Previous Article | Next Article 
J Virol, July 1998, p. 6056-6064, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
UL27.5 Is a Novel
2 Gene
Antisense to the Herpes Simplex Virus 1 Gene Encoding
Glycoprotein B
Yijan E.
Chang,1
Laura
Menotti,2
Felix
Filatov,1
Gabriella
Campadelli-Fiume,2 and
Bernard
Roizman1,*
The Marjorie B. Kovler Viral Oncology
Laboratories, The University of Chicago, Chicago, Illinois
60637,1 and
Department of Experimental
Pathology, Section on Microbiology and Virology, University of
Bologna, 40126 Bologna, Italy2
Received 17 February 1998/Accepted 17 April 1998
 |
ABSTRACT |
An antibody made against the herpes simplex virus 1 US5
gene predicted to encode glycoprotein J was found to react strongly with two proteins, one with an apparent Mr of
23,000 and mapping in the S component and one with a herpes simplex
virus protein with an apparent Mr of 43,000. The antibody also reacted with herpes simplex virus type 2 proteins
forming several bands with apparent Mrs ranging
from 43,000 to 50,000. Mapping studies based on intertypic
recombinants, analyses of deletion mutants, and ultimately, reaction of
the antibody with a chimeric protein expressed by in-frame fusion of
the glutathione S-transferase gene to an open reading frame
antisense to the gene encoding glycoprotein B led to the definitive
identification of the new open reading frame, designated
UL27.5. Sequence analyses indicate the conservation of a
short amino acid sequence common to US5 and
UL27.5. The coding sequence of the herpes simplex virus
UL27.5 open reading frame is strongly homologous to the
sequence encoding the carboxyl terminus of the herpes simplex virus 2 UL27.5 sequence. However, both open reading frames could
encode proteins predicted to be significantly larger than the mature
UL27.5 proteins accumulating in the infected cells,
indicating that these are either processed posttranslationally or
synthesized from alternate, nonmethionine-initiating codons. The
UL27.5 gene expression is blocked by phosphonoacetate,
indicating that it is a
2 gene. The product accumulated
predominantly in the cytoplasm. UL27.5 is the third open
reading frame found to map totally antisense to another gene and
suggests that additional genes mapping antisense to known genes may
exist.
 |
INTRODUCTION |
In this report, we describe the
identification of a new open reading frame (ORF) in the genomes of
herpes simplex virus types 1 and 2 (HSV-1 and HSV-2). What makes this
ORF particularly interesting is its location antisense to
UL27, the gene encoding glycoprotein B (gB) (5,
22). The initial objectives of this study were quite different
from its outcome.
The sequence of the HSV-1 genome (22) corroborated the
existence of several glycoproteins and led to the discovery of others, bringing the total to 11 (gB, gC, gD, gE, gG, gH, gI, gJ, gK, gL, and
gM) (reviewed in references 28, 30, and
32). Of these, gJ was reported to be dispensable for
viral replication in cell culture and was the least well understood
(4, 21, 33). To initiate these studies, we immunized rabbits
with a fusion protein consisting of maltose binding protein fused in frame to the entire sequence of gJ. The resulting antibody reacted with
a protein (presumed to be gJ) whose gene maps in the S component and
with higher-Mr proteins in lysates of HSV-1- and
HSV-2-infected cells. Extensive mapping studies led ultimately to the
conclusion that these protein bands are encoded by a gene mapping
antisense to gB. A possible explanation for the reactivity of the
polyclonal antibody with both proteins rests on the observation that
HSV-1 and HSV-2 UL27.5 proteins have a short amino acid
sequence common to the predicted amino acid sequence of gJ.
Transcripts antisense to known ORFs were first reported by Stevens et
al. (31). The latency-associated transcript, however, does
not appear to affect the expression of ICP0, the gene to which it is
partially antisense. In the past several years, this laboratory
reported two sets of antisense genes. Thus, ORFs O and P map antisense
to the
134.5 gene, and the UL43.5 gene maps antisense to the UL43 gene (6, 20, 26). The
striking feature of the antisense genes is that their expression is
mutually exclusive. Thus, derepression of ORF P leads to its expression
early in infection and grossly reduces the normal expression of the
134.5 gene (27). UL43 and
UL43.5 are also expressed at different times after
infection (6). The gB/UL27.5 genes are the third
set of genes located antisense to each other. gB is expressed
relatively early in infection, whereas the UL27.5 gene
belongs to the
2 group in that its expression is totally
dependent on viral DNA synthesis (14, 15).
 |
MATERIALS AND METHODS |
Cells and viruses.
Rabbit skin cells and Vero cells were
obtained from John McLaren and American Type Culture Collection,
respectively, and were maintained in Dulbecco's modified Eagle medium
supplemented with 5% newborn calf serum. BHK(TK+) cells (American Type
Culture Collection) and 143TK
cells (obtained from Carlo Croce) were
maintained in the same medium supplemented with 5% fetal bovine serum.
Infected cells were maintained in mixture 199 supplemented with 1%
calf serum (199V) unless indicated otherwise. HSV-1(F) and HSV-2(G) are
prototypes of HSV-1 and HSV-2 strains, respectively, used in this
laboratory (10). Intertypic recombinants HSV-1(F) × HSV-2(G) were described previously (1, 8). In R7015 the HSV-1 S component was replaced by the homologous HSV-2(G) sequences. HSV-1(F)
305 was derived from HSV-1(F) and has a 501-bp deletion in
UL23 (thymidine kinase) and UL24 genes
(25). The HSV-1(KOS) mutant, lacking the UL26
gene (11), was the generous gift of Steven Weinheimer
(Bristol-Myers Squibb).
Antibodies.
Mouse monoclonal antibody CH28 to the human
cytomegalovirus (HCMV) gB epitope or G1102 to ICP35 was purchased from
Goodwin Institute (Plantation, Fla.). ICP0 polyclonal antibody was
described previously (18). Goat anti-mouse or anti-rabbit
immunoglobulin G alkaline phosphatase-conjugated secondary antibodies
were purchased from Bio-Rad (Hercules, Calif.).
Generation of US5 polyclonal antibody.
The
US5 maltose binding protein expression plasmid pRB5154,
containing the entire coding region of US5, was transfected
into Escherichia coli. The induction and purification
procedure of maltose binding fusion protein was done as recommended by
the manufacturer (New England BioLabs, Beverly, Mass.). A New Zealand White female rabbit was injected subcutaneously five times, each time
with 250 to 400 µg of fusion protein emulsified with Freund adjuvant.
Detection of viral proteins in lysates electrophoretically
separated in a denaturing polyacrylamide gel.
Mock-infected
or HSV-1-infected Vero or BHK (TK+) cells were harvested in
disruption buffer (50 mM Tris-HCl [pH 7.0], 2% sodium dodecyl
sulfate (SDS), 0.7 M
-mercaptoethanol, 2.75% sucrose), electrophoretically separated in a denaturing polyacrylamide gel cross-linked with N,N'-diallyltartardiamide,
electrophoretically transferred to a nitrocellulose membrane
(Schleicher & Schuell), and probed with appropriate antibodies. The
immunoblotting procedure was as described elsewhere (7). The
molecular weight marker was obtained with the LMW electrophoresis
calibration kit (Pharmacia Biotech, Uppsala, Sweden).
Generation of plasmids and recombinant viruses.
All
molecular cloning was done by standard techniques as described
elsewhere (29). The maltose binding
protein-US5 chimeric construct was cloned as pRB5154
and contained the entire US5 coding sequence. The
US5 coding sequence with an insertion at the
EcoO109 site of an oligomer encoding the HCMV gB epitope
(5'
AAAAGGG ACAGAAGCCCAACCTGCTAGACCGACTGCGACACCGCAAAAACGG GTACCGACACC
3') was ligated to the UL26.5 promoter sequence
(
599 to +44, relative to the transcription start site of the
UL26.5 gene) to create pRB4152. The UL26.5
promoter-US5 construct was cloned into the HSV-1(F)
thymidine kinase (tk) gene in place of the
BglII/EcoNI sequence of the
coding domain of the tk gene to create
pRB5175. In turn, the HSV sequence in pRB5175 was recombined into
HSV-1(F) as previously described to generate the recombinant virus
R5175.
pRB4351 contained an
27-tk construct cloned into the
NcoI site between the UL26 and UL27
genes (Fig. 1C, line 6). pRB4492 contained an
27-tk
construct between the UL25 and UL26 genes. In
order to insert the
27-tk construct and at the same time
provide a promoter for the UL26 gene, a series of clones
were generated. A BglII/EcoRI fragment from
pRB4454 containing the
27-tk cassette was cloned into the
BamHI/EcoRI sites of pRB4428 to create pRB4463. pRB4463 contains the 3' terminus of the UL25 gene and the
inserted
27-tk construct. Subsequently, a
NarI fragment containing an
4 promoter (
604 to +25
relative to the transcription start site of the
4 gene)
UL26 5' terminal sequence from pRB4060 was cloned into the
NarI site of pRB4463 to create pRB4492. pRB4351 and pRB4492 were recombined into the HSV-1(F)
305 genome to create recombinant viruses R4351 and R4492, respectively.
The HSV-2(G) KpnI H fragment subcloned from pAV6 (a kind
gift from Aviron, Mountain View, Calif.), containing HSV-2 genes UL25 to UL28, was cloned into pGEM3Zf(+) as
pRB812. pRB812 was recombined into the R4492 viral genome to create a
series of intertypic recombinant viruses (K-2 to K-7, K-9, and K-10).
All recombinant viruses made for these studies were generated by
homologous recombination. Rabbit skin cells were transfected with viral
DNA and cotransfected with appropriate plasmid DNA as previously
described (7). The transfection was plated on 143TK
cells
and selected either for tk+ progeny viruses,
e.g., R4351 and R4492 in HAT medium (15 µg of hypoxanthine, 0.2 µg
of aminopterin, and 5 µg of thymidine per ml) or tk mutant
progeny viruses (e.g., R5175) in medium containing 40 µg of
bromodeoxyuridine per ml. Individual isolates were plaque purified on
Vero cells, and their sequences and gene expression were verified by
Southern blot and immunoblot analyses, respectively.
Analyses of viral DNA by hybridization.
Cytoplasmic DNAs
were purified from infected cells as described elsewhere
(16), digested with either BamHI or
EcoRV, separated by agarose gel electrophoresis, and
transferred to a nylon membrane (Bio-Rad). The hybridization procedure
was done according to the manufacturer's recommendations. Either the
HSV-1(F) BamHI Q fragment cloned as pRB165 or the
gel-purified HSV-1(F) EcoRV D fragment was used as a probe.
All probes were internally labeled with [
32P]dCTP (800 Ci/mmol; DuPont, NEN, Boston, Mass.) with a nick translation kit
(DuPont, NEN).
Generation of GST-UL27.5 fusion protein.
The
sequence encoding UL27.5 codons 299 to 412 was amplified by
PCR and cloned into glutathione S-transferase (GST)
expression vector pGEX-KG as pRB5132 (12). The induction and
purification of a GST fusion protein were done as recommended by the
manufacturer (Promega, Madison, Wis.). Affinity-purified fusion protein
was loaded onto an SDS-15% polyacrylamide gel and stained with
Coomassie blue or electrophoretically transferred to a nitrocellulose
membrane and subjected to immunoblot analysis.
In vitro transcription and translation.
The
UL27.5 ORF amplified by PCR was cloned into pGEM3Zf(+) as
pRB5169 and used as a template for in vitro transcription and translation. The reaction was carried out in a TNT coupled
transcription/translation system (Promega) with T7 RNA polymerase in
the presence of [14C]leucine (0.25 µCi, 342 mCi/mmol;
DuPont, NEN). The final product was denatured in disruption buffer and
subjected to electrophoresis on an SDS-15% polyacrylamide gel and
electrophoretically transferred to a nitrocellulose sheet. The membrane
was treated with En3Hance spray (Dupont, NEN) and subjected
to autoradiography.
Cytoplasmic and nuclear fractionation.
BHK(TK+) cells were
mock infected or exposed to 10 PFU of HSV-1(F) or HSV-2(G) per cell and
harvested at 18 h after infection. Infected cells were collected
by low-speed centrifugation (1,000 × g for 5 min),
resuspended in buffer A (10 mM HEPES buffer [pH 7.4], 10 mM NaCl, 1.5 mM MgCl2), and stored on ice for 10 min. The cells were
subjected to five strokes of Dounce homogenization and incubated on ice
for 10 min. The cytoplasmic fraction was collected after centrifugation
(12,000 × g at 4°C for 20 min). The pellet was
washed once with buffer A and resuspended in buffer B (10 mM HEPES
buffer [pH 7.4], 420 mM NaCl, 1.5 mM MgCl2). The pellet
was briefly sonicated to facilitate resuspension, and the nuclear
fraction was collected after the removal of any insoluble material by
centrifugation (12,000 × g at 4°C for 5 min). The proteins in the cytoplasmic and nuclear fractions were denatured by the
addition of disruption buffer, boiled for 5 min, and subjected to
SDS-polyacrylamide gel electrophoresis.
 |
RESULTS |
Genomic structure of recombinant viruses R4351, R4492, and
R5175.
Recombinant viruses were constructed by double homologous
recombination as described in Materials and Methods, and their
structures were verified by Southern blot analyses. Cytoplasmic DNAs
from infected cells were digested with either the BamHI or
the EcoRV enzyme, separated on an agarose gel, transferred
to a nylon membrane, and hybridized with appropriate probes. As
illustrated in Fig. 1C,
lines 2 and 3, the replacement of the BglII/EcoNI
fragment of the tk gene with a UL26.5
promoter-US5-HCMV tag construct increased the size of
HSV-1(F) BamHI-Q from 3.5 to 4.2 kb, as detected when 32P-labeled pRB165 was used as the probe (Fig.
2B). To verify the predicted genomic
structure of R4351 and R4492, electrophoretically separated
EcoRV digests of the recombinant virus DNAs were probed with
a 32P-labeled HSV-1(F) EcoRV D fragment. There
are two closely positioned EcoRV sites in the
27-tk construct. The EcoRV-D probe showed, as
predicted, that insertion of the
27-tk construct and the
4 promoter into R4492 (Fig. 1C, lines 4 and 5) replaced the original EcoRV D fragment (14.8 kb) with two fragments of 2.4 and
14.6 kb in length (Fig. 2A, lanes 1 and 3). In the same fashion, the insertion of the
27-tk cassette into the R4351 viral
genome (Fig. 1C, line 6) resulted in the replacement of the
EcoRV D fragment with two fragments of 4.6 and 11.8 kb in
length (Fig. 2A, lane 2). We conclude that the three recombinant
viruses made in these studies show the expected genotype.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Schematic diagram of genome structures of HSV-1(F)
and HSV-1(F) × HSV-2(G) intertypic recombinants. Line 1, HSV-1(F)
genome arrangement. Open rectangles represent inverted repeats, and the
single lines in between represent unique long (UL) and
unique short (US) regions of the genome. Lines 2 to 7, schematic diagram of genome arrangement of intertypic recombinants used
in this study. Lines labeled 1 represent HSV-1(F) sequences, and lines
labeled 2 represent HSV-2(G) sequences. Crossovers are indicated by
bold-faced lines. R7015 (line 2) has the HSV-1(F) unique short region
replaced with the HSV-2(G) unique short sequence. Lines 3 to 7 are a
set of intertypic recombinants that are basically HSV-1(F), with
various portions between map units 0.3 and 0.45 replaced with the
HSV-2(G) sequence. (B) Schematic diagram of HSV-1(F) and various
recombinants used in this study. Line 1, genome arrangement of HSV-1(F)
and location of ORFs UL23 to UL28. Arrow
indicates the polarity and position of each ORF. Line 2, position of
the HSV-2(G) KpnI H fragment relative to the location of
ORFs. Lines 3 and 4, positions of proposed new ORF UL27.5
in the HSV-1(F) and HSV-2(G) genomes, respectively. Lines 5 to 9, genome organization of various recombinants. Short vertical lines
represent deletions (lines 5, 7, and 9). Triangles represent insertions
(lines 6, 8, and 9). Filled rectangle represents HCMV epitope tag (line
9). (C) Line 1, sequence arrangement of HSV-1(F). Line 2, ORFs in
HSV-1(F) BamHI Q fragment. Line 3, in R5175, an 0.8-kb
EcoNI/BglII fragment within the
UL23-to-UL24 region is replaced by a 1.5-kb
UL26.5 promoter-US5 construct. Line 4, ORF
arrangement in HSV-1(F) EcoRV D fragment. Line 5, in R4492,
a 2.2-kb 27tk- 4 promoter construct is inserted between
the UL25 and UL26 genes. Line 6, in R4351, a
1.6-kb 27tk construct is inserted between the
UL26 and UL27 genes. B, BamHI; Bg,
BglII; E, EcoRV; En, EcoNI; N,
NcoI.
|
|

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 2.
Autoradiography of electrophoretically separated DNA
hybridized with 32P-labeled probe. DNA of HSV-1(F) or
recombinant viruses was digested with EcoRV (A) or
BamHI (B), electrophoretically separated in agarose gel,
transferred to a nylon membrane, and hybridized with labeled
EcoRV D fragment (A) or BamHI Q fragment (B).
|
|
US5 rabbit polyclonal antibody reacted with two viral
proteins by immunoblot analyses.
Although the rabbit polyclonal
antibody was made against the US5 protein, in immunoblot
assays the anti-US5 polyclonal antibody reacted with two
bands containing different proteins. Mock-infected or HSV-1(F)-infected
BHK(TK+) cells were harvested in disruption buffer at 18 h after
infection, electrophoretically separated in an SDS-15% polyacrylamide
gel, electrophoretically transferred to a nitrocellulose sheet, and
probed with the US5 polyclonal antiserum. The results (Fig.
3A, lane 5) reproducibly showed that the
serum reacted with two virus-specific HSV-1 proteins with apparent
Mrs of 43,000 and 23,000, respectively
(designated band 2 and band 3, respectively). The antibody did not
react with lysates of mock-infected cells (Fig. 3A, lane 1). In
HSV-2(G)-infected cell lysate, only one virus-specific signal, with a
mobility on a denaturing gel equivalent to that of HSV-1(F) band 2, was
detected as a heterogeneous group of bands with apparent
Mrs ranging from 43,000 to 50,000. The HSV-2
equivalent of HSV-1(F) band 3 was not detected (Fig. 3A, lane 3).
Overdeveloped immunoblots occasionally showed another faint band with
an apparent Mr of greater than 100,000 (designated band 1).

View larger version (44K):
[in this window]
[in a new window]
|
FIG. 3.
Photograph of immunoblot of electrophoretically
separated proteins reacted with proper antibodies. Vero cells mock
infected or infected with HSV were harvested at 18 h
postinfection, electrophoretically separated onto an SDS-15%
polyacrylamide gel, electrically transferred to a nitrocellulose
membrane, and reacted with US5 polyclonal antibody (panel
A, lanes 2 to 8, and panels B and C) or monoclonal antibody recognizing
the HCMV epitope (CH28) (panel A, lane 9). (B) Lane 3, HSV-1(KOS) UL26 (UL26 deletion virus m100);
lane 4, HSV-1(KOS) UL26R (UL26 repaired
virus). Molecular weight markers are shown in lane 1, and bands 1 to 4 are indicated at the right of panel A.
|
|
The reactive band 3 was encoded by a gene residing in the
US sequence of HSV-1(F) inasmuch as the signal was missing
in the intertypic recombinant virus R7015 (Fig. 3, lane 4). As noted in
Materials and Methods, in this recombinant, the US sequence of HSV-1(F) was replaced with the corresponding sequence of HSV-2(G). The hypothesis that the protein contained in band 3 is encoded by the
US5 gene was supported by studies of recombinant R5175. In
this recombinant, a second copy of US5 coding sequence
tagged with an HCMV gB epitope was inserted into the tk
gene. The polyclonal rabbit serum made against the US5
protein reacted with a fourth band in electrophoretically separated
lysates of R5175 virus-infected cell lysates (Fig. 3A, lane 8, band 4).
Band 4 comigrated with the signal detected in R5175 reacted only with
the monoclonal antibody to the HCMV gB epitope (Fig. 3, compare lanes 8 and 9). The CMV epitope-tagged second copy US5 protein
migrated with an apparent Mr of about 18,000, which is faster than the authentic US5 protein. One
explanation for the discrepancy in the electrophoretic mobilities is
that insertion of the epitope blocks the glycosylation of the protein.
The studies with the gJ protein will be dealt with elsewhere.
The gene encoding protein in band 2 maps in UL.
In
this section, we describe three series of experiments designed to map
the gene encoding band 2 protein. We took advantage of the difference
in the electrophoretic mobilities of the HSV-1 and HSV-2 homologs of
band 2 protein.
The first series of experiments was done with a series of HSV-1 × HSV-2 recombinants shown in Fig. 1A. These recombinants have been
extensively studied for mapping studies, and the crossover sites are
well known. Replicate Vero cell cultures were exposed to 10 PFU of a
wild-type or recombinant virus, incubated at 37°C, harvested at
18 h after infection, solubilized in disruption buffer, electrophoretically separated in a denaturing polyacrylamide gel, transferred to a nitrocellulose sheet, and reacted with the
anti-US5 antibody. The results shown in Fig.
4 indicate that the recombinant viruses
RHIG7 and RHIG13 encoded the HSV-2(G) form of band 2 protein (Fig. 4,
lanes 3, 4, and 6), whereas the recombinants RHIG8, RHIG44, and RHIG48
yielded the HSV-1(F) form of band 2 protein (Fig. 4, lanes 2, 5, 7, and
8). These results indicated that the sequence encoding the band 2 protein maps between map units 0.33 and 0.37, that is, within the
genome domain encoding the UL23 to UL27 genes (Fig. 1A) (22).

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 4.
Photograph of immunoblot of electrophoretically
separated proteins reacted with US5 polyclonal antibody.
Vero cells mock infected or infected with wild-type HSV or intertypic
recombinants, harvested at 18 h postinfection, electrophoretically
separated in a denaturing polyacrylamide gel, transferred to a
nitrocellular membrane, and reacted with US5 polyclonal
antibody.
|
|
The second series of studies was designed to determine whether the gene
encoding band 2 protein maps to UL23 to UL26 on
the basis of the synthesis of band 2 protein in cells infected with mutants with changes in these genes. Thus, several recombinant viruses
with mutations in this region, including deletions in the domains of
UL23 and UL24 [HSV-1(F)
305 and R5175] and
UL26 [HSV-1(KOS)m100] (11) and disruption of
the UL25-to-UL26 (R4492) and
UL26-to-UL27 interfaces (R4351), were tested
for alteration in the mobility of band 2 protein. In this series of
experiments, Vero cells were infected and processed as described above.
The results were that the electrophoretic mobility of band 2 protein specified by the recombinants tested in these studies was no different from that predicted (9, 17) or specified by HSV-1(F) (Fig. 3A, lanes 5 to 7, Fig. 3B, lanes 1 to 4, and Fig. 3C, lanes 1 to 3).
Band 3 protein was detected in all of the recombinant viruses tested in
this series of experiments.
We conclude from this series of experiments that the band 2 protein was
not encoded by UL23, UL24, or UL26
ORFs inasmuch as deletions in these genes had no effect on the mobility
of band 2. Furthermore, the mobility of band 2 on denaturing
polyacrylamide gel was different from what would be expected for
UL25 or UL27 gene products (2, 3, 13,
22-24). Therefore, we conclude that band 2 protein is derived
from a previously unidentified viral ORF between map units 0.33 and
0.37.
In the third series of experiments, we generated a series of
recombinant viruses in which the HSV-1 ORFs UL25 to
UL28 were replaced with the equivalent HSV-2(G) sequences.
The strategy was to cotransfect the HSV-2 sequences in pRB812 with
intact R4492 viral DNA and select for the TK
phenotype.
In the process, the
27-tk chimeric gene inserted into the
R4492 genome in the intergenic domain between UL25 and UL26 was replaced with the HSV-2(G) DNA sequences cloned in
pRB812. Replicate Vero cell cultures, each exposed to 10 PFU of
intertypic recombinant per cell, were then analyzed for the presence of
the HSV-2(G) band 2 protein in the HSV-1(F) background. As shown in Fig. 5, the lysates of cells infected
with isolates K-6, K-9, and K-10 exhibited band 2 proteins which
comigrated with band 2 of HSV-2(G), that is, migrated more slowly than
the HSV-1 band 2 protein present in the lysate from parent virus R4492
(Fig. 5, lane 1). The slower-migrating species, designated
UL27.5 in this figure for reasons detailed in the next
section, appeared as a doublet similar to the band 2 in
HSV-2(G)-infected lysate, although the upper band was not as prominent
as in HSV-2(G)-infected lysate. Since the crossover could have occurred
proximal to the location of the ORF encoding band 2 protein, not all of
the recombinants in this series exhibited or were predicted to exhibit
an HSV-2(G) band 2 phenotype. In no instance was the electrophoretic
mobility of the band 3 (US5) protein affected. Based on the
observation that an insertion between UL26 and
UL27 (R4351) or between UL25 and
UL26 (R4492) and a truncation in the amino terminus of the UL26 gene (m100) had no effect on the mobility of band 2, we conclude that the new ORF could reside completely within the
UL25 ORF, within the carboxyl-terminal portion of the
UL26 ORF, or within the region between UL27 and
UL28 (Fig. 1B).

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 5.
Photograph of immunoblot of electrophoretically
separated proteins reacted with US5 polyclonal antibody.
Vero cells were infected with various intertypic recombinants and
harvested at 18 h postinfection. Proteins were electrophoretically
separated on an SDS-15% polyacrylamide gel, transferred to a
nitrocellulose membrane, and reacted with US5 polyclonal
antibody. The bands formed by the UL27.5 and
US5 proteins are identified at the right.
|
|
Sequence analysis predicts new ORF antisense to
UL27.
We next searched for potential ORFs in the
target regions stated above. We focused on new ORFs conserved in HSV-1
and HSV-2 with the capacity to encode at least 200 amino acids.
As shown in Fig. 1B, lines 3 and 4, only one ORF, designated
UL27.5 and predicted to encode an HSV-1 protein of 575 amino acids, and an HSV-2 protein of 985 amino acids met these
criteria. Sequence comparison showed that, except for the
amino-terminal region of the predicted HSV-2 UL27.5 ORF,
the HSV-1 and HSV-2 UL27.5 ORFs were homologous (Fig.
6). Since the US5 polyclonal
antibody cross-reacted with the denatured band 2 protein, the
cross-reacting epitope is predicted to be linear and could potentially
be deduced by comparing primary amino acid sequences. Amino acid
sequence comparison of HSV-1(F) and HSV-2(G) UL27.5 and
US5 revealed very limited sequence homology (Fig.
7). The sequence of the US5
gene predicts a hydrophobic protein. Therefore, the observation that
the limited homology resided in a rather hydrophobic stretch of amino
acids was not unexpected.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
Amino acid sequence alignment of the proposed new ORF
UL27.5 from HSV-1(F) (top line) and HSV-2(G) (middle line).
The consensus sequence is shown on the bottom line. Numbers indicate
the amino acid number based on the sequence of the HSV-2(G) ORF. Note
the slight sequence variation between HSV-1(F) and HSV-2(G) from 855 to
934, which gives the HSV-2(G) UL27.5 ORF a total amino acid
residue count of 985.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
Amino acid sequence alignment between HSV-2(G)
UL27.5 amino acids 701 to 847 (the second line), the
equivalent sequence in HSV-1(F) UL27.5 (top line), and the
entire coding sequence of HSV-1(F) US5 (the third line).
The consensus sequence is shown at the bottom.
|
|
A GST-UL27.5 fusion protein expressing the
US5 homologous region of UL27.5 reacted with
the US5 polyclonal antibody by immunoblot analysis.
A
GST-UL27.5 fusion protein expressing the homologous region
of the HSV-1 UL27.5 coding sequence (Fig. 6, HSV-1 amino
acids 299 to 412) was constructed, purified on affinity columns, and subjected to electrophoresis in denaturing polyacrylamide gels. The
eluted GST-UL27.5 chimeric protein, the chimeric
protein remaining bound to the affinity resin and eluted by
solubilization in disruption buffer, and the eluted GST protein were
each separated on a 15% denaturing gel and stained with Coomassie blue
(Fig. 8A, lanes 1, 2, and 3, respectively). Portions of the same preparation were electrophoretically separated in the same gel, electrically transferred to a nitrocellulose membrane, and probed with US5
polyclonal antibody (Fig. 8B). The results were that the
GST-UL27.5 fusion protein migrated at an expected
Mr of 42,000 on denaturing gel (panel A, lanes 1 and 2) (2). Both eluted GST-UL27.5 and
resin-associated GST-UL27.5 reacted with the
US5 polyclonal antibody on an immunoblot, whereas GST
alone did not (Fig. 8B, lanes 1, 2, and 3). These results are
consistent with the results of the mapping studies and indicate that
UL27.5 encodes a protein containing an epitope common to
the US5 protein.

View larger version (42K):
[in this window]
[in a new window]
|
FIG. 8.
Photograph of gel stained with Coomassie blue (A) or
immunoblot of proteins electrophoretically separated in an
SDS-polyacrylamide gel and reacted with US5 polyclonal
antibody (B). GST-UL27.5 fusion protein was induced as
described in Materials and Methods. The eluent (lane 1), the remaining
fusion protein bound to the affinity resin (lane 2), and the eluent of
GST protein (lane 3) were electrophoretically separated in an SDS-15%
polyacrylamide gel and stained with Coomassie blue (A). Equal amounts
of each sample were separated in the same fashion, electrically
transferred to a nitrocellulose membrane, and reacted with
US5 polyclonal antibody (B). Molecular weight marker is
shown at the left.
|
|
In vitro-translated product of the UL27.5 coding
sequence migrated as a protein with a molecular weight of 65,000.
The primary sequence of the UL27.5 ORF has the capacity to
encode a protein of 575 amino acids. The apparent molecular weight of
band 2 on denaturing polyacrylamide gel was 43,000. To test if the
discrepancy between the predicted and observed size is due to the
nature of the protein or to posttranslational modification, we
translated the UL27.5 open reading frame with a coupled in vitro transcription translation system and analyzed the protein in a
denaturing gel. As shown in Fig. 9, lanes
3 and 4, the only [14C]leucine-labeled species,
supposedly the full-length product, migrated with an apparent
Mr of 65,000. A minor protein band with an
apparent Mr of 65,000 was also observed in
immunoblots reacted with the US5 antibody (Fig. 4).

View larger version (24K):
[in this window]
[in a new window]
|
FIG. 9.
Autoradiography of [14C]leucine-labeled in
vitro-translated UL27.5 protein immobilized on a
nitrocellulose membrane. Vector pGEM3Zf(+) (lanes 1 and 2) or pRB5169
containing the proposed HSV-1(F) UL27.5 coding sequence
(lanes 3 and 4) was in vitro translated in a programmed rabbit
reticulocyte lysate, labeled with [14C]leucine,
electrophoretically separated in an SDS-15% polyacrylamide gel,
electrically transferred onto a nitrocellulose membrane, and subjected
to autoradiography. Lanes 1, 2, 3, and 4 represent four independent
experiments.
|
|
As a general rule, HSV proteins migrate with an apparent
Mr larger than that predicted on the basis of
their amino acid sequences. The apparent Mr
obtained for the in vitro transcription-translation product is
consistent with an HSV protein of 575 amino acids and suggests that
either the domain translated is smaller than the ORF or that the
protein is processed by cleavage in the environment of the infected
cell.
UL27.5 is a
2 gene.
In this series
of experiments, replicate Vero cultures were either mock infected or
infected with HSV-1(F) and either left untreated or incubated in medium
containing phosphonoacetic acid (PAA) (300 µg/ml of medium; a
gift of Abbott Laboratories) throughout the course of infection.
The cells were harvested at 18 h after infection, solubilized in
disruption buffer, subjected to electrophoresis, electrically
transferred onto a membrane, and probed with appropriate antibodies to
viral proteins. As shown in Fig. 10B,
lanes 2 and 4, the treatment of PAA was effective, as evidenced by the
reduced accumulation of ICP35 (a
1 gene). In contrast to
ICP0 and the ICP35 protein, UL27.5 was not detected in
infected cells treated with PAA (Fig. 10C). We conclude therefore that
UL27.5 is a
2 gene totally dependent on
viral DNA synthesis for its expression.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 10.
Photograph of immunoblot of electrophoretically
separated infected-cell proteins reacted with indicated antibodies.
Vero cells were mock infected or infected with HSV-1(F) in the presence
or absence of PAA and harvested at 18 h postinfection. Lysates
were electrophoretically separated in a denaturing polyacrylamide gel,
transferred to a nitrocellulose membrane, and reacted with antibodies
to ICP0 (A) and ICP35 (B) and the US5 polyclonal antibody
(C).
|
|
UL27.5 protein accumulates in the cytoplasm.
BHK(TK+) cells were either mock infected or exposed to 10 PFU of
HSV-1(F) or of HSV-2(G) per cell and incubated at 37°C. The cells
were harvested at 18 h after infection. The cytoplasmic and
nuclear fractions were collected as described in Materials and Methods,
solubilized, electrophoretically separated onto a denaturing
polyacrylamide gel, electrically transferred to a membrane, and reacted
with the anti-US5 antibody. As shown in Fig.
11, lanes 1 and 2, the
UL27.5 protein accumulated exclusively in the cytoplasmic fraction. In HSV-2(G)-infected cell lysates, the majority of the signal
was detected in the cytoplasmic fraction. A slightly more rapidly
migrating protein band was detected in both the nuclear and cytoplasmic
fractions whereas a less abundant and more rapidly migrating protein
band was detected only in the nuclear fraction (Fig. 11, lanes 3 and
4).

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 11.
Photograph of immunoblot of electrophoretically
separated proteins reacted with US5 polyclonal antibody.
BHK(TK+) cells were either mock infected or infected with HSV for
18 h. The cytoplasmic and nuclear fractions were collected as
described in Materials and Methods, electrophoretically separated onto
an SDS-15% polyacrylamide gel, electrically transferred to a
nitrocellulose membrane, and reacted with US5 polyclonal
antibody. Band 1, 2, and 3 proteins are indicated at the right.
|
|
 |
DISCUSSION |
A polyclonal rabbit antibody made against gJ reacted with a
protein expressed by both HSV-1 and HSV-2. The gene encoding this protein has been mapped to an ORF antisense to the gene encoding gB. In
this article, we report on the mapping of the gene and preliminary
characterization of the product of the ORF. The salient features of
this report are as follows.
(i) The protein is encoded by the UL27.5 gene on the basis
of three kinds of data, i.e., mapping of two independently derived intertypic recombinants, analyses of insertion and deletion mutants, and direct reaction of the antibody with a chimeric protein containing the relevant domain of the ORF expressed in E. coli.
(ii) The UL27.5 ORFs predict an HSV-1 protein of 575 amino
acids and an HSV-2 protein of 985 amino acids. The HSV-1 sequence predicts a single methionine codon, whereas the HSV- 2
sequence predicts two methionines at positions 1 and 669. Translation
in vitro of the entire HSV-1 ORF yielded a protein with an apparent Mr of 65,000. However, this observation does not
prove that translation initiation occurs at the initiator methionine of
the ORF, and there is no substantive evidence that the accumulating
HSV-2 proteins are derived from a high-molecular-weight precursor.
Initiation at the second methionine codon of the HSV-2
UL27.5 open reading frame would predict a protein much
smaller than the HSV-2 protein accumulating in the infected cell. We
cannot at this time exclude the possibility that translation initiation
begins internally from an alternate translation initiation codon
(19).
(iii) Most of the HSV-1 and HSV-2 UL27.5 accumulated in the
cytoplasm. A small amount of HSV-2 UL27.5 protein migrating
faster than the cytoplasmic protein partitioned in the nucleus. We
should note that the amount of HSV-2 protein accumulating in infected cells is higher or reacts better with the antibody than the
corresponding HSV-1 protein. It is conceivable that a small amount of
HSV-1 UL27.5 also accumulates in the nucleus.
Because UL27.5 maps antisense to a gene essential for viral
replication, it has not been possible at this time to determine whether
the UL27.5 gene product is also essential. Experiments now
in progress should allow us to assess the role of this gene in cell
culture and in an experimental animal system.
(iv) The discovery of a gene antisense to gB (UL27) was
totally unexpected. Most analytical tools used to analyze nucleotide sequences are based on the assumption that a coding domain is present
in the form of a linear array of nucleotides on one strand only. The
gB-UL27.5 pair of antisense genes is the third set
discovered within the HSV-1 genome (6, 20, 26). The ease
with which they have been discovered in the past few years suggests
that there may be more such pairs. Given the fact that the size of the
capsids is conserved and virtually identical for all herpesviruses and
that the capsids could package >240 kbp of DNA (e.g., the HCMV
genome), the question arises as to why HSV encodes genes antisense to
each other rather than stringing these ORFs in linear arrays. Among the
many possible explanations, three are worthy of further discussion.
The first, less-interesting hypothesis is that even the large
herpesviruses contain genes arranged antisense to each other and that
the actual number of genes in HCMV is grossly underestimated. It is
conceivable that the antisense arrangements antedate the divergence of
the primordial herpesvirus into the various subfamilies now in
existence.
The second, more-attractive hypothesis is that the antisense
arrangement is a form of regulation of gene expression that determines both the timing of synthesis and the abundance of the gene product. In
the two preceding cases, that is,
134.5/ORF P and ORF O
and UL43/UL43.5, we have found that the
expression of the genes situated antisense to each other was sequential
or even mutually exclusive (6, 20, 26). In this instance, gB
is expressed very early in infection in abundant amounts, whereas the
UL27.5 gene expression appears to be a late event,
dependent on viral DNA synthesis. One test of the hypothesis would be
to reverse the timing of the expression of the two genes to determine
whether early expression of the UL27.5 is deleterious.
Lastly, the possibility that the sequences of two ORFs fit such that
both proteins contain only the amino acid sequences essential for their
function is probably remote. It is more likely that key amino acid
domains of one protein correspond to neutral or linker domains in the
product of the antisense ORF. Once the precise sequence encoding the
UL27.5 protein is elucidated, it may be possible to probe
more accurately the corresponding domains of the gB gene.
 |
ACKNOWLEDGMENTS |
We thank Min Gao for HSV-1(KOS)
UL26 virus and A. Louise McCormick for the HSV-1(KOS)
UL26R virus.
These studies were aided by grants from the National Cancer Institute
(CA47451 and CA71933) to the University of Chicago laboratory and by
AIDS Project from Istituto Superiore di Sanita BIOMED2 BMH4 CT95 1016 from the European Community Target Project in Biotechnology to the
University of Bologna laboratory.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Marjorie B. Kovler Viral Oncology Laboratories, The University of Chicago, 910 E. 58th St., Chicago, IL 60637. Phone: (773) 702-1898. Fax: (773) 702-1631. E-mail: bernard{at}kovler.uchicago.edu.
 |
REFERENCES |
| 1.
|
Ackermann, M.,
R. Longnecker,
B. Roizman, and L. Pereira.
1986.
Identification, properties, and gene location of a novel glycoprotein specified by herpes simplex virus 1.
Virology
150:207-220[Medline].
|
| 2.
|
Addison, C.,
F. J. Rixon,
J. W. Palfreyman,
M. O'Hara, and V. G. Preston.
1984.
Characterisation of a herpes simplex virus type 1 mutant which has a temperature-sensitive defect in penetration of cells and assembly of capsids.
Virology
138:246-259[Medline].
|
| 3.
|
Ali, M. A.,
B. Forghani, and E. M. Cantin.
1996.
Characterization of an essential HSV-1 protein encoded by the UL25 gene reported to be involved in virus penetration and capsid assembly.
Virology
216:278-283[Medline].
|
| 4.
|
Balan, P.,
N. Davis-Poynter,
S. Bell,
H. Atkinson,
H. Browne, and T. Minson.
1994.
An analysis of the in vitro and in vivo phenotypes of mutants of herpes simplex virus type 1 lacking glycoproteins gG, gE, gI or the putative gJ.
J. Gen. Virol.
75:1245-1258[Abstract/Free Full Text].
|
| 5.
|
Bzik, D. J.,
B. A. Fox,
N. A. Deluca, and S. Person.
1984.
Nucleotide sequence specifying the glycoprotein gene gB of herpes simplex virus type 1.
Virology
133:301-314[Medline].
|
| 6.
|
Carter, K. L.,
P. L. Ward, and B. Roizman.
1996.
Characterization of the products of the UL43 gene of herpes simplex virus 1: potential implications for regulation of gene expression by antisense transcription.
J. Virol.
70:7663-7668[Abstract].
|
| 7.
|
Chang, Y. E., and B. Roizman.
1993.
The product of the UL31 gene of herpes simplex virus 1 is a nuclear phosphoprotein which partitions with the nuclear matrix.
J. Virol.
67:6348-6356[Abstract/Free Full Text].
|
| 8.
|
Conley, A. J.,
D. M. Knipe,
P. C. Jones, and B. Roizman.
1981.
Molecular genetics of herpes simplex virus. VII. Characterization of a temperature-sensitive mutant produced by in vitro mutagenesis and defective in DNA synthesis and accumulation of polypeptides.
J. Virol.
37:191-206[Abstract/Free Full Text].
|
| 9.
|
Cook, W. J., and D. M. Coen.
1996.
Temporal regulation of herpes simplex virus type 1 UL24 mRNA expression via differential polyadenylation.
Virology
218:204-213[Medline].
|
| 10.
|
Ejercito, P. M.,
E. D. Kieff, and B. Roizman.
1968.
Characterization of herpes simplex virus strains differing in their effects on social behaviour of infected cells.
J. Gen. Virol.
2:357-364[Abstract/Free Full Text].
|
| 11.
|
Gao, M.,
L. Matusick-Kumar,
W. Hurlburt,
S. F. Ditusa,
W. W. Newcomb,
J. C. Brown,
P. J. McCann III,
I. Deckman, and R. J. Colonno.
1994.
The protease of herpes simplex virus type 1 is essential for functional capsid formation and viral growth.
J. Virol.
68:3702-3712[Abstract/Free Full Text].
|
| 12.
|
Guan, K., and J. E. Dixon.
1991.
Eukaryotic protein expression in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase.
Anal. Biochem.
192:262-267[Medline].
|
| 13.
|
Holland, L. E.,
R. M. Sandri-Goldin,
A. L. Goldin,
J. C. Glorioso, and M. Levine.
1984.
Transcriptional and genetic analysis of the herpes simplex virus type 1 genome: coordinates 0.29 to 0.45.
J. Virol.
49:947-959[Abstract/Free Full Text].
|
| 14.
|
Honess, R. W., and B. Roizman.
1974.
Regulation of herpes virus macromolecular synthesis. I. Cascade regulation of the synthesis of three groups of viral proteins.
J. Virol.
14:8-19[Abstract/Free Full Text].
|
| 15.
|
Honess, R. W., and B. Roizman.
1975.
Regulation of herpesvirus macromolecular synthesis: sequential transition of polypeptide synthesis requires functional viral polypeptides.
Proc. Natl. Acad. Sci. USA
72:1276-1280[Abstract/Free Full Text].
|
| 16.
|
Igarashi, K.,
R. Fawl,
R. J. Roller, and B. Roizman.
1993.
Construction and properties of a recombinant herpes simplex virus 1 lacking both S-component origins of DNA synthesis.
J. Virol.
67:2123-2132[Abstract/Free Full Text].
|
| 17.
|
Jacobson, J. G.,
S. L. Martin, and D. M. Coen.
1989.
A conserved open reading frame that overlaps the herpes simplex virus thymidine kinase gene is important for viral growth in cell culture.
J. Virol.
63:1839-1843[Abstract/Free Full Text].
|
| 18.
|
Kawaguchi, Y.,
C. Van Sant, and B. Roizman.
1997.
Herpes simplex virus 1 alpha regulatory protein ICP0 interacts with and stabilizes the cell cycle regulator cyclin D3.
J. Virol.
71:7328-7336[Abstract].
|
| 19.
|
Kozak, M.
1997.
Recognition of AUG and alternative initiator codons is augmented by G in position +4 but is not generally affected by the nucleotides in positions +5 and +6.
EMBO J.
16:2482-2492[Medline].
|
| 20.
|
Lagunoff, M., and B. Roizman.
1995.
The regulation of synthesis and properties of the protein product of open reading frame P of the herpes simplex virus 1 genome.
J. Virol.
69:3615-3623[Abstract].
|
| 21.
|
Longnecker, R., and B. Roizman.
1987.
Clustering of genes dispensable for growth in culture in the S component of the HSV-1 genome.
Science
236:573-576[Abstract/Free Full Text].
|
| 22.
|
McGeoch, D. J.,
M. R. Dalrymple,
A. J. Davison,
A. Dolan,
M. C. Frame,
D. McNab,
L. Perry,
J. E. Scott, and P. Taylor.
1988.
The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1.
J. Gen. Virol.
69:1531-1574[Abstract/Free Full Text].
|
| 23.
|
McNab, A. R.,
P. Desai,
S. Person,
L. L. Roof,
D. R. Thomsen,
W. W. Newcomb,
J. C. Brown, and F. L. Homa.
1998.
The product of the herpes simplex virus type 1 UL25 gene is required for encapsidation but not for cleavage of replicated viral DNA.
J. Virol.
72:1060-1070[Abstract/Free Full Text].
|
| 24.
|
Pellett, P. E.,
K. G. Kousoulas,
L. Pereira, and B. Roizman.
1985.
Anatomy of the herpes simplex virus 1 strain F glycoprotein B gene: primary sequence and predicted protein structure of the wild type and of monoclonal antibody-resistant mutants.
J. Virol.
53:243-253[Abstract/Free Full Text].
|
| 25.
|
Post, L. E., and B. Roizman.
1981.
A generalized technique for deletion of specific genes in large genomes: gene 22 of herpes simplex virus 1 is not essential for growth.
Cell
25:227-232[Medline].
|
| 26.
|
Randall, G.,
M. Lagunoff, and B. Roizman.
1997.
The product of ORF O located within the domain of herpes simplex virus 1 genome transcribed during latent infection binds to and inhibits in vitro binding of infected cell protein 4 to its cognate DNA site.
Proc. Natl. Acad. Sci. USA
94:10379-10384[Abstract/Free Full Text].
|
| 27.
|
Randall, G., and B. Roizman.
1997.
Transcription of the derepressed open reading frame P of herpes simplex virus 1 precludes the expression of the antisense 134.5 gene and may account for the attenuation of the mutant virus.
J. Virol.
71:7750-7757[Abstract].
|
| 28.
|
Roizman, B., and A. E. Sears.
1995.
The replication of herpes simplex viruses, p. 2231-2295.
In
B. N. Fields, D. M. Knipe, P. Howley, R. M. Chanock, M. S. Hirsch, J. L. Melnick, T. P. Monath, and B. Roizman (ed.), Virology, 3rd ed. Raven Press, New York, N.Y.
|
| 29.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 30.
|
Spear, P. G.
1993.
Membrane fusion induced by herpes simplex virus, p. 201-232.
In
J. Bentz (ed.), Viral fusion mechanisms. CRC Press Inc., Boca Raton, Fla.
|
| 31.
|
Stevens, J. G.,
E. K. Wagner,
G. B. Devi-Rao,
M. L. Cook, and L. T. Feldman.
1987.
RNA complementary to a herpesvirus gene mRNA is prominent in latently infected neurons.
Science
235:1056-1059[Abstract/Free Full Text].
|
| 32.
|
Ward, P. L., and B. Roizman.
1994.
Herpes simplex genes: the blueprint of a successful human pathogen.
Trends Genet.
10:267-274[Medline].
|
| 33.
|
Weber, P. C.,
M. Levine, and J. C. Glorioso.
1987.
Rapid identification of nonessential genes of herpes simplex virus type 1 by Tn5 mutagenesis.
Science
236:576-579[Abstract/Free Full Text].
|
J Virol, July 1998, p. 6056-6064, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Aubert, M., Chen, Z., Lang, R., Dang, C. H., Fowler, C., Sloan, D. D., Jerome, K. R.
(2008). The Antiapoptotic Herpes Simplex Virus Glycoprotein J Localizes to Multiple Cellular Organelles and Induces Reactive Oxygen Species Formation. J. Virol.
82: 617-629
[Abstract]
[Full Text]
-
Zhang, G., Raghavan, B., Kotur, M., Cheatham, J., Sedmak, D., Cook, C., Waldman, J., Trgovcich, J.
(2007). Antisense Transcription in the Human Cytomegalovirus Transcriptome. J. Virol.
81: 11267-11281
[Abstract]
[Full Text]
-
Melancon, J. M., Luna, R. E., Foster, T. P., Kousoulas, K. G.
(2005). Herpes Simplex Virus Type 1 gK Is Required for gB-Mediated Virus-Induced Cell Fusion, While neither gB and gK nor gB and UL20p Function Redundantly in Virion De-Envelopment. J. Virol.
79: 299-313
[Abstract]
[Full Text]
-
Perelygina, L., Zhu, L., Zurkuhlen, H., Mills, R., Borodovsky, M., Hilliard, J. K.
(2003). Complete Sequence and Comparative Analysis of the Genome of Herpes B Virus (Cercopithecine Herpesvirus 1) from a Rhesus Monkey. J. Virol.
77: 6167-6177
[Abstract]
[Full Text]
-
Zhou, G., Roizman, B.
(2001). The Domains of Glycoprotein D Required To Block Apoptosis Depend on Whether Glycoprotein D Is Present in the Virions Carrying Herpes Simplex Virus 1 Genome Lacking the Gene Encoding the Glycoprotein. J. Virol.
75: 6166-6172
[Abstract]
[Full Text]
-
Zhou, G., Galvan, V., Campadelli-Fiume, G., Roizman, B.
(2000). Glycoprotein D or J Delivered in trans Blocks Apoptosis in SK-N-SH Cells Induced by a Herpes Simplex Virus 1 Mutant Lacking Intact Genes Expressing Both Glycoproteins. J. Virol.
74: 11782-11791
[Abstract]
[Full Text]