independent of HBV
elements outside the core promoter and core gene. (A) Core expression
constructs. The core expression constructs contain coding sequences for
only core promoter and core protein. Enhancers I and II (Enh 1 and Enh
2), encapsidation signal ( ), and core promoter (CP) are illustrated
above. tIVS, small t-antigen intron. The sequence of HBV adw strain in
the core promoter region is shown below; the hormone response element
(HRE) (where various members of nuclear receptor superfamily bind),
MT5/6, and MT8 are indicated. (B) Core protein expression. adwCP-core
or MT5/6CP-core constructs were cotransfected with a LacZ expression
construct (pCDLacZ) as a transfection control into HuH-7 cells. Three
days after transfection, cells were lysed and core expression was
analyzed by immunoblotting (upper panel). To demonstrate similar
protein loading and transfection efficiency in the experiment, the blot
was stripped and reprobed with antiactin and anti-LacZ antibodies,
respectively (middle and lower panels). In panels B to D, positions of
molecular weight (MW) markers (in kilodaltons) are indicated on the
left. (C) Core protein synthesis. After labeling of cellular and viral
proteins with [35S]methionine and -cysteine for 15 min,
HuH-7 cells were lysed and subjected to immunoprecipitation (IP) with a
core-specific antibody (anti-core) or nonimmune serum (IgG).
Immunoprecipitated proteins were analyzed by SDS-PAGE and
autoradiography. (D) Nucleocapsid assembly. Lysates of transfected
HuH-7 cells were subjected to sucrose velocity centrifugation (10 to
60% step gradient); 10 fractions were collected from the top and
analyzed for core protein by immunoblotting with an anticore antibody.
Nucleocapsid-associated core (NC) sedimented to fractions 5 and 6, whereas unassembled core monomers and dimers (UA) did not sediment and
remained in fractions 1 and 2.
|
|
The precore protein is not involved in the MT5/6-induced enhanced
replication.
Since the precore protein has been suggested to
interfere with viral encapsidation when expressed under the control of
a strong promoter (17) and some core promoter mutations have
been shown to result in a modest decrease in precore protein and HBeAg
expression (4, 25), a decrease in precore protein expression
may be responsible for the enhanced replication associated with core promoter mutants. To address this hypothesis, we eliminated the precore
ORF in both wild-type and mutant constructs by mutating the precore
start codon AUG to GUG at nt 1816. Mutating this codon should have no
effect on the downstream encapsidation signal and DR1 sequences,
precluding the possibility of any confounding effects on replication.
One caveat of this approach is that the elimination of precore AUG may
lead to initiation of core synthesis at the downstream core AUG,
resulting in increased core expression and encapsidation of the precore
mRNA (27). However, since the precore mRNA accounts for only
a minor fraction (<1/3 [Fig. 2B]) of the total 3.5-kb RNA, this
effect should have only a small impact on the overall core expression
and encapsidation. Furthermore, this possibility should be independent
of the effect of MT5/6 on core synthesis from the core mRNA.
Elimination of the precore expression had no effect on the enhanced
replication (Fig. 8A, lane 7) and core
expression (Fig. 8B, lane 7) associated with MT5/6, although there was
a minor increase of replication associated with the pre-C
mutant over wild type (Fig. 8A or B; compare lanes 2 and 3), perhaps
reflecting the possibility discussed above. The successful elimination
of precore expression was functionally confirmed by a complete absence
of HBeAg synthesis (Fig. 8C). Similar HBsAg production (Fig. 8C) as
well as similar levels of growth hormone levels expressed from the
cotransfected plasmid pTKGH (data not shown) demonstrated that the
transfection efficiencies were comparable in these experiments. These
data exclude a role of the precore protein in MT5/6-induced enhanced
replication and are consistent with previous studies showing that a
naturally occurring mutation leading to a precore stop codon (G to A at
nt 1896) did not significantly alter HBV replication in transfected
cells (10, 40, 43). The lack of effect of precore
elimination on MT5/6-induced enhanced replication is not surprising
since MT5/6 did not result in a dramatic change of precore gene
transcription (Fig. 2B and reference 2) or precore
protein expression as indicated by HBeAg synthesis (Fig. 8C).

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 8.
Effects of core promoter and precore mutations on viral
replication and protein expression. Replication-competent constructs
containing either wild-type adw (WTadw), precore
(WTadwpreC or MT5/6preC , each containing a
mutated precore start codon), or core promoter mutant sequences (Table
1) were transfected into HuH-7 cells. The transfected cells were
analyzed for viral replication, core protein expression, and HBeAg and
HBsAg synthesis. (A) Viral replication. Viral replicative intermediates
were analyzed by Southern blotting of core particle-associated viral
DNA. SS, single stranded DNA. (B) Core protein expression. Transfected
cell lysates from the experiment shown in panel A were subjected to
SDS-PAGE and immunoblotting with an anticore antibody. Positions of
molecular weight (MW) markers (in kilodaltons) are indicated on the
left. (C) HBeAg and HBsAg synthesis. HBeAg (left) and HBsAg (right)
were analyzed from the medium of transfected HuH-7 cells by using
radioimmunoassays. Transfection efficiencies as monitored by pTKGH
cotransfection were similar among all samples. Results are shown as
signal-to-noise ratio (S/N) of three independent experiments
(average ± standard deviation).
|
|
Functional comparison of naturally occurring and randomly
introduced core promoter mutants.
Recent studies have identified
another cluster of mutations in the HBV core promoter (A to T at nt
1764 and G to A at nt 1766; designated MT8 in Table 1) associated with
fulminant or severe hepatitis (12, 34). Functional studies
in a tissue culture system have demonstrated that these mutations
exhibited a high-replication phenotype (4, 25), although not
as dramatic as that of MT5/6 (2). To directly compare MT5/6
and these mutations in the capacity to increase viral replication, we
introduced MT8 into the replication-competent construct adwR9. Analysis
of viral replication of the mutant constructs in HuH-7 cells
demonstrated at most a 2-fold increase in replication for MT8, versus a
15-fold increase in replication for MT5/6 (Table 1; Fig. 8A). To
further define HBV core promoter sequences involved in the regulation
of encapsidation and replication, various other mutations were randomly
introduced into the region of the core promoter of the
replication-competent HBV construct adwR9. Analysis of viral
replication of the mutant constructs in HuH-7 cells demonstrated that
only the naturally occurring core promoter mutation in construct MT5/6
resulted in a substantially enhanced replication, whereas other
mutations had little or no effect on replication (Table 1; Fig. 8A).
The effect of MT5/6 on HBV replication is quantitatively dependent
on strain background.
To study whether the observed MT5/6-induced
enhanced encapsidation and replication also occur in an HBV wild-type
strain other than adw, we introduced MT5/6 into a replication-competent
construct of HBV strain ayw. This ayw strain was originally described
by Galibert et al. (7). Compared to a 15-fold increase of
replication in the adw background, MT5/6 led to a 2.5- to 5-fold
increase in replication when introduced into the ayw strain (Fig.
9A). This finding demonstrates that the
identified core promoter mutations result in enhanced replication
independent of the strain background, though the effect on replication
is quantitatively different between the two strains. In contrast, the
introduction of a mutation (G to A at nt 1896) leading to a stop codon
in the precore ORF and loss of HBeAg synthesis did not result in
enhanced viral replication (Fig. 9A). Interestingly, HBV adw replicated
~3- to 5-fold more efficiently than ayw although the levels of
pregenomic and precore RNA transcripts (3.5-kb RNAs) were comparable,
as indicated by primer extension and Northern blot analysis of HBV RNA
(Fig. 9B).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
Effects of core promoter and precore stop codon
mutations on replication of different HBV strains. MT5/6 (C to T at nt
1768 and T to A at nt 1770) and precore stop codon mutation (G to A at
nt 1896) were introduced into replication-competent constructs (HBVayw
strain) as described in Materials and Methods. These constructs were
transfected into HuH-7 cells, and viral replication, transcription, and
antigen expression were analyzed as described in Materials and Methods.
(A) Viral replication. WT, wild type; SS, single-stranded DNA. HBs and
HBeAg levels are indicated as signal-to-noise ratio (S/N). (B)
Transcription of adw and ayw constructs. HBV RNA was purified from
HuH-7 cells transfected with either adwR9 or aywR9 and analyzed by
primer extension using a HBV-specific antisense primer (upper panel) or
Northern blotting using an HBV-specific probe (lower panel).
Transfection efficiencies as monitored by pTKGH cotransfection were
similar among all samples.
|
|
 |
DISCUSSION |
In this study, we have defined the molecular mechanism of enhanced
viral replication and encapsidation induced by naturally occurring core
promoter mutations (in construct MT5/6) isolated from patients with a
fatal outbreak of fulminant hepatitis. The enhanced replication is
apparently mediated through the effect of the core promoter mutations
on core synthesis largely at the posttranscriptional or translational
level, leading to enhanced encapsidation of pregenomic RNA. The
enhanced core expression was the result of two different effects of the
core promoter mutations. First, the core promoter mutations resulted in
a minor (twofold) increase in pregenomic RNA transcription, as
demonstrated by primer extension, RNase protection, and Northern blot
analysis of HBV transcripts in HuH-7 cells transfected with
replication-competent wild-type and mutant constructs (Fig. 2B and
reference 2). Second, the twofold increase in
pregenomic RNA transcription is accompanied by a much larger (15-fold)
increase of core protein expression, which is paralleled by a similar
increase in core protein synthesis in the metabolic labeling
experiments (Fig. 3). Therefore, it is likely that the core promoter
mutations exert a novel posttranscriptional or translational effect on
core synthesis. Furthermore, this effect appears to be specific for
core protein and not for RT-Pol (Fig. 6), which is translated from the
same RNA. Both mechanisms, a minor increase in transcription and a substantial enhancement in translation (or other posttranscriptional processes), contributed to a 15-fold augmentation of core protein expression, nucleocapsid assembly, and replication.
Since the precore protein has been suggested to interfere with viral
encapsidation (17), it is conceivable that a change in
precore expression could alter encapsidation efficiency. Similarly, some core promoter mutations have been shown to result in a moderate decrease in precore protein and HBeAg expression, possibly explaining the phenotype of enhanced replication (4, 25). However, in our study the elimination of the precore ORF did not affect the phenotype of enhanced core expression and replication, essentially excluding a role of the precore protein in MT5/6-induced enhanced replication. This is consistent with a lack of effect of MT5/6 on
precore gene transcription (2) and protein expression (HBeAg synthesis [Fig. 8C]). This finding has also been substantiated by
several previous reports that the introduction of a mutation resulting
in a precore stop codon (G to A in nt 1896) did not result in enhanced
replication (10, 40, 43). In contrast, one report
suggested that the precore stop codon mutation led to a
high-replication phenotype (35). The explanation for this discrepancy is unclear but possibly includes laboratory strain differences or technical aspects of the experiments.
It is conceivable that elements outside the core promoter and gene are
required for the effect of the core promoter mutations. However,
several lines of evidence indicate that this is unlikely. First, the
trans-complementation experiment demonstrated that enhanced
replication occurred only when the core promoter mutations are provided
together with the core protein (Fig. 1). Presence of the mutations in a
core promoter construct directing pregenomic RNA synthesis had no
effect on replication when core protein was provided in
trans (Fig. 1). Second, the core promoter mutations did not
appear to affect RT-Pol expression substantially other than a minor
effect on transcription (Fig. 6). Third, analysis of the core
expression constructs containing only the HBV enhancer and promoter
elements driving the core ORF resulted in a similar increase in core
synthesis associated with the mutations (Fig. 7). Fourth, our previous
studies demonstrated that HBX or any possible antisense ORFs
overlapping with the core promoter played no role in this effect
(2).
By demonstrating that MT5/6 resulted in a posttranscriptional effect on
core promoter activities, we have identified a novel function of the
core promoter in the regulation of core protein expression. The
molecular mechanism whereby MT5/6 induces the posttranscriptional or
translational effect on core synthesis is not completely understood. It
is interesting that the mutations are not part of the transcribed core
RNA sequences (Fig. 7A) and therefore probably exert their main effect
cotranscriptionally without affecting the transcriptional rate
substantially. We reason that the mutations likely confer specific
cis-acting sequence information to the core promoter, which
is then translated into a functional effect. It is interesting that
this core promoter region has been shown to contain sequence
information (Fig. 7A) important for interaction with various members of
nuclear receptor family (32) as well as in differential
regulation of precore and pregenomic RNA transcription (42).
These nuclear receptors appear to exert a differential effect on the
transcription of these two forms of RNAs. Two other naturally occurring
mutations (MT8 in this report) in this region have been shown to induce a selective decrease of precore RNA transcription (4).
Although the sequence affected by MT5/6 is not part of the critical
motifs important for interaction with these factors (42), it
is situated immediately adjacent to them. Therefore, it is conceivable
that MT5/6 can affect the differential bindings of these cellular
factors. One of the effects of MT5/6 is evidenced by the twofold
increase in the transcription of pregenomic RNA without affecting the
precore RNA. In addition, we speculate that MT5/6 induces a specific
change in the composition of transcription factors binding to this
region in such a way that some of the factors may become complexed
specifically with the transcript and, through some unknown mechanism,
function to enhance translation of the RNA. The RNA polymerase II
transcription complex has been shown to interact with splicing and
polyadenylation factors to form an mRNA factory leading to coupled
transcription, splicing, processing, and possibly transport of mRNAs
(21, 26). In addition, there is evidence suggesting that
nuclear processing and export of mRNA are closely and possibly
physically linked to cytoplasmic translation (20).
Therefore, transcription and translation may be tightly coupled,
representing interaction of cellular factors with distinct functions in
a highly interdependent manner.
Candidates for such a factor(s) could be some of the translation
initiation factors such as eIF-4E or its associated factors, which bind
to the 5'-terminal cap structure of most mRNAs to facilitate translation initiation in the cytoplasm (38). This factor
has also been shown to be present in the nucleus (18) and
probably plays an additional role in the transport of mRNA
(33). However, such an effect of MT5/6 must be selective on
the pregenomic RNA only, since the synthesis of precore protein is not
similarly affected. This phenomenon can be explained by the possibility that MT5/6 confers the binding of such a factor only to the pregenomic RNA, or more plausibly that the pregenomic RNA is affected to a greater
extent by this factor than the precore RNA. It is interesting that the
encapsidation signal lies between the precore and core start codons,
and it may function as a deterrant for translation of core protein from
the pregenomic RNA, whose 5' end lies upstream of the encapsidation
signal. Such secondary structures have been shown to impede ribosomal
binding, and eIF-4F, of which eIF-4E is a subunit, functions to relieve
the translation inhibition of these structures (15). The
ribosomal binding site (RBS; Kozak sequences) of the precore ORF,
because of its position upstream of the encapsidation signal, may be
more accessible to the translational machinery. In contrast, the RBS of
the core ORF is part of the encapsidation signal (part of the stem
structure) (27) and therefore may function less efficiently
as a translation initiation signal. In addition, the RBS of the precore
ORF (GCACCATG) conforms much better to the Kozak consensus
sequence (CCACCATG) (16) than that of the core
ORF (GGGGCATG), underscoring the possibility that
translation of the core ORF is less efficient and therefore more
sensitive to regulation by translational factors. The validity of this
hypothesis awaits further experimentation.
Our data suggest that MT5/6 appears to induce less replication
enhancement in the ayw than the adw strain. The difference in
phenotypic expression of the mutations is probably due to sequence heterogeneity in this core promoter region, which may confer a qualitatively similar but quantitatively distinct response to the
mutations. There are several sequence polymorphisms in this region
distinctive for the adw and ayw strains, and whether they contribute to
the observed difference in the impact of MT5/6 on replication is not
known. Again this effect may be the result of posttranscriptional
mechanism, since adw replicates ~4- to 5-fold more efficiently than
ayw but their levels of transcription are comparable (Fig. 9B and
reference 2). Further experiments are necessary to
resolve this issue.
Previous studies have identified core promoter mutations in various
patient populations which share the phenotype of more aggressive liver
disease (9, 12, 31, 34, 36). A common hallmark of several of
these mutations is the phenotype of enhanced replication (4, 9,
25, 31). The mechanism of the enhanced replication in these
strains is only partially understood. Two mutations in the enhancer II
of the core promoter (indicated as MT8 in Table 1) have been shown to
affect precore protein expression (4). This finding led the
authors to conclude that the decrease in precore expression may have
been responsible for the enhanced replication by derepressing
nucleocapsid assembly, although no functional studies (effect of
elimination of the precore ORF in the construct containing the
mutation) were performed to verify this hypothesis (4, 25).
Other mutations have been shown to alter the binding of nuclear
transcription factors to the core promoter (9, 31). For some
of these variants, the alteration of binding of transcription factors
was associated with increased pregenomic RNA transcription and core and
polymerase expression (9). Further studies are necessary to
elucidate whether these naturally occurring core promoter mutations
affect the same functional core promoter element as MT5/6 or whether
different mechanisms apply to the individual mutations.
Core promoter mutations have been associated with more aggressive
disease, including fulminant hepatitis (2, 9, 31, 34, 36).
The MT5/6-induced increase in core protein expression and increased
replication could potentially play an important role in the
pathogenesis of fulminant hepatitis associated with this mutation.
Since the core protein is a major target of the host immune response
(5), the increase in core protein expression may render
hepatocytes more vulnerable to host immune response and the enhanced
replication may result in more widespread HBV infection in the liver.
In addition, the precore stop codon mutation (G to A at nt 1896), which
has been found in many cases of fulminant hepatitis B, results in the
absence of HBeAg production, which, in turn, may direct a more
Th1-like, proinflammatory response (23). A more vigorous and
extensive immune response with enhanced viral replication may lead to
massive liver injury and ultimately fulminant hepatic failure. Further
studies in animal models such as woodchuck and chimpanzee
(28) are necessary to ascertain whether the findings in the
tissue culture system are applicable in vivo and whether the observed
changes in replication and protein expression are indeed responsible
for the more aggressive disease associated with these mutations.
Functional analysis of hepatitis B virus mutants in vivo will be
crucial in validating current concepts of virus-host interaction and
the impact of these viral factors on HBV-induced disease.
 |
ACKNOWLEDGMENTS |
We thank Jim Ou (University of Southern California, Los Angeles)
for providing the anticore antibody and Junying Yuan (Harvard Medical
School, Boston, Mass.) for the gift of plasmid pBSlacZ. We also thank
Jay Hoofnagle and Reed Wickner (NIDDK, National Institutes of Health,
Bethesda, Md.) for helpful discussions.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Liver Diseases
Section, NIDDK-NIH, 10 Center Dr., Rm. 9B16, Bethesda, MD 20892-1800. Phone: (301) 496-1721. Fax: (301) 402-0491. E-mail:
jliang{at}nih.gov.
 |
REFERENCES |
| 1.
|
Ausubel, F. M.,
R. Brent,
R. E. Kingston,
D. D. Moore,
J. G. Seidman,
J. A. Smith, and K. Struhl (ed.).
1991.
Current protocols in molecular biology.
John Wiley & Sons, New York, N.Y.
|
| 2.
|
Baumert, T. F.,
S. A. Rogers,
K. Hasegawa, and T. J. Liang.
1996.
Two core promoter mutations identified in a hepatitis B virus strain associated with fulminant hepatitis result in enhanced viral replication.
J. Clin. Invest.
98:2268-2276[Medline].
|
| 3.
|
Blum, H. E.,
E. Galun,
T. J. Liang,
F. von Weizsäcker, and J. R. Wands.
1991.
Naturally occurring missense mutation in the polymerase gene terminating hepatitis B virus replication.
J. Virol.
65:1836-1842[Abstract/Free Full Text].
|
| 4.
|
Buckwold, V. E.,
Z. Xu,
M. Chen,
T. S. B. Yen, and J.-H. Ou.
1996.
Effects of a naturally occurring mutation in the hepatitis B virus basal core promoter on precore gene expression and viral replication.
J. Virol.
70:5845-5851[Abstract].
|
| 5.
|
Chisari, F. V., and C. Ferrari.
1995.
Hepatitis B virus immunopathogenesis.
Annu. Rev. Immunol.
13:29-60[Medline].
|
| 6.
|
Fields, H. A.,
F. B. Hollinger,
J. Desmyter,
J. L. Melnick, and G. R. Dreesman.
1977.
Biochemical and biophysical characterization of hepatitis B core particles derived from Dane particles and infected hepatocytes.
Intervirology
8:336-350[Medline].
|
| 7.
|
Galibert, F. E.,
E. Mandart,
F. Fitoussi,
P. Tiollais, and P. Charnay.
1979.
Nucleotide sequences of the hepatitis B virus genome (subtype ayw) cloned in E. coli.
Nature
281:646-650[Medline].
|
| 8.
|
Ganem, D., and H. E. Varmus.
1987.
The molecular biology of the hepatitis B virus.
Annu. Rev. Biochem.
56:651-693[Medline].
|
| 9.
|
Günther, S.,
N. Piwon,
A. Iwanska,
R. Schilling,
H. Meisel, and H. Will.
1996.
Type, prevalence, and significance of core promoter/enhancer II mutations in hepatitis B viruses from immunosuppressed patients with severe liver disease.
J. Virol.
70:8318-8331[Abstract].
|
| 10.
|
Hasegawa, K.,
J. Huang,
S. A. Rogers,
H. E. Blum, and T. J. Liang.
1994.
Enhanced replication of a hepatitis B virus mutant associated with an epidemic of fulminant hepatitis.
J. Virol.
68:1651-1659[Abstract/Free Full Text].
|
| 11.
|
Hirsch, R. C.,
J. E. Lavine,
L.-J. Chang,
H. E. Varmus, and D. Ganem.
1990.
Polymerase gene products of hepatitis B viruses are required for genomic RNA packaging as well as for reverse transcription.
Nature
344:552-555[Medline].
|
| 12.
|
Honda, A.,
T. Ehata,
O. Ypkosuka,
M. Ohto, and M. Omata.
1994.
Mutations in enhancer 2/core promoter, X protein region of hepatitis B virus correlate with fatal fulminant hepatitis.
Hepatology
20:792A.
|
| 13.
|
Huang, J., and T. J. Liang.
1993.
A novel hepatitis B virus (HBV) genetic element with Rev response element-like properties that is essential for expression of HBV gene products.
Mol. Cell. Biol.
13:7476-7486[Abstract/Free Full Text].
|
| 14.
|
Junker-Niepmann, M.,
R. Bartenschlager, and H. Schaller.
1990.
A short cis-acting sequence is required for hepatitis B virus pregenome encapsidation and sufficient for packaging of foreign RNA.
EMBO J.
9:3389-3396[Medline].
|
| 15.
|
Koromilas, A. E.,
A. Lazaris-Karatzas, and N. Sonenberg.
1992.
mRNAs containing extensive secondary structure in their 5' non-coding region translate efficiently in cells overexpressing initiation factor eIF-4E.
EMBO J.
11:4153-4158[Medline].
|
| 16.
|
Kozak, M.
1984.
Compilation and analysis of sequences upstream from the translational start site in eukaryotic mRNAs.
Nucleic Acids Res.
12:857-872[Abstract/Free Full Text].
|
| 17.
|
Lamberts, C.,
M. Nassal,
I. Velhagen,
H. Zentgraf, and C. H. Schroeder.
1993.
Precore-mediated inhibition of hepatitis B virus progeny DNA synthesis.
J. Virol.
67:3756-3762[Abstract/Free Full Text].
|
| 18.
|
Lejbkowicz, F.,
C. Goyer,
A. Darveau,
S. Neron,
R. Lemieux, and N. Sienberg.
1992.
A fraction of the mRNA 5' cap-binding protein, eukaryotic initiation factor 4E, localizes to the nucleus.
Proc. Natl. Acad. Sci. USA
89:9612-9616[Abstract/Free Full Text].
|
| 19.
|
Liang, T. J.,
H. Hasegawa,
N. Rimon,
J. R. Wands, and E. Ben-Porath.
1991.
A hepatitis B virus mutant associated with an epidemic of fulminant hepatitis.
N. Engl. J. Med.
324:1705-1709[Abstract].
|
| 20.
|
Maquat, L. E.
1995.
When cells stop making sense: effect of nonsense codons on RNA metabolism in vertebrate cells.
RNA
1:453-465[Abstract].
|
| 21.
|
McCracken, S.,
N. Fong,
K. Yankulov,
S. Ballantyne,
G. Pan,
J. Greenblatt,
S. D. Patterson,
M. Wickens, and D. L. Bentley.
1997.
The C-terminal domain of RNA polymerase II couples mRNA processing to transcription.
Nature
385:357-361[Medline].
|
| 22.
|
McEwen, C. R.
1967.
Tables for estimating sedimentation through linear concentration gradients of sucrose solution.
Anal. Biochem.
20:114-149[Medline].
|
| 23.
|
Milich, D. R.,
F. Schödel,
J. Hughes,
J. E. Jones, and D. L. Peterson.
1997.
The hepatitis B virus core and e antigen elicit different Th cell subsets: antigen structure can affect Th cell phenotype.
J. Virol.
71:2192-2201[Abstract].
|
| 24.
|
Miura, M.,
H. Zhu,
R. Rotello,
E. A. Hartwieg, and J. Yuan.
1993.
Induction of apoptosis in fibroblasts by IL-1 -converting enzyme, a mammalian homolog of the C. elegans cell death gene ced-3.
Cell
75:653-660[Medline].
|
| 25.
|
Moriyama, K.,
H. Okamoto,
F. Tsuda, and M. Mayumi.
1996.
Reduced precore transcription and enhanced core-pregenome transcription of hepatitis B virus DNA after replacement of the precore-core promoter with sequences associated with e antigen-seronegative persistent infections.
Virology
226:269-280[Medline].
|
| 26.
|
Mortillaro, M. J.,
B. J. Blencowe,
X. Wei,
H. Nakayasu,
L. Du,
S. Warren,
P. A. Sharp, and R. Berezney.
1996.
A hyperphosphorylated form of the large subunit of RNA polymerase II is associated with splicing complexes and the nuclear matrix.
Proc. Natl. Acad. Sci. USA
93:8253-8257[Abstract/Free Full Text].
|
| 27.
|
Nassal, M.,
M. Junker-Niepmann, and H. Schaller.
1990.
Translational inactivation of RNA function: discrimination against a subset of genomic transcripts during HBV nucleocapsid assembly.
Cell
63:1357-1363[Medline].
|
| 28.
|
Ogata, N.,
R. H. Miller,
K. G. Ishak, and R. H. Purcell.
1993.
The complete nucleotide sequence of a pre-core mutant of hepatitis B virus implicated in fulminant hepatitis and its biological characterization in chimpanzees.
Virology
194:263-276[Medline].
|
| 29.
|
Pollack, J. R., and D. Ganem.
1993.
An RNA stem-loop structure directs hepatitis B virus genomic RNA encapsidation.
J. Virol.
67:3254-3263[Abstract/Free Full Text].
|
| 30.
|
Pollack, J. R., and D. Ganem.
1994.
Site-specific RNA binding by a hepatitis B virus reverse transcriptase initiates two distinct reactions: RNA packaging and DNA synthesis.
J. Virol.
68:5579-5587[Abstract/Free Full Text].
|
| 31.
|
Pult, I.,
T. Chouard,
S. Wieland,
R. Klemenz,
M. Yaniv, and H. E. Blum.
1997.
A hepatitis B virus mutant with a new hepatocyte nuclear factor 1 binding site emerging in transplant-transmitted fulminant hepatitis B.
Hepatology
25:1507-1515[Medline].
|
| 32.
|
Raney, A. K.,
J. L. Johnson,
C. N. A. Palmer, and A. McLachlan.
1997.
Members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter.
J. Virol.
71:1058-1071[Abstract].
|
| 33.
|
Rousseau, D.,
R. Kaspar,
I. Rosenwald,
L. Gehrke, and N. Sonenberg.
1996.
Translation initiation of ornithine decarboxylase and nucleocytoplasmic transport of cyclin D1 mRNA are increased in cells overexpressing eukaryotic initiation factor 4E.
Proc. Natl. Acad. Sci. USA
93:1065-1070[Abstract/Free Full Text].
|
| 34.
|
Sato, S.,
K. Suzuki,
Y. Akahane,
K. Akamatsu,
K. Akiyama,
K. Yunomura,
F. Tsuda,
T. Tanaka,
H. Okamoto,
Y. Miyakawa, and M. Mayumi.
1995.
Hepatitis B virus strains with mutations in the core promoter in patients with fulminant hepatitis.
Ann. Intern. Med.
122:241-248[Abstract/Free Full Text].
|
| 35.
|
Scaglioni, P. P.,
M. Melegari, and J. R. Wands.
1997.
Biologic properties of hepatitis B viral genomes with mutations in the precore promoter and precore open reading frame.
Virology
233:374-381[Medline].
|
| 36.
|
Sterneck, M.,
S. Günther,
T. Sanantonia,
L. Fischer,
X. Rogiers,
C. E. Brölsch, and H. Will.
1996.
The complete nucleotide sequence of hepatitis B virus in 9 patients with fulminant hepatitis B infection.
Hepatology
24:300-306[Medline].
|
| 37.
|
Summers, J., and W. S. Mason.
1982.
Replication of the genome of a hepatitis B-like virus by reverse transcription of an RNA intermediate.
Cell
29:403-415[Medline].
|
| 38.
|
Thach, R. E.
1992.
Cap recap: the involvement of eIF-4F in regulating gene expression.
Cell
68:177-180[Medline].
|
| 39.
|
Tiollais, P.,
C. Pourcel, and A. Dejean.
1985.
The hepatitis B virus.
Nature
317:489-495[Medline].
|
| 40.
|
Tong, S.-P.,
J.-S. Li,
L. Vitvitski, and C. Trepo.
1992.
Replication capacities of natural and artificial precore stop codon mutants of hepatitis B virus: relevance of pregenome encapsidation signal.
Virology
191:237-245[Medline].
|
| 41.
|
Will, H.,
W. Reiser,
T. Weimer,
E. Pfaff,
M. Buescher,
R. Sprengel,
R. Cattaneo, and H. Schaller.
1987.
Replication strategy of human hepatitis B virus.
J. Virol.
61:904-911[Abstract/Free Full Text].
|
| 42.
|
Yu, X., and J. E. Mertz.
1997.
Differential regulation of the pre-C and pregenomic promoters of human hepatitis B virus by members of the nuclear receptor superfamily.
J. Virol.
71:9366-9374[Abstract].
|
| 43.
|
Yuan, T. T. T.,
A. Faruqi,
J. W. K. Shih, and C. Shih.
1995.
The mechanism of natural occurrence of two closely linked HBV precore predominant mutations.
Virology
211:144-156[Medline].
|
| 44.
|
Yuh, C.-H.,
Y.-L. Chang, and L.-P. Ting.
1992.
Transcriptional regulation of precore and pregenomic RNAs of hepatitis B virus.
J. Virol.
66:4073-4084[Abstract/Free Full Text].
|
| 45.
|
Zhou, S.,
S. Q. Yang, and D. Standring.
1992.
Characterization of hepatitis B virus capsid particle assembly in Xenopus oocytes.
J. Virol.
66:3086-3092[Abstract/Free Full Text].
|
J Virol, August 1998, p. 6785-6795, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jammeh, S., Tavner, F., Watson, R., Thomas, H. C., Karayiannis, P.
(2008). Effect of basal core promoter and pre-core mutations on hepatitis B virus replication. J. Gen. Virol.
89: 901-909
[Abstract]
[Full Text]
-
Chou, Y-C, Yu, M-W, Wu, C-F, Yang, S-Y, Lin, C-L, Liu, C-J, Shih, W-L, Chen, P-J, Liaw, Y-F, Chen, C-J
(2008). Temporal relationship between hepatitis B virus enhancer II/basal core promoter sequence variation and risk of hepatocellular carcinoma. Gut
57: 91-97
[Abstract]
[Full Text]
-
Heipertz, R. A. Jr., Miller, T. G., Kelley, C. M., Delaney, W. E. IV, Locarnini, S. A., Isom, H. C.
(2007). In Vitro Study of the Effects of Precore and Lamivudine-Resistant Mutations on Hepatitis B Virus Replication. J. Virol.
81: 3068-3076
[Abstract]
[Full Text]
-
Parekh, S., Zoulim, F., Ahn, S. H., Tsai, A., Li, J., Kawai, S., Khan, N., Trepo, C., Wands, J., Tong, S.
(2003). Genome Replication, Virion Secretion, and e Antigen Expression of Naturally Occurring Hepatitis B Virus Core Promoter Mutants. J. Virol.
77: 6601-6612
[Abstract]
[Full Text]
-
Lau, G. K. K., Leung, Y.-h., Fong, D. Y. T., Au, W.-y., Kwong, Y.-l., Lie, A., Hou, J.-l., Wen, Y.-m., Nanj, A., Liang, R.
(2002). High hepatitis B virus (HBV) DNA viral load as the most important risk factor for HBV reactivation in patients positive for HBV surface antigen undergoing autologous hematopoietic cell transplantation. Blood
99: 2324-2330
[Abstract]
[Full Text]
-
Wellnitz, S., Klumpp, B., Barth, H., Ito, S., Depla, E., Dubuisson, J., Blum, H. E., Baumert, T. F.
(2002). Binding of Hepatitis C Virus-Like Particles Derived from Infectious Clone H77C to Defined Human Cell Lines. J. Virol.
76: 1181-1193
[Abstract]
[Full Text]
-
Yu, X., Mertz, J. E.
(2001). Critical Roles of Nuclear Receptor Response Elements in Replication of Hepatitis B Virus. J. Virol.
75: 11354-11364
[Abstract]
[Full Text]
-
Gordien, E., Rosmorduc, O., Peltekian, C., Garreau, F., Bréchot, C., Kremsdorf, D.
(2001). Inhibition of Hepatitis B Virus Replication by the Interferon-Inducible MxA Protein. J. Virol.
75: 2684-2691
[Abstract]
[Full Text]
-
Petrosillo, N., Ippolito, G., Solforosi, L., Varaldo, P. E., Clementi, M., Manzin, A.
(2000). Molecular Epidemiology of an Outbreak of Fulminant Hepatitis B. J. Clin. Microbiol.
38: 2975-2981
[Abstract]
[Full Text]
-
Yang, W., Summers, J.
(1999). Integration of Hepadnavirus DNA in Infected Liver: Evidence for a Linear Precu