JVI Figure table search 04
Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schulte, A. M.
Right arrow Articles by Wellstein, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schulte, A. M.
Right arrow Articles by Wellstein, A.

 Previous Article  |  Next Article 

J Virol, July 1998, p. 6065-6072, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Structure and Phylogenetic Analysis of an Endogenous Retrovirus Inserted into the Human Growth Factor Gene Pleiotrophin

Anke M. Schulte and Anton Wellstein*

Lombardi Cancer Center and Department of Pharmacology, Georgetown University, Washington, D.C. 20007

Received 20 October 1997/Accepted 6 April 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A human endogenous retrovirus-like element (HERV), flanked by long terminal repeats of 502 and 495 nucleotides is inserted into the human pleiotrophin (PTN) gene upstream of the open reading frame. Based on its Glu-tRNA primer binding site specificity and the location within the PTN gene, we named this element HERV-E.PTN. HERV-E.PTN appears to be a recombined viral element based on its high homology (70 to 86%) in distinct areas to members of two distantly related HERV type C families, HERV-E and retrovirus-like element I (RTVL-I). Furthermore, its pseudogene region is organized from 5' to 3' into gag-, pol-, env-, pol-, env-similar sequences. Interestingly, full-length and partial HERV-E.PTN-homologous sequences were found in the human X chromosome, the human hereditary haemochromatosis region, and the BRCA1 pseudogene. Finally, Southern analyses indicate that the HERV-E.PTN element is present in the PTN gene of humans, chimpanzees, and gorillas but not of rhesus monkeys, suggesting that genomic insertion occurred after the separation of monkeys and apes about 25 million years ago.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Pleiotrophin (PTN) is a secreted heparin-binding polypeptide growth factor (16) with an apparent molecular mass of 18 kDa (42) and a restricted time- and tissue-dependent expression pattern during development. PTN is expressed in rodents at the highest level in the central nervous system during the perinatal period, at markedly decreased levels thereafter, and in only a few adult rodent tissues (2, 26, 29, 40). Similar patterns of expression were seen in normal human adult tissues (32); however, in various human tumor specimens and tumor cell lines, PTN is expressed at high levels (9, 33). Regarding its biological activity, PTN has growth-promoting and transforming activity on fibroblasts (4, 16) and epithelial cells (9, 42) and mitogenic activity on endothelial cells (6, 9, 15) and induces tube formation of endothelial cells and angiogenesis in vitro (15). Furthermore, PTN induces proteolytic enzyme activity from endothelial cells (14), and we recently showed that it plays an essential role for the growth, angiogenesis, and metastasis of human melanoma and the growth of human trophoblast-derived choriocarcinoma in vivo (7, 32).

Regarding its genomic organization, we recently reported that a type C human endogenous retrovirus-like (HERV) element is inserted into the human PTN gene in the intron between the 5' untranslated region and the coding region (32). This insert in the human genome expands the region relative to the murine gene, and we showed that insertion of the HERV element generated a phylogenetically new promoter within the human PTN gene. Due to this promoter function, fusion transcripts between HERV- derived 5' untranslated exons (so-called UV3, UV2, and UV1) and the intact open reading frame of PTN are expressed in the human trophoblast as early as 9 weeks after implantation, in term placenta, and in trophoblast-derived human choriocarcinoma cell lines (JEG-3 and JAR) (32) and tissues (unpublished data).

HERV elements are assumed to be prehistoric sequences from infective retroviruses that inserted into the germ line of human progenitors millions of years ago, mostly before the divergence of apes and Old World monkeys. Up to 1% of the human genome consists of solitary long terminal repeats (LTRs) and partial and complete proviral sequences. In terms of their homology to animal retroviruses, they are classified into mammalian type C (class I), type B and D and avian type C (class II) similar ERV (20, 27, 44). These ERVs are named and organized into families based on their putative tRNA primer-binding site specificity, e.g., HERV- E for Glu-tRNA, HERV- I for Ile-tRNA, and HERV- K for Lys-tRNA. The human genome contains ERVs from different families which differ in their copy numbers from 1 to 10,000 (44). These ERVs are noninfective, replication-defective retroviral fossils transmitted as stable Mendelian genes, mostly incapable of coding for the retroviral proteins Gag, Pol, and Env due to the accumulation of various mutations. Exceptions to this rule are, e.g., HTDV/HERV- K and ERV-3 (HERV- R), which are capable of expression of retroviral proteins (19, 41). Numerous authors have described retroviral transcripts in different human tissues and cell lines, preferentially of placental, embryonic, or neoplastic origin (11-13, 25, 28, 43), and some investigators have reported the identification of HERV- cellular gene fusion transcripts (8, 10, 18). However, as far as we know, only two reports of an HERV germ line insertion that induces changes in the expression pattern of a functional human gene product have been published to date. Expression of human amylase in the salivary gland is generated through the insertion of an HERV- E element in reverse orientation upstream of the human amylase genes. This retroviral element functions as a tissue-specific enhancer (31, 38). We showed that expression of the human growth factor pleiotrophin in trophoblasts and in choriocarcinoma cell lines is attributable to the insertion of an HERV- E element immediately upstream of the coding region of the gene. This insertion generates a phylogenetically new promoter, driving the expression of HERV- PTN fusion transcripts, and generates full-length, biologically active PTN protein (32).

Here we report the complete structure and phylogenetic analysis of the HERV insertion into the PTN gene. We present evidence that it is a recombinant element between HERV- E and retrovirus-like element I (RTVL-I) family members and demonstrate that closely related sequences are localized in the human X chromosome, the human hereditary haemochromatosis region, and the BRCA1 pseudogene.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Tissue and blood samples. Human term placenta was a gift from J. Simons (Georgetown University, Washington, D.C.), rhesus monkey term placenta and whole-blood samples were a gift from D. Wolf (Oregon Regional Primate Center, Beaverton, Oreg.), and whole-blood samples from night monkeys, gorillas, and chimpanzees were kindly provided by E. Davidson (Georgetown University, Washington, D.C.), Lisa Stevens (National Zoological Park, Smithsonian Institution, Washington, D.C.) and M. Jenning (New York University LEMSIP Primate Lab., Tuxedo, N.Y.), respectively.

Northern blot analysis and RT-PCR. Total RNA from placental tissues was isolated by the RNA STAT-60 method (Tel-Test, Friendswood, Tex.), and poly(A)+ RNA was isolated by using oligo(dT) cellulose as recommended by the vendor (Boehringer, Mannheim, Germany). RNA samples were separated and blotted as reported previously (17). After hybridization with a probe specific for the open reading frame of PTN (9), the membrane was washed and subjected to autoradiography (9). As a loading control, the membrane was reprobed with glyceraldehyde-3-phosphate dehydrogenase (GAPDH). For the reverse transcriptase PCR (RT-PCR), random-primed cDNA was generated from poly(A)+ RNA from rhesus monkey placenta by using the avian myeloblastosis virus reverse transcriptase (Boehringer) and oligonucleotide hexamers as recommended by the vendor. PCR was performed with an antisense oligonucleotide specific for the second translated exon O2 (5'CTGGGTCTTCATGGTTTGC3') of human PTN in combination with sense primers specific for the 5' untranslated exon U1 (5'CAGGGCGTAATTGAGTC3') or the HERV- derived 5' untranslated exon UV3 (5'CCTGACTTGCTCAGTCGATC3'). Recombinant Taq polymerase (Life Technologies, Gaithersburg, Md.) was used as recommended by the vendor.

Human DNA clones, sequencing, and data analysis. Clones G-11, G-8, and F-7 were obtained from a HindIII restriction library of the human pleiotrophin (PTN) P1 clone P2258 (Genome Systems, St. Louis, Mo.) by screening with oligonucleotides deduced from the HERV- derived 5' untranslated exons UV3 (G11 and G8; 5'CTTCACTATCTCGGTGTCTC3') and UV1 (F7; 5'CCCCCCATGCTGTGGTAACTTTAATAAATACC3') of the human PTN gene (GenBank accession no. U71455 and U71456 [32]). Clone G11-F7 was generated by PCR with P1 clone P2258 and oligonucleotides deduced from clone G11 (sense; 5'TTACTGGGCACTCTGCC3') and F7 (antisense; 5'TTGTCAGGTCAGGT GGC3') and subcloned into a TA-cloning vector (Invitrogen). Clone 1B was obtained from a BamHI restriction library of clone P2258 as reported previously (32). After unidirectional and partial bidirectional cycle sequencing with dye-labelled terminator and AmpliTaq DNA polymerase FS (Perkin-Elmer, Foster City, Calif.), BLAST and FastA GenBank searches were performed. The program DNA Strider was used to define open reading frames and restriction sites, and Mac Vector was used to generate dot plot matrix analysis.

DNA isolation, Southern analysis, probes, and PCR. Genomic DNA from whole blood, tissues, or cultured cells was isolated with the QIAmp blood kit (Qiagen Inc, Chatsworth, Calif.), digested with BamHI or HindIII, separated in a 0.7% agarose gel (10 or 20 µg), transferred to a nylon membrane (Magnacharge; MSI, Westboro, Mass.), and hybridized in 10% dextran sulfate-supplemented formamide standard solution (17) at 42°C. After hybridization, the blots were washed under low-stringency hybridization conditions twice with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate) 0.1% sodium dodecyl sulfate (SDS), twice with 0.1× SSC-0.1% SDS for 15 min at 42°C, and once with 0.1× SSC-0.1% SDS at 62°C for 15 min. For high stringency hybridization, two washes with 0.1× SSC-0.1% SDS for 25 min at 65°C were also performed. Hybridizations were performed with various random-primed labelled DNA probes (Rediprime; Amersham, Arlington Heights, Ill.): probe a, a 632-nucleotide (nt) PCR fragment, containing 602 nt of cellular sequence upstream of the HERV- E.PTN plus 30 nt of 5' LTR sequence (Fig. 1A, positions -11869 to -11238 in reference 32); probe b, an 826-nt ScaI-KpnI restriction fragment isolated from the P2258 subclone G11 (Fig. 1A and B, positions 2439 to 3262); and probe c, a 406-nt KpnI-HindIII restriction fragment isolated from P2258 subclone G11 (Fig. 1A and B, positions 3262 to 3667). PCRs were performed with recombinant Taq polymerase (Life Technologies) as recommended by the vendor.


View larger version (13K):
[in this window]
[in a new window]
 


View larger version (33K):
[in this window]
[in a new window]
 


View larger version (80K):
[in this window]
[in a new window]
 
FIG. 1.   Organization of the human PTN gene, location of the HERV- E.PTN, its complete sequence, and homologies. (A) Mapping and partial restriction map of the HERV- E.PTN. The PTN open reading frame exons (O1 to O4), 5' untranslated region exons (U1 and U2), HERV- derived exons (UV1 to UV3), and HERV element are boxed. The characterized region of the P1 clone P2258, the BamHI (1B) and HindIII (G11, F7, and G8) subclones, and the PCR clone (G11-F7) is enlarged. The genomic Southern blot probes (a, b, and c) and restriction sites are shown (B, BamHI; H, HindIII; Sc, ScaI; K, KpnI). (B) Nucleotide sequence of HERV- E.PTN and its homology to other ERVs. The 6,337-nt HERV- E.PTN is numbered continuously from 5' to 3', the flanking sequences are shown in lowercase letters, the LTRs are labelled and marked at their borders, and the putative tRNAGlu primer-binding site is shown. The short translated amino acid sequences similar to Gag and Env fragments are shown beneath the nucleotide sequence (***, stop codons). The HERV- derived exons of the human PTN gene are boxed (UV3, UV2, and UV1). Boxed regions I, II, and III are similar to other GenBank entries (I, HERV- E; II, RTVL-I; III, X-chromosome PAC clone 215K18 and hHH region) as discussed in the text. The 5' end of the HERV- E.PTN sequence corresponds to position -11267 in reference 32. (C) Comparison of the LTR sequences. Dots represent identity, dashes indicate spacing introduced for optimal alignment, and differing nucleotides are indicated. Putative U3, R, and U5 regions (boundaries are indicated by ddager ), the putative retroviral TATA box (ATTTTAA) and polyadenylation signal (ATTAAA), and the tRNAGlu primer-binding sites downstream of the 5' LTR are shown. (D) HERV- E.PTN flanking sequences. The underlined nucleotides indicate the predicted TATA boxes of the HERV- derived promoter of the human PTN gene and the defined transcription start site of the HERV- PTN fusion transcript.

Nucleotide sequence accession number. The HERV- E.PTN sequence reported in this paper has been deposited in the GenBank database (accession no. AF058907).

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Sequence and structure of the retrovirus-like element HERV- E.PTN. To complete the analysis of the structure and sequence of the endogenous retrovirus-like (ERV) element integrated into the human PTN gene, we used P1 clone P2258. Initially, a HindIII restriction library of the P1 clone was screened with oligonucleotides specific for the HERV- derived 5' untranslated exons UV3 and UV1 (Fig. 1A). By using the UV3-specific probe, two clones, G11 (4,925 nt) and G8 (4,932 nt) were picked due to their hybridization with the 5' and 3' LTR, respectively. Clone G11 overlaps with the previously reported 1.9-kb HindIII- BamHI (HB) fragment (32) and extends it by 3,043 nt downstream. Clone G8 extends the virus-like sequence downstream of the HindIII site in exon UV1, including the 3' LTR (2,209 nt) and an additional 2,723-nt intronic sequence. By using the UV1-specific probe, clone F7 (356 nt) was picked, which extends the sequence upstream of the HindIII site in exon UV1. To bridge the gap between clones G11 and F7, PCR was used (clone G11-F7, 105 nt).

Figure 1B shows the nucleotide sequence and structural analysis derived therefrom. The 6,337-nt ERV element with LTRs of 502 and 495 nt is integrated into the human PTN gene. Based on its similarity to other ERVs, it belongs to the class I group (see below). Its tRNA primer-binding site suggests that it is a new member of the HERV- E family (17-of-18-nt match to the 3' end of rat glutamic acid tRNA [Fig. 1B] [32, 34]). The sequence TTTCT separates the prehistoric primer-binding site from the 5' LTR, as observed in the HERV- E members 4-1 and 4-14 (30). Accordingly, we named this element HERV- E.PTN.

In this HERV- E.PTN insert, exon UV3 covers the complete 5' LTR plus 2 nt of upstream and 28 nt of downstream sequence. Exon UV2 (239 nt) starts 6 nt downstream from exon UV3, and exon UV1 (488 nt) is localized 3,271 nt downstream from exon UV2 (Fig. 1B), considerably closer than the 4.5 kb we had estimated from gel electrophoresis of various long-range PCR products (32).

Similarity to ERVs from different families. The HERV- E.PTN is separated into areas with high similarity to members of the HERV- E and HERV- I or RTVL-I family. The first 1,516 and the last 2,576 nt are up to 82% homologous to members of the HERV- E family (boxes I in Fig. 1B; GenBank accession no. M32220 and M32219 [39] and K02168 [30]). Compared to the provirus sequence of clone 4-1, the HERV- E.PTN underwent two major deletions in its 4-1-similar region, of 1,619 and 651 nt in the pol and env pseudogene regions, respectively. The middle part of the HERV- E.PTN contains 65- and 741-nt sequence stretches with 86 and 70% homology to the pol and env pseudogene regions of an RTVL-I member, respectively (boxes II, Fig. 1B; GenBank accession no. M92068 [22]). Despite the shortness of the 65-nt sequence, its high homology to a region in the RTVL-Ib pol pseudogene supports its RTVL-Ib origin. Interestingly, a 65-nt sequence of the human X chromosome also shows a similar (87%) homology (see below), and nucleotide alignment studies suggest that an HERV- E.PTN-similar element is also inserted into this locus (see below). Figure 2 shows the respective dot plot matrices comparing the HERV- E.PTN with HERV- E clone 4-1 and RTVL-Ib (Fig. 2A), as well as a diagram of the organization of the HERV- E.PTN pseudogene region (Fig. 2E).


View larger version (39K):
[in this window]
[in a new window]
 


View larger version (36K):
[in this window]
[in a new window]
 


View larger version (38K):
[in this window]
[in a new window]
 


View larger version (8K):
[in this window]
[in a new window]
 


View larger version (18K):
[in this window]
[in a new window]
 
FIG. 2.   (A) Dot plot matrix analysis of HERV- E.PTN relative to sequences from the HERV- E clone 4-1 and RTVL-Ib. The x axis shows HERV- E.PTN; the y axes show HERV- E clone 4-1 (GenBank accession no. K02168) and RTVL-Ib (GenBank accession no. M92068). Window size, 30; hash value, 2; homology, 70%. The organization of the pseudogene region of the HERV- E clone 4-1 and the RTVL-Ib is indicated on the right ordinate. (B) Dot plot matrix analysis of HERV- E.PTN relative to sequences from the human X-chromosome PAC clone 215K18, the hHH region, and the BRCA1 pseudogene, and dot plot matrix analysis of HERV- E clone 4-1 relative to the sequence from the human X chromosome PAC clone 215K18. The x axis shows HERV- E.PTN or HERV- E clone 4-1 (Genbank accession no. K02168); the y axes show HERV- E clone 4-1, RTVL-Ib (GenBank accession no. M92068), PAC 215K18 (GenBank accession no. Z83820), hHH region (GenBank accession no. U91328), and BRCA1 pseudogene (GenBank accession no. U77841). Window size, 30; hash value, 2; homology, 70%. The organization of the BRCA1 pseudogene is indicated on the right ordinate. (C) Dot plot matrix analysis of the BRCA1 pseudogene relative to HERV- E.PTN and HERV- E clone 4-1. The x axis shows the BRCA1 pseudogene (GenBank accession no. U77841; positions 2500 to 4098); the y axes show HERV- E.PTN (positions 1 to 2000) and HERV- E clone 4-1 (positions 1 to 2000). Window size, 30; hash value, 2; homology, 90%. (D) The HERV- E.PTN-homologous region in the BRCA1 locus. Arrows represent the direction of transcription, shaded boxes represent exons from BRCA1 and pseudo-BRCA1 genes (1A, 1B, 2, and 3), open boxes symbolize the NBR2 (next to BRCA1 gene 2; formerly known as pseudogene 1A1-3B [~30 kb]) and NBR1 (formerly known as gene 1A1-3B) genes. The solid box represents the recently sequenced HERV- E.PTN-homologous region (1,243 nt) in the pseudo-BRCA1 gene. The genomic organization, restriction enzyme sites (E, EcoRI; H, HindIII; P, PstI), and size (kilobases) of restriction fragments are adapted from references 3 and 45. This diagram is not drawn to scale. (E) Diagram of the structure of HERV- E.PTN based on retroviral pseudogenes.

Similarity to sequences in the human X chromosome, the hHH region, and the BRCA1 pseudogene. Despite some deleted and inserted areas, the entire HERV- E.PTN element is ~80% homologous to a 9.7-kb region in the human X chromosome (GenBank accession no. Z83820; PAC clone 215K18) and to a 6.5-kb area in the human hereditary hemochromatosis (hHH) region (GenBank accession no. U91328; Fig. 1B, box III, and Fig. 2A). Interestingly, the sequence comparison revealed that the respective regions in the X chromosome and the hHH region are more homologous to each other than they are to the HERV- E.PTN sequence, and their similarity is extended upstream and downstream of their HERV- E.PTN homology (data not shown). This suggests that the recombinant HERV- E.PTN element inserted into the human PTN gene en bloc and that the insertion happened more recently than the recombination. Surprisingly, we also found an 80% homology between the 5' end of HERV- E.PTN and a newly published 1.3-kb stretch of intronic sequence immediately downstream of exon 2 in the BRCA1 pseudogene (GenBank accession no. U77841; Fig. 2A [3]). Furthermore, dot plot matrix analysis show a higher homology to the 5' end of HERV- E.PTN than to the corresponding region in HERV- E clone 4-1 (Fig. 2C). The similar organization of the BRCA1 gene and pseudogene around exons 1A, 1B, and 2 indicates that the HERV- E.PTN-like sequence is inserted into both copies of BRCA1 (Fig. 2D).

LTRs and the integration site. The HERV- E.PTN 5' LTR encompasses the first 502 nt, and the 3' LTR (495 nt) starts 5,341 nt downstream. The 3' LTR shows differences from the 5' LTR at 56 nt (17 deletions, 10 insertions, and 29 exchanges) which results in a homology of 89%. Based on the U3-R-U5 organization of retroviral LTRs (37), the HERV- E.PTN LTRs are organized in a putative 440- or 426-nt U3, 23-nt R, and 39- or 46-nt U5 sequence in the 5' and 3' LTR, respectively (Fig. 1C). The highest aberration between the two LTRs is localized in the U5 region (12 nt), and sequence comparison to members of the HERV- E family showed a lower homology for the 5' LTR U5 region (e.g., 59 versus 89% for the 5' LTR U5 region of HERV- E clone 4-1). Compared with a solitary LTR of the HERV- E family, LTR22 is 60 and 65% homologous to regions in the HERV- E.PTN 5' LTR and 3' LTR, respectively (GenBank accession no. M32220 [39]). Furthermore, the last 205 and 211 nt of the 5' or 3' LTR of HERV- E.PTN have a 61 and 69% homology to the 5' LTR of HERV- E clone 4-1, respectively. Overall, the HERV- E.PTN LTRs have a scattered homology to different regions of different HERV- E LTRs (also see reference 32).

Regarding the integration site, the direct repeated DNA adjacent to the HERV- E.PTN differs from provirus integration sites. Whereas direct repeats contain 4 to 6 nt in different provirus species (1, 5), a 123-nt sequence upstream of the 5' LTR is directly repeated downstream of the 3' LTR (Fig. 1B).

Open reading frames. Relevant open reading frames coding for the viral proteins Gag, Pol, or Env are not present in this fossil of a retrovirus. Starting 671 and 3916 nt downstream from the 5' LTR, retroviral Gag and Env protein-like reading frames extend only for 267 and 123 nt, respectively (Fig. 1B).

Phylogenetic analysis. Based on the similarity of HERV- E.PTN to different ERVs and the organization of its pseudogene coding region, we assume that this element is a product of a recombination between a member of the HERV- E and the RTVL-I family.

Southern analysis of BamHI-digested human, gorilla, rhesus monkey (Old World monkey), night monkey (New World monkey), and mouse genomic DNA probed with a fragment containing the RTVL-I env-similar sequence (probe b, Fig. 1A) showed a similar pattern of bands (~20 bands) in human, gorilla, and rhesus monkey DNA (Fig. 3B). As expected, no hybridization signal was detected in mouse DNA, but New World monkey DNA showed three bands at low stringency (Fig. 3A). Southern analysis with a probe corresponding to a different RTVL-I env-similar region (probe c, Fig. 1A) confirmed the hybridization signal in New World monkey DNA (data not shown). We conclude from this that RTVL-I-related elements are inserted into the germ line of New World monkeys and that the genomes of apes and Old World monkeys harbor RTVL-I env-like elements similar to humans.


View larger version (61K):
[in this window]
[in a new window]
 
FIG. 3.   Southern blot hybridization of BamHI-digested genomic DNA with a probe corresponding to the RTVL-I env-similar region (probe b, Fig. 1A). (A) Low-stringency wash (20 µg of DNA). (B) High-stringency wash (10 µg of human and gorilla DNA; 20 µg of rhesus monkey, night monkey [NWM], and mouse DNA).

To define if the HERV- E.PTN is present in PTN genes of nonhuman primates, we performed Southern analysis of BamHI- and/or HindIII-digested human, chimpanzee, gorilla, and rhesus monkey genomic DNA. Based on the human PTN gene structure and restriction map (Fig. 1A), we expected an 8.5-kb BamHI hybridization signal and a 4.9-kb HindIII hybridization signal when using a probe specific for the human intronic sequence immediately upstream of the HERV- E.PTN element (probe a, Fig. 1A). Indeed, a single ~8.5-kb BamHI fragment or 4.9-kb HindIII fragment was detected in human as well as in gorilla DNA (Fig. 4). Chimpanzee DNA, tested after HindIII digestion, also showed the 4.9-kb band in addition to a ~7.5-kb fragment of similar intensity (Fig. 4B). In contrast, the rhesus monkey analysis showed a single ~12-kb BamHI fragment and a single ~2.2-kb HindIII fragment (Fig. 4). Since both enzymes cut inside as well as outside of the HERV- E.PTN insertion, we conclude from this dramatic change in the restriction map of rhesus monkey versus ape DNA that the HERV is not inserted into the rhesus monkey PTN gene. In addition, Northern analysis performed with mRNA from rhesus monkey placenta failed to detect the PTN transcript, in contrast to the strong PTN signal obtained with total RNA from human placenta (Fig. 4C). RT-PCR analysis of rhesus monkey placenta mRNA showed that low levels of PTN mRNA are transcribed from the promoter upstream of the 5' untranslated exon U1. However, this analysis did not show the PTN fusion transcript expected from the HERV- E.PTN insertion. In agreement with our data for human placenta RNA, where we found a 10:1 ratio of HERV- PTN to U1-PTN mRNA (32), these data also support the notion that HERV- E.PTN is not inserted into the rhesus PTN gene.


View larger version (32K):
[in this window]
[in a new window]
 
FIG. 4.   HERV- E.PTN is localized in the human, chimpanzee, and gorilla PTN gene. Southern analysis with BamHI-digested (A) or HindIII-digested (B) genomic DNA with a probe corresponding to the sequence upstream of the HERV- E.PTN plus 30 nt of 5' LTR sequence (probe a, Fig. 1A) is shown. Loading: 10 µg of human DNA in panel A, 20 µg in panel B; 10 µg of gorilla DNA in panel A, 20 µg in panel B; 20 µg of rhesus monkey DNA; 20 µg of chimpanzee DNA; 20 µg of rat DNA. (C) Northern analysis with 20 µg of total RNA from human placenta and 10 µg of poly(A)+ RNA from rhesus monkey placenta.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Here we report the complete structure and evolutionary history of HERV inserted into the human PTN gene (32). Based on its tRNA primer-binding site specificity and its location between the 5'-untranslated region and coding region of the human PTN gene, we named this element HERV- E.PTN. It is flanked by LTRs of 502 and 495 nt and shows no relevant open reading frames for the retroviral proteins Gag, Pol, and Env. The HERV- E.PTN represents a noninfective, replication-defective retroviral element with 70 to 86% homology to members of the HERV- E or the RTVL-I family (two distantly related ERV families of the MLV (murine leukemia virus) genus). Furthermore, it is found in the human genome in connection with at least four different genes or genetic loci, i.e., PTN, the X chromosome (PAC clone 215K18), the hHH region, and the BRCA1 pseudogene (Fig. 2).

Two members of the HERV- E family (clones 4-1 and 4-14) were originally isolated by two successive cross-species genomic library screenings under low-stringency hybridization conditions with probes from the murine leukemia virus (MLV) and the African green monkey endogenous retrovirus (24). The human genome is estimated to contain up to 50 copies of full-length and truncated members of this family (36). The RTVL-I family was identified by chance during the analysis of the haptoglobin-related gene locus. Its members are less homologous to mammalian type C retroviruses (21). Members of the HERV- E and RTVL-I families have been detected in the genomes of Old World monkeys, apes, and humans (22, 30), and PCR analysis revealed that the HERV- E (clone 4-14) and RTVL-Ia elements are present in at least one identical location in these primates (35). Therefore, these retroviruses inserted into the primate germ line before the divergence of apes and Old World monkeys, an event estimated to have occurred some 25 million years ago.

Our findings are consistent with the notion that the HERV- E.PTN and its closely related elements on the human X chromosome and in the hHH represent recombined elements generated between HERV- E and RTVL-I family members. The organization of HERV- E.PTN does not match the typical retrovirus genome organization of gag, pol, and env but instead has pol- and env-like sequences from RTVL-I inserted between gag- and pol-like sequences of HERV- E (Fig. 2). The possibility that the human genome harbors recombinant elements containing the RTVL-I env-like region was suggested previously by Wilkinson et al. (44). Southern analysis and screening of a genomic library showed an up to threefold-higher copy number for the 3' end of RTVL-I elements in the human genome than for the 5' end (25 and 8 copies, respectively [22]). By using a probe from the RTVL-I env-similar sequence (3' end) of HERV- E.PTN, our genomic Southern blots revealed a hybridization pattern in ape (gorilla) and Old World monkey (rhesus) DNA similar to that in human DNA (Fig. 3). We conclude from this that the genomes of gorillas and rhesus monkeys harbor recombinant elements that contain the RTVL-I env-like region, as does the human genome, and it is tempting to speculate that HERV- E.PTN recombinant precursors may already be present in the rhesus monkey genome. In addition, we show that RTVL-I-related retroviruses were already inserted in the germ line of New World monkeys at least 45 million years ago. Recently, Martin et al. (23) reported the identification of RTVL-I-related retroviruses even in lower vertebrates like reptiles and fish.

It is difficult to formally prove that the HERV- E.PTN element inserted into the human PTN gene en bloc, instead of being formed by recombination of an already inserted HERV- E element with an RTVL-I member in loco. However, sequence comparisons and structural similarity between HERV- E.PTN and its related elements on the human X chromosome and in the hHH region make parallel and independent germ line recombination events between HERV- E and RTVL-I members in these different loci rather unlikely. Furthermore, the HERV- E.PTN-similar elements on the X chromosome and the hHH region are more similar to each other than they are to the HERV- E.PTN sequence. This suggests that the insertion of HERV- E.PTN into the PTN gene was a more recent event.

Surprisingly, in the HERV- E.PTN-flanking sequences, a 123-nt region upstream of the 5' LTR is directly repeated downstream of the 3' LTR (Fig. 1D). This is in contrast to the situation for other proviral DNAs, which are typically flanked by direct repeats of only 4 to 6 nt (1, 5). We cannot explain the origin of the 123-nt direct repeat, but we find it rather unlikely that the sequence repetition was generated through integrase-mediated integration of retroviral DNA.

From the Southern analysis and the fact that chimpanzees are phylogenetically closer to humans than to gorillas, we conclude that the HERV- E.PTN is present in the PTN gene of humans, chimpanzees, and gorillas. However, in the HindIII- digested chimpanzee genomic DNA, an additional band of ~7.5 kb hybridized to the probe corresponding to the human 5' upstream sequence of the HERV- E.PTN (Fig. 1A, probe a; Fig. 4B). Hybridization with a probe specific for the coding region of the human PTN gene showed a single band, excluding an amplification of the entire PTN locus in this chimpanzee (data not shown). We conclude that a duplication of unknown size, containing the PTN intronic sequence upstream of the corresponding chimpanzee HERV- E.PTN but excluding the PTN coding region, is most probably present in this chimpanzee genome.

Finally, a comparison of hybridization signals between human and ape versus rhesus monkey DNA shows different hybridization patterns after BamHI or HindIII digestion (Fig. 4). Furthermore, Northern analysis as well as RT-PCR studies with poly(A)+ RNA from rhesus monkey placenta tissue did not show HERV- PTN fusion transcripts (Fig. 4C). Our studies thus indicate that the HERV- E.PTN entered the PTN gene of nonhuman primates after the divergence of apes and Old World monkeys (Fig. 5).


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 5.   Evolutionary tree and proposed time point of the HERV- E.PTN insertion into the PTN gene.

In conclusion, we have reported the complete structural and phylogenetic analysis of the human endogenous retrovirus HERV- E.PTN inserted into the human growth factor gene pleiotrophin. We show evidence that the HERV- E.PTN is a recombined element of two distantly related HERV type C families, HERV- E and RTVL-I, and that closely related elements are localized in the human X chromosome, in the hHH region, and in a recently sequenced region of the BRCA1 pseudogene.

    ACKNOWLEDGMENTS

We thank Achim Aigner, Frank Czubayko, Heinz Joachim List, and Anna Tate Riegel for helpful discussions and support; and we thank L. Stevenson, E. Davidson, M. Jenning, and D. Wolf for providing the primate blood and tissue samples.

This work was supported by SPORE grant CA58185 from the National Cancer Institute, NIH, and by the U.S. Army Medical Research and Material Command Breast Cancer Program under DAMD-17-94-J-4445 to A.W.

    FOOTNOTES

* Corresponding author. Mailing address: Lombardi Cancer Center, Georgetown University, Research Building E311, 3970 Reservoir Rd. N.W., Washington, D.C. 20007. Phone: (202) 687-3672. Fax: (202) 687- 4821. E-mail: wellstea{at}gunet.georgetown.edu.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Andrake, M. D., and A. M. Skalka. 1996. Retroviral integrase, putting the pieces together. J. Biol. Chem. 271:19633-19636[Free Full Text].
2. Bloch, B., E. Normand, I. Kovesdi, and P. Böhlen. 1992. Expression of the HBNF (heparin-binding neurite-promoting factor) gene in the brain of fetal, neonatal and adult rat: an in situ hybridization study. Dev. Brain Res. 70:267-278[Medline].
3. Brown, M. A., X. Chun-Fang, H. Nicolai, B. Griffiths, J. A. Chambers, D. Black, and E. Solomon. 1996. The 5'-end of the BRCA1 gene lies within a duplicated region of human chromosome 17q21. Oncogene 12:2507-2513[Medline].
4. Chauhan, A. K., Y. S. Li, and T. F. Deuel. 1993. Pleiotrophin transforms NIH3T3 cells and induces tumors in nude mice. Proc. Natl. Acad. Sci. USA 90:679-682[Abstract/Free Full Text].
5. Chen, H. R., and W. C. Barker. 1984. Nucleotide sequences of the retroviral long terminal repeats and their adjacent regions. Nucleic Acids Res. 12:1767-1778[Abstract/Free Full Text].
6. Courty, J., M. C. Dauchel, D. Caruelle, M. Perderiset, and D. Barritault. 1991. Mitogenic properties of a new endothelial cell growth factor related to pleiotrophin. Biochem. Biophys. Res. Commun. 180:145-151[Medline].
7. Czubayko, F., A. M. Schulte, G. J. Berchem, and A. Wellstein. 1996. Melanoma angiogenesis and metastasis modulated by ribozyme targeting of the secreted growth factor pleiotrophin. Proc. Natl. Acad. Sci. USA 93:14753-14758[Abstract/Free Full Text].
8. Di Cristofano, A., M. Strazullo, L. Longo, and G. La Mantia. 1995. Characterization and genomic mapping of the ZNF80 locus: expression of this zinc-finger gene is driven by a solitary LTR of ERV9 endogenous retroviral family. Nucleic Acids Res. 23:2823-2830[Abstract/Free Full Text].
9. Fang, W., N. Hartmann, D. T. Chow, A. T. Riegel, and A. Wellstein. 1992. Pleiotrophin stimulates fibroblasts and endothelial and epithelial cells and is expressed in human cancer. J. Biol. Chem. 267:25889-25897[Abstract/Free Full Text].
10. Feuchter-Murthy, A. E., J. D. Freeman, and D. L. Mager. 1993. Splicing of a human endogenous retrovirus to a novel phospholipase A2 related gene. Nucleic Acids Res. 21:135-143[Abstract/Free Full Text].
11. Gattoni-Celli, S., K. Kirsch, S. Kalled, and K. J. Isselbacher. 1986. Expression of type C-related endogenous retroviral sequences in human colon tumors and colon cancer cell lines. Proc. Natl. Acad. Sci. USA 83:6127-6131[Abstract/Free Full Text].
12. Herbst, H., M. Sauter, and N. Mueller-Lantzsch. 1996. Expression of human endogenous retrovirus K elements in germ cell and trophoblastic tumors. Am. J. Pathol. 149:1727-1735[Abstract].
13. Johansen, T., T. Holm, and E. Bjorklid. 1989. Members of the RTVL-H family of human endogenous retrovirus-like elements are expressed in placenta. Gene 79:259-267[Medline].
14. Kojima, S., T. Inui, H. Muramatsu, H. Kimuara, S. Sakakibara, and T. Muramatsu. 1995. Midkine is a heat and acid stable polypeptide capable of enhancing plasminogen activator activity and neurite outgrowth extension. Biochem. Biophys. Res. Commun. 216:574-581[Medline].
15. Laaroubi, K., J. Delbe, F. Vacherot, P. Desgranges, M. Tardieu, M. Jaye, D. Barritault, and J. Courty. 1994. Mitogenic and in vitro angiogenic activity of human recombinant heparin affin regulatory peptide. Growth Factors 10:89-98[Medline].
16. Li, Y. S., P. G. Milner, A. K. Chauhan, M. A. Watson, R. M. Hoffman, C. M. Kodner, J. Milbrandt, and T. F. Deuel. 1990. Cloning and expression of a developmentally regulated protein that induces mitogenic and neurite outgrowth activity. Science 250:1690-1694[Abstract/Free Full Text].
17. Liaudet-Coopman, E. D. E., A. M. Schulte, M. Cardillo, and A. Wellstein. 1996. A tetracycline-responsive promoter system reveals the role of a secreted binding protein for FGFs during the early phase of tumor growth. Biochem. Biophys. Res. Commun. 229:930-937[Medline].
18. Liu, A. Y., and B. A. Abraham. 1991. Subtractive cloning of a human endogenous retrovirus and calbindin gene in the prostate cell line PC3. Cancer Res. 51:4107-4110[Abstract/Free Full Text].
19. Loewer, R., K. Boller, B. Hasenmaier, C. Korbmacher, N. Mueller-Lantzsch, J. Loewer, and R. Kurth. 1993. Identification of human endogenous retroviruses with complex mRNA expression and particle formation. Proc. Natl. Acad. Sci. USA 90:4480-4484[Abstract/Free Full Text].
20. Loewer, R., J. Loewer, and R. Kurth. 1996. The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences. Proc. Natl. Acad. Sci. USA 93:5177-5184[Abstract/Free Full Text].
21. Maeda, N. 1985. Nucleotide sequence of the haptoglobin and haptoglobin-related gene pair. J. Biol. Chem. 260:6698-6709[Abstract/Free Full Text].
22. Maeda, N., and H. S. Kim. 1990. Three independent insertions of retrovirus-like sequences in the haptoglobin gene cluster of primates. Genomics 8:671-683[Medline].
23. Martin, J., E. Herniou, J. Cook, R. Waugh O'Neill, and M. Tristem. 1997. Human endogenous retrovirus type I-related viruses have an apparently widespread distribution within vertebrates. J. Virol. 71:437-443[Abstract].
24. Martin, M. A., T. Bryan, T. F. McCutchan, and H. W. Chan. 1981. Detection and cloning of murine leukemia virus-related sequences from African Green monkey liver DNA. J. Virol. 39:835-844[Abstract/Free Full Text].
25. Medstrand, P., and J. Blomberg. 1993. Characterization of novel reverse transcriptase-encoding human endogenous retroviral sequences similar to type A and type B retroviruses: differential transcription in normal human tissues. J. Virol. 67:6778-6787[Abstract/Free Full Text].
26. Merenmies, J., and H. Rauvala. 1990. Molecular cloning of the 18-kDa growth-associated protein of developing brain. J. Biol. Chem. 265:16721-16724[Abstract/Free Full Text].
27. Patience, C., D. A. Wilkinson, and R. A. Weiss. 1997. Our retroviral heritage. Trends Genet. 13:116-120[Medline].
28. Rabson, A. B., P. E. Steele, C. F. Garon, and M. A. Martin. 1983. mRNA transcripts related to full-length endogenous retroviral DNA in human cells. Nature 306:604-607[Medline].
29. Rauvala, H. 1989. An 18-kd heparin-binding protein of developing brain that is distinct from fibroblast growth factors. EMBO J. 8:2933-2941[Medline].
30. Repaske, R., P. E. Steele, R. R. O'Neill, A. B. Rabson, and M. A. Martin. 1985. Nucleotide sequence of a full-length human endogenous retroviral segment. J. Virol. 54:764-772[Abstract/Free Full Text].
31. Samuelson, L. C., K. Wiebauer, C. M. Snow, and M. H. Meisler. 1990. Retroviral and pseudogene insertion sites reveal the lineage of human salivary and pancreatic amylase genes from a single gene during primate evolution. Mol. Cell. Biol. 10:2513-2520[Abstract/Free Full Text].
32. Schulte, A. M., S. Lai, A. Kurtz, F. Czubayko, A. T. Riegel, and A. Wellstein. 1996. Human trophoblast and choriocarcinoma expression of the growth factor pleiotrophin attributable to germ-line insertion of an endogenous retrovirus. Proc. Natl. Acad. Sci. USA 93:14759-14764[Abstract/Free Full Text].
33. Schulte, A. M., and A. Wellstein. 1997. Pleiotrophin and related molecules, p. 273-289. In R. Bicknell, C. M. Lewis, and N. Ferrara (ed.), Tumour angiogenesis. Oxford University Press, Oxford, United Kingdom.
34. Sekiya, T., Y. Kuchino, and S. Nishimura. 1981. Mammalian tRNA genes: nucleotide sequences of rat genes for tRNAAsp, tRNAGly and tRNAGlu. Nucleic Acids Res. 9:2239-2250[Abstract/Free Full Text].
35. Shih, A., E. E. Coutavas, and M. G. Rush. 1991. Evolutionary implications of primate endogenous retroviruses. Virology 182:495-502[Medline].
36. Steele, P. E., A. B. Rabson, T. Bryan, and M. A. Martin. 1984. Distinctive termini characterize two families of human endogenous retroviral sequences. Science 225:943-947[Abstract/Free Full Text].
37. Temin, H. M. 1981. Structure, variation and synthesis of retrovirus long terminal repeat. Cell 27:1-3[Medline].
38. Ting, C. N., M. P. Rosenberg, C. M. Snow, L. C. Samuelson, and M. H. Meisler. 1992. Endogenous retroviral sequences are required for tissue-specific expression of a human salivary amylase gene. Genes Dev. 6:1457-1465[Abstract/Free Full Text].
39. Tomita, N., A. Horii, S. Doi, H. Yikouchi, M. Ogawa, T. Mori, and K. Matsubara. 1990. Transcription of human endogenous retroviral long terminal repeat (LTR) sequence in a lung cancer cell line. Biochem. Biophys. Res. Commun. 166:1-10[Medline].
40. Vanderwinden, J. M., P. Mailleux, S. N. Schiffmann, and J. J. Vanderhaeghen. 1992. Cellular distribution of the new growth factor pleiotrophin (HB- GAM) mRNA in developing and adult rat tissues. Anat. Embryol. 186:387-406[Medline].
41. Venables, P. J. W., S. M. Brookes, D. Griffiths, R. A. Weiss, and M. T. Boyd. 1995. Abundance of an endogenous retroviral envelope protein in placental trophoblasts suggests a biological function. Virology 211:589-592[Medline].
42. Wellstein, A., W. J. Fang, A. Khatri, Y. Lu, S. S. Swain, R. B. Dickson, J. Sasse, A. T. Riegel, and M. E. Lippman. 1992. A heparin-binding growth factor secreted from breast cancer cells homologous to a developmentally regulated cytokine. J. Biol. Chem. 267:2582-2587[Abstract/Free Full Text].
43. Wilkinson, D. A., D. Freeman, N. L. Goodchild, C. A. Kelleher, and D. L. Mager. 1990. Automomous expression of RTVL-H endogenous retroviruslike elements in human cells. J. Virol. 64:2157-2167[Abstract/Free Full Text].
44. Wilkinson, D. A., D. L. Mager, and J. A. C. Leong. 1994. Endogenous human retroviruses, p. 465-535. In J. A. Levy (ed.), The Retroviridae. Plenum Press, New York, N.Y.
45. Xu, C. F., M. A. Brown, H. Nicolai, J. A. Chambers, B. L. Griffiths, and E. Solomon. 1997. Isolation and characterisation of the NBR2 gene, which lies head to head with the human BRCA1 gene. Hum. Mol. Genet. 6:1057-1062[Abstract/Free Full Text].


J Virol, July 1998, p. 6065-6072, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schulte, A. M.
Right arrow Articles by Wellstein, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schulte, A. M.
Right arrow Articles by Wellstein, A.


Home Help [Feedback] [For Subscribers] [Archive] [Search] [Contents]
J. Bacteriol. Mol. Cell. Biol. Microbiol. Mol. Biol. Rev.
Clin. Vaccine Immunol. ALL ASM JOURNALS