Previous Article | Next Article ![]()
J Virol, July 1998, p. 6215-6217, Vol. 72, No. 7
Laboratory of Immunoregulation, National
Institute of Allergy and Infectious Diseases, Bethesda, Maryland
Received 12 June 1997/Accepted 13 April 1998
Polymorphisms in the coding sequences of CCR5 and CXCR4
were studied in a group of human immunodeficiency virus (HIV)-infected long-term nonprogressors. Two different point mutations were found in
the CXCR4 coding sequence. One of these CXCR4 mutations was silent, and
each was unique to two nonprogressors. The well-described 32-bp
deletion within the CCR5 coding sequence (CCR5- The chemokine receptors CCR5 and
CXCR4 function as coreceptors for macrophage- and T-cell-line-tropic
strains of human immunodeficiency virus type 1 (HIV-1), respectively
(1, 5, 9-11, 13). A 32-bp deletion in the CCR5 gene results
in a truncated protein product that does not function as a coreceptor
(16). The defective CCR5 gene (CCR5- Participants in this study included 17 HIV-infected long-term
nonprogressors, defined as asymptomatic individuals with documented HIV
infection of at least 7 years duration, stable CD4+ T-cell
counts of >600 cells/µl, and no history of antiretroviral therapy.
Characteristics of the study population are presented in Table
1. Mononuclear cells were obtained from
peripheral blood by Ficoll-Hypaque (Organon Teknika, West Chester, Pa.)
density centrifugation. Total RNA was extracted from cells with RNAzol (Tel-Test, Friendswood, Tex.), and 2 µg was reverse transcribed with
400 U of Superscript II RNase H
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
CXCR4 and CCR5 Genetic Polymorphisms in Long-Term Nonprogressive
Human Immunodeficiency Virus Infection: Lack of Association with
Mutations other than CCR5-
32


![]()
ABSTRACT
Top
Abstract
Text
References
32) was found in 4 of
13 nonprogressors, and 12 different point mutations were found
scattered over the CCR5 coding sequence from 8 nonprogressors. Most of
the mutations created either silent or conservative changes in the
predicted amino acid sequence: only one of these mutations was found in
more than a single nonprogressor. All nonsilent mutations were tested
in an HIV envelope-dependent fusion assay, and all functioned
comparably to wild-type controls. Polymorphisms in the CXCR4 and CCR5
coding sequences other than CCR5-
32 do not appear to play a dominant
mechanistic role in nonprogression among HIV-infected individuals.
![]()
TEXT
Top
Abstract
Text
References
32) affords
near-total protection against HIV infection in homozygotes (3, 8,
14, 16, 18, 20, 22, 24, 27) and partial protection against
disease progression in HIV-infected CCR5 heterozygotes (6, 8, 12,
14, 18, 27). Other polymorphisms have been identified in the CCR5
coding sequence, although their relevance to HIV coreceptor function and rates of HIV disease progression is unknown. Two different alleles
have been identified in Asian populations, including a single base
deletion that results in a frameshift and premature stop codon in the
region of the gene encoding the C-terminal intracellular domain of CCR5
and a single base substitution causing an amino acid change in the
third intracellular loop of CCR5 (2). Another single base
substitution resulting in an amino acid change in the C-terminal
intracellular domain of CCR5 was identified in African Americans
(2). We hypothesized that, similar to the CCR5-
32
polymorphism, the frequency in the CXCR4 and CCR5 genes of other
polymorphisms that affect rates of HIV disease progression would be
enriched among HIV-infected long-term nonprogressors.
reverse transcriptase (Life Technologies, Baltimore, Md.), 40 µg of random hexamers (Pharmacia Biotech, Piscataway, N.J.)/ml, 0.8 mM (each) deoxynucleotide
triphosphate (Pharmacia), and 10 U of RNAsin (Promega Corp., Madison,
Wis.) in a volume of 50 µl at 42°C for 45 min. One-fifth of
each cDNA (10 µl) was used in each amplification reaction for
the coding sequences of CCR5 and CXCR4. The PCR mixture included a
final magnesium concentration of 2.5 mM, 200 nM (each) deoxynucleoside triphosphate (Pharmacia), 500 nM each primer, and 5 U of Expand High
Fidelity Taq polymerase (Boehringer-Mannheim, Indianapolis, Ind.) per reaction. Fifty cycles of PCR were performed as follows (per
cycle): 94°C for 15 s, 55°C for 30 s, and 72°C for
60 s. A final extension step of 72°C for 10 min was added after
the 50 PCR cycles. Forward and reverse primers were located in the 5'
and 3' untranslated regions of the CCR5 and CXCR4 mRNA as follows: CCR5
forward, 5' GCATTCATGGAGGGCAACTAAA 3'; CCR5
reverse, 5' GCCCAGGCTGTGTATGAAAACTAA 3';
CXCR4 forward, 5' AAGTGACGCCGAGGGCCTGAG 3'; and CXCR4
reverse, 5' CTGTACAATATTGGTCAGTC 3'. Full-length PCR
products were purified from 1% agarose gels by using the QIAquick
extraction kit (Qiagen, Chatsworth, Calif.). The purified PCR products
were then ligated into the pCR 2.1 vector (Invitrogen, San Diego,
Calif.) with a TA cloning kit (Invitrogen). Plasmids containing
inserts were used to transform Max Efficiency Stable 2 competent
cells (Life Technologies). Single colonies of cells resistant to
ampicillin were expanded, and DNA was extracted by an alkaline lysis
method (Wizard Plasmid Kit; Promega). DNA was sequenced with a
dye terminator DNA sequencing kit (Perkin-Elmer, Foster City,
Calif.) on an ABI PRISM 377 DNA sequencer (Perkin-Elmer).
Sequences were analyzed with Sequencer 3.0 software (Gene Codes, Ann
Arbor, Mich.). Mutations were considered relevant if they were present
in at least two independent clones from the same patient.
TABLE 1.
Characteristics of HIV-infected
long-term nonprogressors
The abilities of the mutant CXCR4 and CCR5 sequences to function as HIV
coreceptors were tested in a fusion assay as previously described
(1, 19). CXCR4 and CCR5 variants were subcloned into pcDNA3
(Invitrogen, Carlsbad, Calif.); expression in this system is driven by
both cytomegalovirus major immediate-early and T7 promoters. BSC-1
cells, which do not express HIV-1 fusion-entry cofactors
(1), were transfected with plasmids carrying CXCR4 or CCR5
variants and infected with recombinant vaccinia viruses vTF7-3
(encoding T7 polymerase) and vCB3 (encoding human CD4). Another set of
BSC-1 cells was infected with recombinant vaccinia virus vCB21R
(encoding the lacZ gene under the control of the T7
promoter) and either vCB41 (encoding the HIV-1 IIIB envelope gene) or
vCB43 (encoding the Ba-L HIV-1 envelope gene). Control experiments were performed both with BSC-1 cells transfected with vector plasmid pcDNA3 and infected with vTF7-3 and vCB3 and with another set of BSC-1 cells infected with vCB21R and vCB16
(encoding a nonfusogenic mutant HIV-1 IIIB envelope gene). Cells were
mixed at 37°C for 4 h in the presence of cytosine arabinoside
(40 µg/ml), and cell lysates were assayed for
-galactosidase
activity by measuring optical density (OD) at 570 nm. The fusion index
was calculated as the percentage of the wild-type OD at 570 nm
(13).
Seventy-four CXCR4 clones from 11 nonprogressors and 85 CCR5 clones
from 13 nonprogressors were sequenced and analyzed. Two point mutations
were identified in the CXCR4 coding sequence (Table 2). Neither of these mutations was found
in any other nonprogressor analyzed, and one was a silent
mutation. The 32-bp deletion at positions 554 to 585 (21)
of the CCR5 coding sequence (CCR5-
32) was detected in 4 of 13 (31%) patients. These four patients were previously shown
to be heterozygous for CCR5-
32 (6). Twelve point
mutations were detected in the CCR5 coding sequence from eight patients
(Table 2). Of the eight patients with point mutations, two were
heterozygous for CCR5-
32. The mutations were scattered over the CCR5
coding sequence and were all unique except for one point mutation which
occurred in two patients (c
t mutation at position 746). Most of the
point mutations created predicted amino acid changes which were
either silent or conservative. With the exception of the
CCR5-
32 mutation, no insertions, deletions, or nonsense mutations
were found.
|
Each of the nonsilent mutations in the CXCR4 and CCR5 coding sequences
was tested for the ability to support HIV envelope-dependent cell
membrane fusion. The CXCR4 variant with a t
c mutation at position
278 supported T-cell-tropic HIV-1-IIIB envelope-dependent fusion to a
degree (84%) comparable to that of the wild-type CXCR4. Similarly, all
of the CCR5 variants with nonsilent single point mutations supported
macrophage-tropic HIV-1-Ba-L envelope-dependent fusion to a degree (60 to 155%) comparable to that of the wild-type CCR5 (Fig.
1). In contrast, CCR5-
32, similar to
the negative control, failed to support fusion (Fig. 1).
|
The CCR5-
32 allele affords partial protection against disease
progression in HIV-infected CCR5-
32 heterozygotes, as indicated by
the increased frequency of this allele among HIV-infected long-term nonprogressors (6, 8, 12, 14, 18, 27). However, the
CCR5-
32 allele is clearly not the sole or even dominant factor responsible for nonprogression of HIV infection (6). We
therefore searched for other mutations in the CXCR4 and CCR5 coding
sequences that might be found at high frequencies in long-term
nonprogressors. Only one nonsilent mutation was detected in the CXCR4
coding sequence. Although point mutations were identified
scattered throughout the CCR5 coding sequence, only one of these
was found in more than a single patient. Furthermore, all of the
nonsilent CXCR4 and CCR5 mutations that were identified had no
substantial impact on HIV coreceptor function measured in a fusion
assay. The possibility that some of the putative mutations that were
identified represent PCR artifacts must also be considered. In this
regard, both of the mutations identified in the CXCR4 coding sequence,
and 7 of the 12 mutations in the CCR5 coding sequence were
identified in only two clones each. Mutations identified in 3 or
more clones each included CCR5-140 (3 of 10 clones from patient 9),
CCR5-496 (5 of 10 clones from patient 3), CCR5- 744 (4 of 8 clones from patient 13), CCR5-746 (7 of 7 clones from patient 5), and
CCR5-928 (6 of 8 clones from patient 13). These data indicate that HIV coreceptor polymorphisms other than CCR5-
32 do not play a dominant role in nonprogression among HIV-infected individuals. Other
possible mechanisms of nonprogression related to HIV coreceptors
are under investigation. In this regard, several polymorphisms in
genes encoding HIV coreceptor molecules or their ligands have
recently been shown to influence rates of HIV disease progression
(23, 25); such genetic polymorphisms and/or the
immunoregulation of these genes in certain hosts may account for
constitutive low-level expression of coreceptors (15, 23),
downregulation of coreceptor expression (4, 26), or
secretion of high levels of coreceptor ligands capable of
inhibiting cellular entry of HIV (7).
| |
ACKNOWLEDGMENTS |
|---|
O.J.C. and S.P. contributed equally to this work.
We acknowledge the kind gift of recombinant vaccinia viruses encoding HIV envelopes from E. Berger and C. Broder; the technical support of M. Gonda, J. Greenwood, and L. Rasmussen; and the editorial assistance of M. Rust and P. Walsh.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: National Institute of Allergy and Infectious Diseases, Laboratory of Immunoregulation, 10 Center Dr., MSC 1876, Bldg. 10, Rm. 11B13, Bethesda, MD 20892-1876. Phone: (301) 496-5508. Fax: (301) 402-0070. E-mail: OCohen{at}nih.gov.
Present address: Servizio di Virologia, IRCCS Policlinico San
Matteo, 27100 Pavia, Italy.
Present address: Division of AIDS, NIAID, Bethesda, MD
20892-7620.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alkhatib, G.,
C. Combadiere,
C. Broder,
Y. Feng,
P. Kennedy,
P. Murphy, and E. Berger.
1996.
CC CKR5: a RANTES, MIP-1 , MIP-1 receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2. | Ansari-Lari, M. A., X.-M. Liu, M. L. Metzker, A. R. Rut, and R. A. Gibbs. 1997. The extent of genetic variation in the CCR5 gene. Nat. Genet. 16:221-222[Medline]. |
| 3. | Biti, R., R. French, J. Young, B. Bennetts, and G. Stewart. 1997. HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Nat. Med. 3:252-253[Medline]. |
| 4. |
Bleul, C.,
L. Wu,
J. Hoxie,
T. Springer, and C. Mackay.
1997.
The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes.
Proc. Natl. Acad. Sci. USA
94:1925-1930 |
| 5. |
Choe, H.,
M. Farzan,
Y. Sun,
N. Sullivan,
B. Rollins,
P. Ponath,
L. Wu,
C. Mackay,
G. LaRosa,
W. Newman,
N. Gerard,
C. Gerard, and J. Sodroski.
1996.
The -chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates.
Cell
85:1135-1138[Medline].
|
| 6. | Cohen, O. J., M. Vaccarezza, J. Arthos, G. Lam, B. Baird, K. Wildt, P. Murphy, P. Zimmerman, T. Nutman, C. Fox, S. Hoover, J. Adelsberger, M. Baseler, R. Davey, R. Dewar, J. Metcalf, D. Schwartzentruber, J. Orenstein, S. Buchbinder, A. Saah, R. Detels, J. Phair, C. Rinaldo, J. Margolick, G. Pantaleo, and A. Fauci. 1997. Heterozygosity for a defective gene for CC chemokine receptor 5 is not the sole determinant for the immunologic and virologic phenotype of HIV-infected long term non-progressors. J. Clin. Invest. 100:1581-1589[Medline]. |
| 7. | Cohen, O. J., A. Kinter, and A. S. Fauci. 1997. Host factors in the pathogenesis of HIV disease. Immunol. Rev. 159:31-48[Medline]. |
| 8. |
Dean, M.,
M. Carrington,
C. Winkler,
G. Huttley,
M. Smith,
R. Allikmets,
J. Goedert,
S. Buchbinder,
E. Vitinghoff,
E. Gomperts,
S. Donfield,
D. Vlahov,
R. Kaslow,
A. Saah,
C. Rinaldo,
R. Detels,
Hemophilia Growth and Development Study,
Multicenter AIDS Cohort Study,
San Francisco City Clinic Cohort,
ALIVE Study, and S. O'Brien.
1996.
Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene.
Science
273:1856-1862 |
| 9. | Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. DiMarzio, S. Marmon, R. Sutton, C. Hill, C. Davis, S. Peiper, T. Schall, D. Littman, and N. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[Medline]. |
| 10. |
Doranz, B.,
J. Rucker,
Y. Yi,
R. Smyth,
M. Samson,
S. Peiper,
M. Parmentier,
R. Collman, and R. Doms.
1996.
A dual-tropic primary HIV-1 isolate that uses fusin and the -chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors.
Cell
85:1149-1158[Medline].
|
| 11. | Dragic, T., V. Litwin, G. Allaway, S. Martin, Y. Huang, K. Nagashima, C. Cayanan, P. Maddon, R. Koup, J. Moore, and W. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667-673[Medline]. |
| 12. | Eugen-Olsen, J., A. K. N. Iversen, P. Garred, U. Koppelhus, C. Pedersen, T. L. Benfield, and A. M. Sorensen. 1997. Heterozygosity for a deletion in the CKR-5 gene leads to prolonged AIDS free survival and slower CD4 T cell fall in a cohort of HIV seropositive individuals. AIDS 11:305-310[Medline]. |
| 13. | Feng, Y., C. Broder, P. Kennedy, and E. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane domain, G-protein coupled receptor. Science 272:872-877[Abstract]. |
| 14. | Huang, Y., W. Paxton, S. Wolinsky, A. Neumann, L. Zhang, T. He, S. Kang, D. Ceradini, Z. Jin, K. Yazdanbakhsh, K. Kunstman, D. Erickson, E. Dragon, N. Landau, J. Phair, D. Ho, and R. Koup. 1996. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat. Med. 2:1240-1243[Medline]. |
| 15. | Kostrikis, L. G., Y. Huang, J. P. Moore, S. M. Wolinsky, L. Zhang, Y. Guo, L. Deutsch, J. Phair, A. U. Neumann, and D. D. Ho. 1998. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter mutation. Nat. Med. 4:350-353[Medline]. |
| 16. | Liu, R., W. Paxton, S. Choe, D. Ceradini, S. Martin, R. Horuk, M. MacDonald, H. Stuhlmann, R. Koup, and N. Landau. 1996. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell 86:367-377[Medline]. |
| 17. |
Loetscher, M.,
T. Geiser,
T. O'Reilly,
R. Zwahlen,
M. Baggiolini, and B. Moser.
1994.
Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes.
J. Biol. Chem.
269:232-237 |
| 18. | Michael, N., G. Chang, L. Louie, J. Mascola, D. Dondero, D. Birx, and H. Sheppard. 1997. The role of viral phenotype and CCR-5 gene defects in HIV-1 transmission and disease progression. Nat. Med. 3:338-340[Medline]. |
| 19. | Moriuchi, H., M. Moriuchi, J. Arthos, J. Hoxie, and A. S. Fauci. 1997. Promonocytic U937 subclones expressing CD4 and CXCR4 are resistant to infection with and cell-to-cell fusion by T-cell-tropic human immunodeficiency virus type 1. J. Virol. 71:9664-9671[Abstract]. |
| 20. | O'Brien, T., C. Winkler, M. Dean, J. Nelson, M. Carrington, N. Michael, and G. White. 1997. HIV-1 infection in a man homozygous for CCR5 delta 32. Lancet 349:1219[Medline]. |
| 21. | Samson, M., O. Labbe, C. Mollereau, G. Vassart, and M. Parmentier. 1996. Molecular cloning and functional expression of a new CC-chemokine receptor gene, CC-CKR5. Biochemistry 35:3362-3367[Medline]. |
| 22. | Samson, M., F. Libert, B. Doranz, J. Rucker, C. Liesnard, C. Farber, S. Saragosti, C. Lapoumeroulie, J. Cognaux, C. Forceille, G. Muyldermans, C. Verhofstede, G. Burtonboy, M. Georges, T. Imai, S. Rana, Y. Yi, R. Smyth, R. Collman, R. Doms, G. Vassart, and M. Parmentier. 1996. Resistance to HIV-1 infection in caucasian individuals bearing mutant alleles of the CCR-5 chemokine receptor gene. Nature 382:722-725[Medline]. |
| 23. | Smith, M. W., M. Dean, M. Carrington, C. Winkler, G. A. Huttley, D. A. Lomb, J. J. Goedert, T. R. O'Brien, L. P. Jacobson, R. Kaslow, S. Buchbinder, E. Vittinghoff, D. Vlahov, K. Hoots, M. W. Hilgartner, and S. J. O'Brien. 1997. Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Science 267:959-965. |
| 24. | Theodorou, I., L. Meyer, M. Magierowska, C. Katlama, and C. Rouzioux. 1997. HIV-1 infection in an individual homozygous for CCR5 delta 32. Lancet 349:1219-1220. |
| 25. |
Winkler, C.,
W. Modi,
M. W. Smith,
G. W. Nelson,
X. Wu,
M. Carrington,
M. Dean,
T. Honjo,
K. Tashiro,
D. Yabe,
S. Buchbinder,
E. Vittinghoff,
J. J. Goedert,
T. R. O'Brien,
L. P. Jacobson,
R. Detels,
S. Donfield,
A. Willoughby,
E. Gomperts,
D. Vlahov,
J. Phair,
ALIVE Study,
Hemophilia Growth and Development Study,
Multicenter AIDS Cohort Study,
Multicenter Hemophilia Cohort Study,
San Francisco City Cohort, and S. J. O'Brien.
1998.
Genetic restriction of AIDS pathogenesis by an SDF-1 chemokine gene variant.
Science
279:389-393 |
| 26. |
Wu, L.,
W. A. Paxton,
N. Kassam,
N. Ruffing,
J. B. Rottman,
N. Sullivan,
H. Choe,
J. Sodroski,
R. A. K. W. Newman, and C. R. Mackay.
1997.
CCR5 levels and expression pattern correlate with infectability by macrophage-tropic HIV-1, in vitro.
J. Exp. Med.
185:1681-1692 |
| 27. | Zimmerman, P., A. Buckler-White, G. Alkhatib, T. Spalding, J. Kubofcik, C. Combadiere, D. Weissman, O. Cohen, A. Rubbert, G. Lam, M. Vaccarezza, P. Kennedy, V. Kumraraswami, J. Giorgi, R. Detels, J. Hunter, M. Chopek, E. Berger, A. Fauci, T. Nutman, and P. Murphy. 1997. Inherited resistance to HIV-1 conferred by an inactivating mutation in CC chemokine receptor 5: studies in populations with contrasting clinical phenotypes, defined racial backgrounds and quantified risks. Mol. Med. 3:23-36[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»