Previous Article | Next Article 
J Virol, August 1998, p. 6291-6297, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Herpesvirus Transactivator VP16 Mimics a Human
Basic Domain Leucine Zipper Protein, Luman, in Its Interaction
with HCF
Rui
Lu,1,2
Ping
Yang,1
Sharmila
Padmakumar,1 and
Vikram
Misra1,*
Department of Veterinary Microbiology,
Western College of Veterinary Medicine, University of Saskatchewan,
Saskatoon, Saskatchewan S7N 5B4,1 and
Saskatchewan Health Services Utilization and Research
Commission, Saskatoon, Saskatchewan S7N OW8,2
Canada
Received 13 March 1998/Accepted 28 April 1998
 |
ABSTRACT |
In human cells infected with herpes simplex virus (HSV), viral gene
expression is initiated by the virion protein VP16. VP16 does not bind
DNA directly but forms a multiprotein complex on the viral
immediate-early gene promoters with two cellular proteins: the POU
domain protein Oct-1 and host cell factor (HCF; also called C1, VCAF,
and CFF). Despite its apparent role in stabilizing the VP16-induced
transcription complex, the natural biological role of HCF is unclear.
Only recently HCF has been implicated in control of the cell cycle. To
determine the role of HCF in cells and answer why HSV has evolved an
HCF-dependent mechanism for the initiation of the lytic cycle, we
identified the first human ligand for HCF (R. Lu et al., Mol. Cell.
Biol. 17:5117-5126, 1997). This protein, Luman, is a
member of the CREB/ATF family of transcription factors that
can activate transcription from promoters containing
cyclic AMP response elements (CRE). Here we provide evidence that
Luman and VP16 share two important structural features: an acidic
activation domain and a common mechanism for binding
HCF. We found that Luman, its homolog in Drosophila,
dCREB-A (also known as BBF-2), and VP16 bind to HCF by a motif,
(D/E)HXY(S/A), present in all three proteins. In addition, a mutation
(P134S) in HCF that prevents VP16 binding also abolishes its
binding to Luman and dCREB-A. We also show that while interaction with
HCF is not required for the ability of Luman to activate transcription
when tethered to the GAL4 promoter, it appears to be essential for
Luman to activate transcription through CRE sites. These data suggest
that the HCF-Luman interaction may represent a conserved mechanism for
transcriptional regulation in metazoans, and HSV mimics this
interaction with HCF to monitor the physiological state of the host
cell.
 |
INTRODUCTION |
In cells infected with herpes
simplex virus (HSV), the transcription of HSV immediate-early (IE or
) genes is regulated by a virion protein, VP16 (also called Vmw65 or
TIF) (reviewed in references 23 and
33). Unlike most other transcription activators, VP16 does not bind to DNA directly but is recruited to IE gene promoters by its association with a cellular POU domain protein, Oct-1
(13, 19, 20, 24, 32). Another cellular protein, host cell
factor (HCF; also called C1, VCAF, or CFF) is required to facilitate
and stabilize the VP16-Oct-1 association (9, 11, 31, 42).
Upon infection of permissive cells, VP16 first forms a complex with
HCF. This association subsequently promotes its interaction with Oct-1,
which is bound to the TAATGARAT motif (R is a purine), the
cis-regulatory target of VP16 activation found in HSV IE
promoters (2, 13, 20, 24, 26, 32).
Purified HCF consists of a family of polypeptides, originating from
cleavage of a single large precursor. The resulting amino (N)- and
carboxyl (C)-terminal polypeptides of HCF remain bound together by
noncovalent linkages (12, 38, 40). Although the
N-terminal portion of the molecule can bind VP16 on its own (14,
37), this association and subsequent interaction with DNA-bound
Oct-1 is stabilized by the C-terminal portion of HCF (14).
HCF has largely been defined by its accessory role in VP16-activated
transcription. Nonetheless the gene for HCF is conserved in species as
diverse as humans (12, 38), mice (10), and nematodes (14), and an HCF-like activity in fruit flies has been reported (28). This suggests that HCF plays an
important role in the biology of metazoans, and recently it has been
implicated in the regulation of the cell cycle (5). The
hamster cell line tsBN67 has a single point mutation in its
gene for HCF, proline to serine at position 134 (P134S), which confers
a temperature-sensitive phenotype on the protein. At the nonpermissive
temperature, cell division in tsBN67 cells is arrested at
the G0/G1-S decision point. Although at the
nonpermissive temperature HCF stability and posttranslational processing are not affected by the mutation, VP16 is unable to interact
with the mutant HCF in vitro, and transcription activation by VP16 is
also disrupted in these cells (5, 37).
Recently, we (18) and others (4) identified a
human basic domain-leucine zipper (bZIP) protein, Luman, that interacts with HCF both in vivo and in vitro. Luman is a transcription factor of
the CREB/ATF gene family that can activate transcription from promoters containing cyclic AMP response elements (CREs)
(18). We showed that Luman and VP16 compete with each
other for the binding of HCF in vitro. In transfection assays,
using a reporter gene with a promoter containing the GAL4
response element (the upstream activation sequence [UAS]), we also
showed that VP16 inhibited transcription activation by a fusion protein
of the GAL4 DNA-binding domain (DBD) and Luman (GAL-Luman). The results suggested that VP16 and Luman bind to HCF by similar mechanisms. Sequence analyses (18) revealed that, like VP16, Luman and
its homologs in mice (LZIP [3]) and in fruit flies
(dCREB-A; also called BBF-2 [1, 30]) have a terminal
acidic domain and a possible HCF-binding motif. This sequence motif,
(D/E)HXY(S/A) (where X stands for any amino acid), in VP16 has been
implicated in HCF binding (7, 8, 15, 29, 41) and is also
present in VP16 homologs in other members of
Alphaherpesvirinae.
Here we provided evidence for the functional relevance of these
structural similarities between VP16 and Luman. We show that Luman's
acidic amino terminus is a functional activation domain when fused to
GAL4 DBD and that the (D/E)HXY(S/A) motif in Luman and dCREB-A is
involved in their interaction with HCF. We also show that interaction
with functional HCF appears to be essential for Luman to activate
promoters through CRE sites. However, it is not required either for
Luman recognition of the CRE in vitro or for its inherent ability to
activate transcription when tethered to a GAL4 UAS. We propose that
VP16 mimics Luman in its interaction with HCF and that HSV has evolved
this mechanism to exploit an important cellular regulatory circuit.
 |
MATERIALS AND METHODS |
Materials.
All restriction endonucleases, modifying enzymes,
oligonucleotide primers, Taq DNA polymerase, and other
reagents were purchased from Canadian Life Technologies unless
otherwise stated.
Plasmids and mutagenesis.
The construction of plasmids
pMLuman (a mammalian expression vector for GAL4-Luman fusion
protein), pGEXLuman (a bacterial expression vector for glutathione
S-transferase [GST]-Luman fusion protein), and pcLuman
(the coding sequence for Luman cloned in the expression vector pcDNA3;
Invitrogen) has been described previously (18). Plasmids
p-109C3 and p-68CRE, which have CRE-containing promoters linked to the
coding sequences for chloramphenicol acetyltransferase (CAT)
(27), were obtained from William Roesler, University of Saskatchewan. Plasmids pM1 and pM2, for constructing GAL4 fusion proteins, and pG5EC, a plasmid containing the CAT gene linked to five
GAL4 UAS, were obtained from Ivan Sadowski, University of British
Columbia.
The 3'-end deletion mutants of Luman were constructed by digestion
and religation of pMLuman, except pMLuman1-315. The
plasmid DNA of pMLuman was cut with
EcoRI-NdeI, HindIII,
HindIII-EcoRV, and
HindIII-PstI individually, blunt
ended with Klenow fragment (where needed), and subsequently
religated. The resultant plasmids were pMLuman1-107,
pMLuman1-119, pMLuman1-220, and pMLuman1-276, respectively. To generate plasmid pMLuman1-315, the stop codon TAG was introduced at amino acid 316 by oligonucleotide-directed mutagenesis.
Amino acid substitutions in Luman were generated by
oligonucleotide-directed mutagenesis (
22). These mutants
were then cloned
into the same expression vectors as Luman
(
18).
Plasmid p46CY, containing the coding sequence of the dCREB-A gene
between
HindIII-
NotI sites, was kindly given
by Sarah Smolik,
Oregon Health Sciences University (
30). To
construct pc-dCREB-A,
an oligonucleotide linker
(5'-AAGCTTGTCCCATGGAATTCTACGC and
5'-GGCCGCGTAGAATTCCATGGGACA)
was first inserted between the
HindIII-
NotI sites on pcDNA-Amp
(Invitrogen)
to generate vector pclinker, and then the
EcoRI-
NotI
fragment from p46CY was cloned between
the same restriction sites
on pclinker. To construct pGEX-dCREB-A, the
NcoI-
SacI fragment
from p46CY containing the
dCREB-A gene was inserted into the pGEX-KG
vector. Mutants of
dCREB-A, constructed by oligonucleotide-directed
mutagenesis, were
cloned into the pGEX-KG and pclinker vectors
by using the same
strategy.
All of the HCF plasmids used in this study contain the functional
version of HCF, HCF(NC) (
14,
18). Plasmid SL2, an expression
vector of GAL4 DBD and HCF(NC) fusion protein, was a gift from
S. LaBoissière and P. O'Hare, Marie Curie Institute, Surrey,
England. The P143S mutation of HCF was made by introducing a C-to-T
transition by using a PCR strategy. The left or mutagenesis primer
(5'-CAAAAAC
GGGCCCCCTtCGTGTCCTCGAC) and the right
primer (5'-ACT
CCCGGGGTGGTGGTAGGACC)
had the
restriction sites
ApaI and
SmaI, respectively
(underlined).
The 25-µl reaction mixture consisted of 50 ng of SL2
plasmid DNA,
0.2 mM each dATP, dTTP, dGTP, and dCTP, 0.2 µM primers,
1.75 mM
MgCl
2 and 1.25 U of
Taq DNA polymerase.
The PCR program began
with one cycle of 2-min denaturation at 94°C,
2-min annealing
at 58°C, and 2-min extension at 72°C, followed by
25 cycles of
45 s at 94°C, 30 s at 55°C, and 1 min at
72°C, ending with a final
8-min extension at 72°C. The PCR products
were subjected to electrophoresis
in a 1.6% agarose gel. The ~200-bp
DNA band was cut out, and DNA
was eluted, purified by phenol-chloroform
extraction, and precipitated
in ethanol. The DNA fragment was then
digested with
ApaI and
SmaI
and was cloned
between the same sites in SL2. The nucleotide sequences
of all of the
mutagenesis clones were confirmed by DNA sequencing.
Cell culture, transfections, and CAT assays.
The
BHK-21-derived temperature-sensitive cell line tsBN67 was
obtained from the RIKEN Gene Bank, Tsukuba, Japan. The growth conditions of COS7 cells and the method of transfection have been described previously (18, 21, 22). COS7 cells were
transfected by using Lipofectamine (Canadian Life Technologies) and
assayed for CAT expression by using a CAT enzyme-linked immunosorbent assay (ELISA) kit (Boehringer Mannheim) as instructed by the
manufacturer. The BHK-21 and mutant tsBN67 cells were
cultured at 37 and 33.5°C, respectively, in Dulbecco's modified
Eagle medium supplemented with 10% newborn calf serum. One day prior
to transfection, BHK-21 and tsBN67 cells were seeded into
six-well plates at a concentration of 2 × 105/well at
the assay temperature (33.5 or 39.5°C). The cells were transfected
with 12 µl of Lipofectamine and 2 µg of DNA (pUC19 was used to make
up the total amount of DNA). CAT activity was measured 48 h
posttransfection, using the CAT ELISA kit (Boehringer Mannheim). All
transfection data were confirmed by at least three independent assays,
and the results of representative assays are presented.
Expression and purification of GST fusion proteins, in vitro
transcription and translation, and GST pull-down assays.
The GST
fusion proteins were produced and purified by using
glutathione-Sepharose beads (Pharmacia) from Escherichia
coli BL21(DE3) (Novagen) (18). A rabbit reticulocyte in
vitro transcription-translation system (TnT; Promega) was used to
produce 35S-labeled proteins according to the
manufacturer's protocol. GST pull-down assays were performed as
described previously (18). To ensure that each GST pull-down
reaction contained the same amount of GST fusion protein, the
concentration of each sample of glutathione beads with fusion proteins
was adjusted so that when examined by sodium dodecyl sulfate
(SDS)-polyacrylamide gel electrophoresis (PAGE), each reaction
contained the same intensity of Coomassie blue-stained protein band.
EMSA.
Oligonucleotides representing binding sites for CRE
(5'-AGCTGCC GGTGACGTCATCGCAT and 5'-CTAGATGCGATGACGTACCCGGC) were
annealed, labeled with [
-32P]dCTP by using the Klenow
fragment of E. coli DNA polymerase, and used as probes. In
each electrophoretic mobility shift assay (EMSA) reaction (50 µl),
approximately 1 ng of labeled DNA probe and 50 to 100 ng of recombinant
GST-Luman and variant proteins were used, as measured by a protein
assay kit (Bio-Rad) and SDS-PAGE. Details of the procedures are
provided elsewhere (18, 21, 22).
 |
RESULTS |
Like VP16, Luman has a defined, acidic activation domain.
Previously, we identified a human bZIP protein, Luman, that interacts
with HCF (18). Sequence analysis revealed that the N-terminal region of Luman is rich in negatively charged amino acids,
suggesting the existence of a N-terminal acidic activation domain, as
exemplified in VP16. To verify and map the N-terminal activation
domain, we constructed a series of 3' deletions (Fig. 1) to progressively remove the C-terminal
proline-rich region, the segment between the proline-rich and the bZIP
regions, the bZIP region, and the region between bZIP and the presumed
HCF-binding motif. A clone bearing the first 107 amino acids of Luman
with a mutation, D78A (an aspartic acid-to-alanine substitution at position 78), in the presumed HCF-binding motif (Fig.
2) was also included. (The same
nomenclature is applied to other amino acid substitution mutations
referred to in this paper.) These plasmids were cotransfected into COS7
cells with a reporter plasmid, pG5EC, that contains the coding
sequences of CAT linked to five GAL4 UAS in its promoter region. The
results (Fig. 1) showed that the first 107 amino acids in the
N-terminal region were sufficient to activate transcription when fused
to GAL4 DBD, and removal of the first 38 amino acids disrupted the
activation. The D78A mutation, which abrogates HCF binding (see below),
did not affect activation. The data suggest that the N-terminal acidic
region of Luman is an activation domain and that transcription
activation, at least in the context of a GAL4 UAS-containing promoter,
does not require HCF.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Mapping of the activation domain of Luman by deletion
analysis. On the left is a schematic representation of the structure of
the Luman protein, in which numbers indicate the positions of the amino
acids. The X in the HCF-binding domain of D78A represents a point
mutation (alanine replaces the aspartate residue at position 78).
Features of the protein discussed in the text are labeled. Luman and
its deletion mutants were fused to the GAL4 DBD. The same amount (0.5 µg) of each plasmid was introduced into COS7 cells along with the
reporter plasmid, pG5EC (0.5 µg), which has five copies of GAL4 UAS
in the promoter region linked to the cat gene. CAT activity
was measured by ELISA 48 h posttransfection.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Putative HCF-binding domains and mutants. The
amino acid sequence alignment shows that Luman and the
Drosophila protein dCREB-A share, with the herpesvirus
TIF proteins, a motif that has been implicated in HCF binding in
VP16 (HSV- TIF). In this consensus (D/E)HXY(S/A) motif, we mutated
amino acids D78, H79, and Y81 of Luman and amino acids E64, H65, and
Y67 of dCREB-A. BHV, bovine herpesvirus.
|
|
Luman, along with dCREB-A, shares an HCF-binding motif with
VP16.
Amino acid sequence alignment showed that Luman and the
Drosophila protein dCREB-A (1, 30) share a motif
with the
TIF proteins of alphaherpesviruses (18). This
motif in VP16 (HSV
TIF) has been implicated in its association with
HCF (7, 8, 15, 29, 41). In the consensus (D/E)HXY(S/A)
motif (Fig. 2), we mutated amino acids D78, H79, and Y81 of Luman and
amino acids E64, H65, and Y67 of dCREB-A to determine if these amino acids are involved in the HCF binding.
In the GST pull-down assays, the GST fusion proteins of Luman and
dCREB-A were produced in bacteria and purified by using
glutathione-Sepharose beads. The HCF protein was transcribed and
translated in vitro in the presence of [
35S]methionine.
The GST and GST-VP16 fusion proteins were used as
controls. Equivalent
amounts of protein-beads were used for all
samples, as estimated by
SDS-PAGE. The result (Fig.
3) showed
that
the amino acid substitution mutations in the HCF-binding
motifs of
Luman or dCREB-A disrupted their association with HCF.

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Mutants in the conserved residues of the putative
HCF-binding motif of Luman and dCREB-A do not bind to HCF in vitro. All
GST and GST fusion proteins were produced in E. coli
BL21(DE3) and bound to glutathione-Sepharose beads. HCF was labeled
with [35S]methionine by in vitro transcription and
translation in the TnT system (Promega). Equivalent amounts of GST
proteins attached to the beads were incubated with
[35S]HCF for 45 min, washed, analyzed on an SDS-10%
polyacrylamide gel, and visualized by autoradiography. The lane labeled
Input represents 1/10 of the [35S]HCF incubation mixture.
Panels A and B show the GST pull-down results for Luman and dCREB-A and
their mutants, respectively.
|
|
To test whether these mutants could also disrupt interaction with HCF
in vivo, we used a mammalian two-hybrid system. We transfected
COS7
cells with the expression plasmids for Luman or its mutants,
GAL4
DBD-HCF fusion protein (GAL-HCF), as well as the reporter
plasmid
pG5EC. In this system, transcriptional activation by the
Luman
proteins is dependent on tethering to the GAL4 UAS-containing
promoter
in pG5EC via their interaction with GAL-HCF. The result
(Fig.
4) showed that, in contrast to the
wild-type Luman, the
Luman mutants could not interact with HCF and
therefore could
not activate transcription on the GAL4 UAS promoter.

View larger version (12K):
[in this window]
[in a new window]
|
FIG. 4.
Luman mutants do not interact with HCF in vivo. Plasmids
expressing wild-type Luman and its mutants (0.5 µg) were individually
introduced in COS7 cells with pG5EC (0.5 µg) and a plasmid (0.5 µg)
expressing GAL-HCF. Since transactivation by Luman depends on its
tethering to GAL4 UAS through its interaction with HCF, CAT activity is
an indicator of Luman-HCF interaction. The control represents the
expression vector without an insert.
|
|
To prove that the loss of transactivation ability was not due to any
changes that these mutations might have caused to the
activation domain
of Luman, the Luman mutants were fused to GAL4
DBD and tested for the
ability to transactivate the GAL4 UAS promoter
in pG5EC. The results
(Fig.
5) showed that the activation
domains
of these Luman mutants were fully functional. The results also
confirmed our observation [compare Luman1-107 and Luman(D78A)1-107
in
Fig.
1] that mutation of the HCF-binding domain has little
effect on
the activation domain of Luman.

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Mutations in the HCF-binding motif do not affect the
activation domain of Luman. Luman and its mutants were fused to the
GAL4 DBD to study the effects of the mutations on their ability to
activate transcription when tethered to the GAL4 UAS. Equivalent
amounts (0.5 µg) of each GAL-Luman fusion protein-expressing plasmid
were cotransfected in COS7 cells with plasmid pG5EC (0.5 µg) as the
reporter. The control represents the expression vector without an
insert.
|
|
The HCF-binding mutants of Luman have reduced transcription
activity on CRE-containing promoters, although they still retain the
ability of binding to CRE in vitro. Our previous study
showed that
Luman binds to CRE and activates transcription from
CRE-containing
promoters (
18). We therefore wanted to determine
if Luman
requires HCF for the activation of CRE-containing promoters
in vivo.
Plasmid p-109C3 (
27), which has a CRE-containing promoter
linked to the CAT gene, was used as the reporter plasmid to study
the
effect of mutations on the transcriptional activation by Luman.
In the
transfection assays, plasmids expressing Luman proteins
were introduced
into COS7 cells with p-109C3. Figure
6
shows that
the Luman mutants that were unable to bind HCF were impaired
in
the ability to activate transcription from the CRE-containing
promoter. The result was confirmed by using a different reporter
plasmid, p-68CRE (data not shown).

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 6.
Transcriptional activation by the Luman mutants on a
CRE-containing promoter is reduced. Plasmids (0.5 µg each) expressing
Luman and the mutants were introduced into COS7 cells with CAT reporter
plasmid p-109C3 (0.5 µg), in which the promoter region has a CRE
linked to the cat gene (27).
|
|
We had previously shown that Luman binds CRE in vitro in an
HCF-independent manner (
18). To eliminate the possibility
that
mutations in the HCF-binding domain indirectly affected their
binding to CRE, we examined the purified mutant proteins in the
HCF-independent CRE binding assay. The results (Fig.
7A) showed
that all of the Luman mutants
retained the ability of binding
to CRE and that the binding could be
competed by unlabeled CRE
DNA probe. Similar EMSA results were also
obtained for dCREB-A
and its mutants (Fig.
7B).

View larger version (58K):
[in this window]
[in a new window]
|
FIG. 7.
Mutations in the putative HCF-binding domain of Luman
and dCREB-A do not affect binding of CRE in vitro as detected by
HCF-independent EMSA. A double-stranded oligonucleotide representing
CRE was labeled with 32P, annealed, incubated with each of
the purified Luman (A) or dCREB-A (B) GST fusion proteins, and analyzed
on a 4% nondenaturing polyacrylamide gel. (A) For each GST-Luman
fusion protein sample, 1 µl of unlabeled CRE oligonucleotide, at
concentrations of 1 and 10 µM, was added to the incubation mix and
used as a competitor. For wild-type Luman, an additional concentration
of 0.1 mM was included. (B) In every other lane, 10 pmol of unlabeled
CRE oligonucleotide was added to the GST-dCREB-A protein sample and
used as a competitor. The last lane contains the labeled CRE probe
alone.
|
|
Like VP16, Luman and dCREB-A do not interact with the
HCF(P134S) mutant.
Recent studies (14, 37)
suggest that VP16 targets the N-terminal region of HCF, which has
six Kelch repeats. The P134S mutation, located in the third Kelch
repeat of the HCF protein in tsBN67 cells, can cause cells
to arrest at G0/G1. At the nonpermissive temperature, VP16 is unable to interact with the mutated HCF and cannot
activate transcription in tsBN67 cells (5, 37).
To further compare VP16 with Luman and dCREB-A in their modes of interaction with HCF, we also tested HCF(P134S) for its interaction with wild-type Luman and dCREB-A. Both the GST pull-down (Fig. 8) and mammalian two-hybrid (Fig.
9) assays, as described above, were
performed with HCF(P134S) as well as wild-type HCF. The results of both assays clearly showed that, like VP16, Luman could not interact with the mutated form of HCF. The GST pull-down assay (Fig.
8B) and a separate mammalian two-hybrid assay on dCREB-A (data not
shown) also indicated that dCREB-A could bind to wild-type HCF but not
HCF(P134S).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 8.
A mutation in the VP16-binding site of HCF(P134S)
prevents its association with VP16 as well as with Luman and dCREB-A in
vitro. GST and GST fusion proteins of dCREB-A, Luman, and VP16 were
incubated with an equivalent amount of 35S-labeled HCF (A)
or HCF(P134S) (B) and analyzed on an SDS-polyacrylamide gel. Input
(1/10) was run on the last lane of each gel.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 9.
A mutation in the VP16-binding site of HCF(P134S)
prevents its association with VP16 as well as with Luman and dCREB-A in
vivo. The parental expression vector pcDNA3 was used as a negative
control, and VP16 was included as a reference. Along with the reporter
plasmid pG5EC (0.5 µg), equivalent amounts (0.5 µg) of plasmids
expressing Luman and VP16 or the empty expression vector pcDNA3 were
introduced into COS7 cells with either the blank GAL fusion vector, a
plasmid expressing GAL-HCF, or a plasmid expressing GAL-HCF(P134S).
|
|
A functional HCF is required for the ability of Luman to activate
transcription from CRE-containing promoters but not from heterologous
promoters.
To confirm that interaction with HCF is required for
Luman to activate transcription through CRE, we used the
tsBN67 cell line, in which the endogenous HCF(P134S) is
nonfunctional at the nonpermissive temperature of 39.5°C. At either
the permissive temperature of 33.5°C or the nonpermissive
temperature, we transfected tsBN67 and the wild-type
parental BHK-21 cells with plasmid pcLuman and the CRE-containing
plasmid p-109C3 as a reporter. We found that in tsBN67
cells, Luman could activate transcription from the CRE-containing
promoter only at the permissive temperature (Fig.
10A), while in BHK-21 cells, Luman
could activate transcription at both temperatures (Fig. 10B). The
result was also confirmed by using a different CRE-containing reporter
plasmid, p-68CRE (data not shown). In contrast to these results, the
GAL4 fusion proteins of full-length Luman, its amino-terminal portion
containing the activation domain (Luman1-107), or the same segment with
the D78A mutation, Luman(D78A)1-107, were all capable of activating transcription at both temperatures in the mutant tsBN67
cells (Fig. 10C) as well as in BHK-21 cells (data not shown).

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 10.
Luman activates transcription from CRE-containing
promoters in tsBN67 cells at the permissive (33.5°C) but
not nonpermissive (39.5°C) temperature. (A and B) Plasmids expressing
wild-type Luman (0.5 µg) and a blank vector (0.5 µg) were used to
transfect tsBN67 (A) and parental BHK-21 (B) cells at both
33.5°C ( ) and 39.5°C ( ). (C) Plasmids (0.5 µg of each)
expressing the GAL4 DBD fusion proteins of full-length Luman, the
N-terminal portion containing the activation domain (Luman1-107) and
the same segment with the mutation D78A were introduced into
tsBN67 cells at both 33.5°C ( ) and 39.5°C ( ).
|
|
 |
DISCUSSION |
Previously we identified a human cellular protein, Luman, through
its interaction with HCF (18). Luman belongs to the CREB/ATF gene family of bZIP proteins. It can bind CRE in vitro and can activate
transcription from promoters containing CRE in vivo. A contemporaneous
study by Freiman and Herr (4) using the yeast two-hybrid
system and immunoprecipitation assays also showed that VP16 and Luman
(referred to as LZIP in that study) have a common mode of association
with HCF. In the present study, we confirmed and extended these
observations by showing the following. (i) Luman, like VP16, has a
defined acidic activation domain. (ii) Luman and its
Drosophila homolog dCREB-A interact with HCF similarly to
VP16: Luman and dCREB-A share an HCF-binding motif,
(D/E)HXY(S/A), present in VP16 and VP16 homologs in
other alphaherpesviruses. Mutations of conserved residues in this motif
drastically reduced the binding of Luman or dCREB-A to HCF both in
vitro and in vivo, while these mutations had little effect on the
activation potentials of these proteins. In addition, Luman, like VP16,
did not interact with HCF with the P134S mutation, which in
tsBN67 cells causes cell growth arrest at the
G0/G1 stage of the cell cycle (5). (iii) The ability of Luman to activate CRE-containing promoters appears
to require its association with HCF. The conservation of HCF in
distantly related organisms (36, 39) and the presence of
Luman and other HCF-binding bZIP proteins in species as diverse as
humans and fruit flies suggests that the interaction between Luman and
HCF may represent a mechanism for transcriptional regulation that has
been retained during the evolution of metazoans.
In addition to Luman, we have recently isolated the cDNA for another
human protein, named Zhangfei, that binds to HCF (unpublished data).
Although the overall sequence homology between the Luman and Zhangfei
proteins is not significant (~30%), they share striking structural
similarities: Zhangfei is also a bZIP protein with an acidic activation
domain and an HCF-binding motif (DHDYAS). The mRNAs of both proteins
are detected in a variety of adult and fetal tissues (reference
18 and unpublished data). The discovery of two
HCF-binding proteins in human cells suggests that HCF is a key switch
that coordinately regulates transcriptional activation by these and
other ubiquitous HCF-binding proteins. In this role, we envisage HCF as
an upstream trigger of a process like G0/G1-S transition. The response to HCF would be the immediate activation of one or more cascades regulated by these transcription activators. However, the withdrawal of HCF would not have a similar immediate effect. This might explain the long delay in achieving growth arrest after tsBN67 cells are elevated to the nonpermissive
temperature (5).
Luman mutants that did not bind HCF also failed to activate
transcription from CRE-containing promoters. These mutants nonetheless retained the ability to activate transcription when tethered to a
heterologous promoter by the GAL4 DBD. In this respect, Luman is also
similar to VP16, where inability to bind HCF compromises transcription
from TAATGARAT-containing promoters but does not hinder activation by
GAL4 DBD fusion proteins from GAL4 UAS-containing promoters (data not
shown). For VP16, HCF is believed to stabilize the
TAATGARAT-Oct-1-VP16 complex. It is likely that HCF also stabilizes the Luman-CRE association in vivo. However, our results show that at
least in vitro, Luman does not require HCF to bind the CRE. This
HCF-independent binding may be stabilized or enhanced by HCF, but we
have not been able to obtain recombinant or native HCF of sufficiently
high purity to test this hypothesis. The abundance of endogenous
CRE-binding activity in cell lysates and the in vitro
transcription-translation systems precludes the use of crude cell
lysates or in vitro-synthesized HCF in this assay.
An alternative explanation for our observation is that the association
with HCF does not change the DNA-binding ability of Luman. Instead, HCF
may act by altering the conformation of the proteins with which it
interacts. This hypothesis is supported by the observation that the
basic DNA-binding domains of bZIP proteins are relatively independent
of the adjoining protein structures and can readily bind to DNA by
themselves after dimerization (25). In VP16, the
conformational change resulting from HCF binding would allow it to form
a stable complex with DNA-bound Oct-1 without effects on its activation
domain. In Luman, the HCF-induced change might activate the
transactivation domain of Luman on its cognate response element,
CRE, or a similar motif. Many transcription factors have been
found to possess masked activation domains, which can be unmasked by
the binding of a factor, e.g., Leu3p (35) and YY1
(16), and/or by modification (e.g., phosphorylation; ATF-2
[17] and C/EBP
[34]). It is
puzzling that Luman mutants that do not bind HCF can nonetheless
activate transcription when tethered to heterologous promoters by the
GAL4 DBD. It is possible that fusion with the GAL4 DBD causes a
conformational change in Luman that is equivalent to that caused by
HCF. It has been shown that the GAL4 DBD when fused to transcription
factors can alter their properties of transcription: fusion of VP16 to
the GAL4 DBD allows the chimeric protein to activate from distal as
well as proximal promoter sites, while without the GAL4 DBD, VP16 is restricted to activation from proximal binding sites (6).
We have also noticed that HCF itself can activate transcription. We
observed low levels of transactivation activities in both mammalian
cells (COS7 cells [control samples in Fig. 4 and 9]) and yeast cells
(18). More interestingly, in the hamster fibroblast cell
line, BHK-21, the GAL-HCF fusion protein was as potent as GAL-Luman in
activating transcription from a GAL4 UAS-containing promoter (data not
shown). Thus, in addition to the above hypotheses, HCF may be directly
involved in the process of transcription activation, instead of merely
stabilizing the transcription factor-DNA complex.
Wilson et al. (39) have suggested that the activation
or synthesis of HCF might represent an important step in the
commitment to exit G0/G1 phases of the cell
cycle and that HSV uses HCF as a sensor of the physiological state of
host cells to regulate IE gene expression. If this is indeed the case,
HSV may have evolved a mechanism to tap into one of the more conserved
and as yet little-understood triggers for the activation of genes
needed for cell division.
 |
ACKNOWLEDGMENTS |
This work was funded by an operating grant to V.M. from the
Natural Sciences and Engineering Research Council of Canada. R.L. is a
postdoctoral fellow of the Saskatchewan Health Services Utilization and
Research Commission.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Veterinary Microbiology, Western College of Veterinary Medicine,
University of Saskatchewan, 52 Campus Dr., Saskatoon, Saskatchewan S7N
5B4, Canada. Phone: (306) 966-7218. Fax: (306) 966-7244. E-mail:
misra{at}duke.usask.ca.
 |
REFERENCES |
| 1.
|
Abel, T.,
R. Bhatt, and T. Maniatis.
1992.
A Drosophila CREB/ATF transcriptional activator binds to both fat body- and liver-specific regulatory elements.
Genes Dev.
6:466-480[Abstract/Free Full Text]. (Erratum, 7:719, 1993.)
|
| 2.
|
apRhys, C. M.,
D. M. Ciufo,
E. A. O'Neill,
T. J. Kelly, and G. S. Hayward.
1989.
Overlapping octamer and TAATGARAT motifs in the VF65-response elements in herpes simplex virus immediate-early promoters represent independent binding sites for cellular nuclear factor III.
J. Virol.
63:2798-2812[Abstract/Free Full Text].
|
| 3.
|
Burbelo, P. D.,
G. C. Gabriel,
M. C. Kibbey,
Y. Yamada,
H. K. Kleinman, and B. S. Weeks.
1994.
LZIP-1 and LZIP-2: two novel members of the bZIP family.
Gene
139:241-245[Medline].
|
| 4.
|
Freiman, R. N., and W. Herr.
1997.
Viral mimicry: common mode of association with HCF by VP16 and the cellular protein LZIP.
Genes Dev.
11:3122-3137[Abstract/Free Full Text].
|
| 5.
|
Goto, H.,
S. Motomura,
A. C. Wilson,
R. N. Freiman,
Y. Nakabeppu,
K. Fukushima,
M. Fujishima,
W. Herr, and T. Nishimoto.
1997.
A single-point mutation in HCF causes temperature-sensitive cell-cycle arrest and disrupts VP16 function.
Genes Dev.
11:726-737[Abstract/Free Full Text].
|
| 6.
|
Hagmann, M.,
O. Georgiev, and W. Schaffner.
1997.
The VP16 paradox: herpes simplex virus VP16 contains a long-range activation domain but within the natural multiprotein complex activates only from promoter-proximal positions.
J. Virol.
71:5952-5962[Abstract/Free Full Text].
|
| 7.
|
Haigh, A.,
R. Greaves, and P. O'Hare.
1990.
Interference with the assembly of a virus-host transcription complex by peptide competition.
Nature
344:257-259[Medline].
|
| 8.
|
Hayes, S., and P. O'Hare.
1993.
Mapping of a major surface-exposed site in herpes simplex virus protein Vmw65 to a region of direct interaction in a transcription complex assembly.
J. Virol.
67:852-862[Abstract/Free Full Text].
|
| 9.
|
Katan, M.,
A. Haigh,
C. P. Verrijzer,
P. C. van der Vliet, and P. O'Hare.
1990.
Characterization of a cellular factor which interacts functionally with Oct-1 in the assembly of a multicomponent transcription complex.
Nucleic Acids Res.
18:6871-6880[Abstract/Free Full Text].
|
| 10.
|
Kristie, T. M.
1997.
The mouse homologue of the human transcription factor C1 (host cell factor). Conservation of forms and function.
J. Biol. Chem.
272:26749-26755[Abstract/Free Full Text].
|
| 11.
|
Kristie, T. M.,
J. H. LeBowitz, and P. A. Sharp.
1989.
The octamer-binding proteins form multi-protein-DNA complexes with the HSV alpha TIF regulatory protein.
EMBO J.
8:4229-4238[Medline].
|
| 12.
|
Kristie, T. M.,
J. L. Pomerantz,
T. C. Twomey,
S. A. Parent, and P. A. Sharp.
1995.
The cellular C1 factor of the herpes simplex virus enhancer complex is a family of polypeptides.
J. Biol. Chem.
270:4387-4394[Abstract/Free Full Text].
|
| 13.
|
Kristie, T. M., and B. Roizman.
1987.
Host cell proteins bind to the cis-acting site required for virion-mediated induction of herpes simplex virus 1 alpha genes.
Proc. Natl. Acad. Sci. USA
84:71-75[Abstract/Free Full Text].
|
| 14.
|
LaBoissière, S.,
S. Walker, and P. O'Hare.
1997.
Concerted activity of host cell factor subregions in promoting stable VP16 complex assembly and preventing interference by the acidic activation domain.
Mol. Cell. Biol.
17:7108-7118[Abstract/Free Full Text].
|
| 15.
|
Lai, J. S., and W. Herr.
1997.
Interdigitated residues within a small region of VP16 interact with Oct-1, HCF, and DNA.
Mol. Cell. Biol.
17:3937-3946[Abstract/Free Full Text].
|
| 16.
|
Lee, J. S.,
R. H. See,
K. M. Galvin,
J. Wang, and Y. Shi.
1995.
Functional interactions between YY1 and adenovirus E1A.
Nucleic Acids Res.
23:925-931[Abstract/Free Full Text].
|
| 17.
|
Livingstone, C.,
G. Patel, and N. Jones.
1995.
ATF-2 contains a phosphorylation-dependent transcriptional activation domain.
EMBO J.
14:1785-1797[Medline].
|
| 18.
|
Lu, R.,
P. Yang,
P. O'Hare, and V. Misra.
1997.
Luman, a new member of the CREB/ATF family, binds to herpes simplex virus VP16-associated host cellular factor.
Mol. Cell. Biol.
17:5117-5126[Abstract/Free Full Text].
|
| 19.
|
Marsden, H. S.,
M. E. Campbell,
L. Haarr,
M. C. Frame,
D. S. Parris,
M. Murphy,
R. G. Hope,
M. T. Muller, and C. M. Preston.
1987.
The 65,000-Mr DNA-binding and virion trans-inducing proteins of herpes simplex virus type 1.
J. Virol.
61:2428-2437[Abstract/Free Full Text].
|
| 20.
|
McKnight, J. L.,
T. M. Kristie, and B. Roizman.
1987.
Binding of the virion protein mediating alpha gene induction in herpes simplex virus 1-infected cells to its cis site requires cellular proteins.
Proc. Natl. Acad. Sci. USA
84:7061-7065[Abstract/Free Full Text].
|
| 21.
|
Misra, V.,
S. Walker,
S. Hayes, and P. O'Hare.
1995.
The bovine herpesvirus alpha gene trans-inducing factor activates transcription by mechanisms different from those of its herpes simplex virus type 1 counterpart VP16.
J. Virol.
69:5209-5216[Abstract/Free Full Text].
|
| 22.
|
Misra, V.,
S. Walter,
P. Yang,
S. Hayes, and P. O'Hare.
1996.
Conformational alteration of Oct-1 upon DNA binding dictates selectivity in differential interactions with related transcriptional coactivators.
Mol. Cell. Biol.
16:4404-4413[Abstract/Free Full Text].
|
| 23.
|
O'Hare, P.
1993.
The virion transactivator of herpes simplex virus.
Semin. Virol.
4:145-155.
|
| 24.
|
O'Hare, P., and C. R. Goding.
1988.
Herpes simplex virus regulatory elements and the immunoglobulin octamer domain bind a common factor and are both targets for virion transactivation.
Cell
52:435-445[Medline].
|
| 25.
|
O'Neil, K. T.,
R. H. Hoess, and W. F. DeGrado.
1990.
Design of DNA-binding peptides based on the leucine zipper motif.
Science
249:774-778[Abstract/Free Full Text].
|
| 26.
|
Preston, C. M.,
M. C. Frame, and M. E. Campbell.
1988.
A complex formed between cell components and an HSV structural polypeptide binds to a viral immediate early gene regulatory DNA sequence.
Cell
52:425-434[Medline].
|
| 27.
|
Roesler, W. J.,
J. Simard,
J. G. Graham, and P. J. McFie.
1994.
Characterization of the liver specific component of the cAMP response unit in the phosphoenolpyruvate carboxykinase (GTP) gene promoter.
J. Biol. Chem.
269:14276-14283[Abstract/Free Full Text].
|
| 28.
|
Rose, R. E.,
N. M. Gallaher,
D. J. Andrew,
R. H. Goodman, and S. M. Smolik.
1997.
The CRE-binding protein dCREB-A is required for Drosophila embryonic development.
Genetics
146:595-606[Abstract].
|
| 29.
|
Simmen, K. A.,
A. Newell,
M. Robinson,
J. S. Mills,
G. Canning,
R. Handa,
K. Parkes,
N. Borkakoti, and R. Jupp.
1997.
Protein interactions in the herpes simplex virus type 1 VP16-induced complex: VP16 peptide inhibition and mutational analysis of host cell factor requirements.
J. Virol.
71:3886-3894[Abstract/Free Full Text].
|
| 30.
|
Smolik, S. M.,
R. E. Rose, and R. H. Goodman.
1992.
A cyclic AMP-responsive element-binding transcriptional activator in Drosophila melanogaster, dCREB-A, is a member of the leucine zipper family.
Mol. Cell. Biol.
12:4123-4131[Abstract/Free Full Text].
|
| 31.
|
Stern, S., and W. Herr.
1991.
The herpes simplex virus trans-activator VP16 recognizes the Oct-1 homeo domain: evidence for a homeo domain recognition subdomain.
Genes Dev.
5:2555-2566[Abstract/Free Full Text].
|
| 32.
|
Stern, S.,
M. Tanaka, and W. Herr.
1989.
The Oct-1 homeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP16.
Nature
341:624-630[Medline].
|
| 33.
|
Thompson, C., and S. McKnight.
1992.
Anatomy of an enhancer.
Trends Genet.
8:232-236.
|
| 34.
|
Twamley Stein, G.,
E. Kowenz Leutz,
S. Ansieau, and A. Leutz.
1996.
Regulation of C/EBP beta/NF-M activity by kinase oncogenes.
Curr. Top. Microbiol. Immunol.
211:129-136[Medline].
|
| 35.
|
Wang, D.,
Y. Hu,
F. Zheng,
K. Zhou, and G. B. Kohlhaw.
1997.
Evidence that intramolecular interactions are involved in masking the activation domain of transcriptional activator Leu3p.
J. Biol. Chem.
272:19383-19392[Abstract/Free Full Text].
|
| 36.
|
Werstuck, G. H., and J. P. Capone.
1993.
An unusual cellular factor potentiates protein-DNA complex assembly between Oct-1 and Vmw65.
J. Biol. Chem.
268:1272-1278[Abstract/Free Full Text].
|
| 37.
|
Wilson, A. C.,
R. N. Freiman,
H. Goto,
T. Nishimoto, and W. Herr.
1997.
VP16 targets an amino-terminal domain of HCF involved in cell cycle progression.
Mol. Cell. Biol.
17:6139-6146[Abstract/Free Full Text].
|
| 38.
|
Wilson, A. C.,
K. LaMarco,
M. G. Peterson, and W. Herr.
1993.
The VP16 accessory protein HCF is a family of polypeptides processed from a large precursor protein.
Cell
74:115-125[Medline].
|
| 39.
|
Wilson, A. C.,
J. E. Parrish,
H. F. Massa,
D. L. Nelson,
B. J. Trask, and W. Herr.
1995.
The gene encoding the VP16-accessory protein HCF (HCFC1) resides in human Xq28 and is highly expressed in fetal tissues and the adult kidney.
Genomics
25:462-468[Medline].
|
| 40.
|
Wilson, A. C.,
M. G. Peterson, and W. Herr.
1995.
The HCF repeat is an unusual proteolytic cleavage signal.
Genes Dev.
9:2445-2458[Abstract/Free Full Text].
|
| 41.
|
Wu, T. J.,
G. Monokian,
D. F. Mark, and C. R. Wobbe.
1994.
Transcriptional activation by herpes simplex virus type 1 VP16 in vitro and its inhibition by oligopeptides.
Mol. Cell. Biol.
14:3484-3493[Abstract/Free Full Text].
|
| 42.
|
Xiao, P., and J. P. Capone.
1990.
A cellular factor binds to the herpes simplex virus type 1 transactivator Vmw65 and is required for Vmw65-dependent protein-DNA complex assembly with Oct-1.
Mol. Cell. Biol.
10:4974-4977[Abstract/Free Full Text].
|
J Virol, August 1998, p. 6291-6297, Vol. 72, No. 8
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Desmazieres, A., Charnay, P., Gilardi-Hebenstreit, P.
(2009). Krox20 Controls the Transcription of Its Various Targets in the Developing Hindbrain According to Multiple Modes. J. Biol. Chem.
284: 10831-10840
[Abstract]
[Full Text]
-
Misaghi, S., Ottosen, S., Izrael-Tomasevic, A., Arnott, D., Lamkanfi, M., Lee, J., Liu, J., O'Rourke, K., Dixit, V. M., Wilson, A. C.
(2009). Association of C-Terminal Ubiquitin Hydrolase BRCA1-Associated Protein 1 with Cell Cycle Regulator Host Cell Factor 1. Mol. Cell. Biol.
29: 2181-2192
[Abstract]
[Full Text]
-
Kolb, G., Kristie, T. M.
(2008). Association of the Cellular Coactivator HCF-1 with the Golgi Apparatus in Sensory Neurons. J. Virol.
82: 9555-9563
[Abstract]
[Full Text]
-
Audas, T. E., Li, Y., Liang, G., Lu, R.
(2008). A Novel Protein, Luman/CREB3 Reruitment Factor, Inhibits Luman Activation of the Unfolded Protein Response. Mol. Cell. Biol.
28: 3952-3966
[Abstract]
[Full Text]
-
Narayanan, A., Ruyechan, W. T., Kristie, T. M.
(2007). The coactivator host cell factor-1 mediates Set1 and MLL1 H3K4 trimethylation at herpesvirus immediate early promoters for initiation of infection. Proc. Natl. Acad. Sci. USA
104: 10835-10840
[Abstract]
[Full Text]
-
Jang, S.-W., Kim, Y. S., Kim, Y. R., Sung, H. J., Ko, J.
(2007). Regulation of Human LZIP Expression by NF-{kappa}B and Its Involvement in Monocyte Cell Migration Induced by Lkn-1. J. Biol. Chem.
282: 11092-11100
[Abstract]
[Full Text]
-
Liang, G., Audas, T. E., Li, Y., Cockram, G. P., Dean, J. D., Martyn, A. C., Kokame, K., Lu, R.
(2006). Luman/CREB3 Induces Transcription of the Endoplasmic Reticulum (ER) Stress Response Protein Herp through an ER Stress Response Element. Mol. Cell. Biol.
26: 7999-8010
[Abstract]
[Full Text]
-
Vogel, J. L., Kristie, T. M.
(2006). Site-specific proteolysis of the transcriptional coactivator HCF-1 can regulate its interaction with protein cofactors. Proc. Natl. Acad. Sci. USA
103: 6817-6822
[Abstract]
[Full Text]
-
Akhova, O., Bainbridge, M., Misra, V.
(2005). The Neuronal Host Cell Factor-Binding Protein Zhangfei Inhibits Herpes Simplex Virus Replication. J. Virol.
79: 14708-14718
[Abstract]
[Full Text]
-
Misra, V., Rapin, N., Akhova, O., Bainbridge, M., Korchinski, P.
(2005). Zhangfei Is a Potent and Specific Inhibitor of the Host Cell Factor-binding Transcription Factor Luman. J. Biol. Chem.
280: 15257-15266
[Abstract]
[Full Text]
-
Khurana, B., Kristie, T. M.
(2004). A Protein Sequestering System Reveals Control of Cellular Programs by the Transcriptional Coactivator HCF-1. J. Biol. Chem.
279: 33673-33683
[Abstract]
[Full Text]
-
Yokoyama, A., Wang, Z., Wysocka, J., Sanyal, M., Aufiero, D. J., Kitabayashi, I., Herr, W., Cleary, M. L.
(2004). Leukemia Proto-Oncoprotein MLL Forms a SET1-Like Histone Methyltransferase Complex with Menin To Regulate Hox Gene Expression. Mol. Cell. Biol.
24: 5639-5649
[Abstract]
[Full Text]
-
Nogueira, M. L., Wang, V. E. H., Tantin, D., Sharp, P. A., Kristie, T. M.
(2004). Herpes simplex virus infections are arrested in Oct-1-deficient cells. Proc. Natl. Acad. Sci. USA
101: 1473-1478
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2003). HCF-1 Functions as a Coactivator for the Zinc Finger Protein Krox20. J. Biol. Chem.
278: 51116-51124
[Abstract]
[Full Text]
-
Angelastro, J. M., Ignatova, T. N., Kukekov, V. G., Steindler, D. A., Stengren, G. B., Mendelsohn, C., Greene, L. A.
(2003). Regulated Expression of ATF5 Is Required for the Progression of Neural Progenitor Cells to Neurons. J. Neurosci.
23: 4590-4600
[Abstract]
[Full Text]
-
Wysocka, J., Myers, M. P., Laherty, C. D., Eisenman, R. N., Herr, W.
(2003). Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4 methyltransferase are tethered together selectively by the cell-proliferation factor HCF-1. Genes Dev.
17: 896-911
[Abstract]
[Full Text]
-
Piluso, D., Bilan, P., Capone, J. P.
(2002). Host Cell Factor-1 Interacts with and Antagonizes Transactivation by the Cell Cycle Regulatory Factor Miz-1. J. Biol. Chem.
277: 46799-46808
[Abstract]
[Full Text]
-
Mahajan, S. S., Little, M. M., Vazquez, R., Wilson, A. C.
(2002). Interaction of HCF-1 with a Cellular Nuclear Export Factor. J. Biol. Chem.
277: 44292-44299
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2002). An activation domain in the C-terminal subunit of HCF-1 is important for transactivation by VP16 and LZIP. Proc. Natl. Acad. Sci. USA
99: 13403-13408
[Abstract]
[Full Text]
-
Raggo, C., Rapin, N., Stirling, J., Gobeil, P., Smith-Windsor, E., O'Hare, P., Misra, V.
(2002). Luman, the Cellular Counterpart of Herpes Simplex Virus VP16, Is Processed by Regulated Intramembrane Proteolysis. Mol. Cell. Biol.
22: 5639-5649
[Abstract]
[Full Text]
-
Higaki, S., Gebhardt, B. M., Lukiw, W. J., Thompson, H. W., Hill, J. M.
(2002). Effect of Immunosuppression on Gene Expression in the HSV-1 Latently Infected Mouse Trigeminal Ganglion. IOVS
43: 1862-1869
[Abstract]
[Full Text]
-
Lee, S., Herr, W.
(2001). Stabilization but Not the Transcriptional Activity of Herpes Simplex Virus VP16-Induced Complexes Is Evolutionarily Conserved among HCF Family Members. J. Virol.
75: 12402-12411
[Abstract]
[Full Text]
-
Wysocka, J., Reilly, P. T., Herr, W.
(2001). Loss of HCF-1-Chromatin Association Precedes Temperature-Induced Growth Arrest of tsBN67 Cells. Mol. Cell. Biol.
21: 3820-3829
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2000). N-terminal transcriptional activation domain of LZIP comprises two LxxLL motifs and the Host Cell Factor-1 binding motif. Proc. Natl. Acad. Sci. USA
10.1073/pnas.190062797v1
[Abstract]
[Full Text]
-
Lu, R., Misra, V.
(2000). Zhangfei: a second cellular protein interacts with herpes simplex virus accessory factor HCF in a manner similar to Luman and VP16. Nucleic Acids Res
28: 2446-2454
[Abstract]
[Full Text]
-
Scarr, R. B., Smith, M. R., Beddall, M., Sharp, P. A.
(2000). A Novel 50-Kilodalton Fragment of Host Cell Factor 1 (C1) in G0 Cells. Mol. Cell. Biol.
20: 3568-3575
[Abstract]
[Full Text]
-
Mahajan, S. S., Wilson, A. C.
(2000). Mutations in Host Cell Factor 1 Separate Its Role in Cell Proliferation from Recruitment of VP16 and LZIP. Mol. Cell. Biol.
20: 919-928
[Abstract]
[Full Text]
-
Ajuh, P. M., Browne, G. J., Hawkes, N. A., Cohen, P. T. W., Roberts, S. G. E., Lamond, A. I.
(2000). Association of a protein phosphatase 1 activity with the human factor C1 (HCF) complex. Nucleic Acids Res
28: 678-686
[Abstract]
[Full Text]
-
Lu, R., Misra, V.
(2000). Potential Role for Luman, the Cellular Homologue of Herpes Simplex Virus VP16 (alpha Gene trans-Inducing Factor), in Herpesvirus Latency. J. Virol.
74: 934-943
[Abstract]
[Full Text]
-
Liu, Y., Gong, W., Huang, C. C., Herr, W., Cheng, X.
(1999). Crystal structure of the conserved core of the herpes simplex virus transcriptional regulatory protein VP16. Genes Dev.
13: 1692-1703
[Abstract]
[Full Text]
-
Johnson, K. M., Mahajan, S. S., Wilson, A. C.
(1999). Herpes Simplex Virus Transactivator VP16 Discriminates between HCF-1 and a Novel Family Member, HCF-2. J. Virol.
73: 3930-3940
[Abstract]
[Full Text]
-
Zachos, G., Clements, B., Conner, J.
(1999). Herpes Simplex Virus Type 1 Infection Stimulates p38/c-Jun N-terminal Mitogen-activated Protein Kinase Pathways and Activates Transcription Factor AP-1. J. Biol. Chem.
274: 5097-5103
[Abstract]
[Full Text]
-
Zhou, H.-J., Wong, C.-M., Chen, J.-H., Qiang, B.-Q., Yuan, J.-G., Jin, D.-Y.
(2001). Inhibition of LZIP-mediated Transcription through Direct Interaction with a Novel Host Cell Factor-like Protein. J. Biol. Chem.
276: 28933-28938
[Abstract]
[Full Text]
-
Luciano, R. L., Wilson, A. C.
(2000). N-terminal transcriptional activation domain of LZIP comprises two LxxLL motifs and the Host Cell Factor-1 binding motif. Proc. Natl. Acad. Sci. USA
97: 10757-10762
[Abstract]
[Full Text]