Previous Article | Next Article ![]()
J Virol, July 1998, p. 5984-5993, Vol. 72, No. 7
Department of Genetics and Microbiology,
University of Geneva School of Medicine, CH1211 Geneva,
Switzerland,1 and
Department of
Microbiology, Kobe University School of Medicine, Chuo-ku, Kobe
650, and Osaka Prefectural Institute of Public Health,
Higashinari-ku, Osaka 537, Japan2
Received 26 January 1998/Accepted 7 April 1998
Recombinant Sendai viruses were prepared which cannot express their
Cprime, C, or Cprime plus C proteins due to
mutation of their respective start codons ([Cprime-minus], [C-minus] and [double mutant],
respectively). The [Cprime-minus] and [C-minus] stocks
were similar to that of wild-type (wt) virus in virus titer and plaque
formation, whereas the double-mutant stock had a much-reduced PFU or
50% egg infective dose/particle ratio and produced very small plaques.
Relative to the wt virus infection, the [Cprime-minus]
and [C-minus] infections of BHK cells resulted in significantly greater accumulation of viral RNAs, consistent with the known inhibitory effects of the Cprime and C proteins. The
double-mutant infection, in contrast, was delayed in its accumulation
of viral RNAs; however, once accumulation started, overaccumulation
quickly occurred, as in the single-mutant infections. Our results
suggest that the Cprime and C proteins both provide a
common positive function early in infection, so that only the double
mutant undergoes delayed RNA accumulation and exhibits the highly
debilitated phenotype. Later in infection, the same proteins appear to
act as inhibitors of RNA accumulation. In infections of mice,
[Cprime-minus] was found to be as virulent as wt virus
whereas [C-minus] was highly attenuated. These results suggest that
the Cprime and C proteins cannot be functionally
equivalent, since C can replace Cprime for virulence in
mice whereas Cprime cannot replace C.
The paramyxomyxovirus C proteins
were first found in Sendai virus (SeV)-infected cells and, since they
were apparently absent in virions, were termed nonstructural proteins
(reviewed in reference 22). Subsequent work with
specific antisera showed that the C proteins could be detected in
virions, associated with nucleocapsids. They are, however, greatly
underrepresented in virions relative to their intracellular amounts
(22, 27, 38). Furthermore, unlike the other virion
proteins, which are translated from separate transcriptional
units, the C proteins are translated from the P (phosphoprotein)
gene mRNA, from an alternate open reading frame (ORF) which
overlaps the N-terminal end of the P protein ORF (14) (Fig.
1).
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Various Sendai Virus C Proteins Are Not Functionally
Equivalent and Exert both Positive and Negative Effects on Viral RNA
Accumulation during the Course of Infection

![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (31K):
[in a new window]
FIG. 1.
ORF organization and expression of the SeV P gene. The
three ORFs expressed as proteins (P, C, and V) are shown as horizontal
boxes, drawn roughly to scale (top). A blow-up of the 5' end of the
mRNA is shown in the middle, and the five ribosomal start sites in
this region are indicated. The mutations used to eliminate expression
from the Cprime and C protein start codons are shown. The
effects of these mutations on C protein expression in BHK cells
infected with a 1:5 dilution of the wt (SeVZ), [C-minus],
[Cprime-minus], and double-mutant virus stocks (see the
text) were examined by immunoblotting with a polyclonal rabbit anti-C
antiserum (bottom). aa, amino acids.
The expression of the paramyxovirus C proteins can also be complex. SeV is a member of the newly renamed Respirovirus genus (formerly the Paramyxovirus genus) of the subfamily Paramyxovirinae. This subfamily also includes the Morbillivirus (e.g., measles virus) and the Rubulavirus (e.g., mumps virus and simian virus 5) genera. The more distantly related pneumoviruses, such as respiratory syncytial virus, are now classified in a separate subfamily (Pneumovirinae) of the Paramyxoviridae (24). The members of the Paramyxovirinae have been recently reclassified based on their P gene organizations, including the presence of a C ORF. In SeV-infected cells, the C proteins are relatively abundant and are the major products of this P gene on a molar basis. There are four independently initiated SeV C proteins (Fig. 1) expressed via a non-AUG start site (C' or Cprime), and there are both scanning-dependent (C) and scanning-independent (Y1/Y2) ribosomal initiation (reviewed in reference 7). However, morbilliviruses such as measles virus express only a single C protein, and in significantly smaller amounts than that of P (1, 3). Furthermore rubulaviruses do not contain a C ORF at all (32). The optional nature of this ORF is also apparent in other mononegaviruses. For the pneumoviruses, an overlapping ORF is absent in the P gene of respiratory syncytial virus, but the pneumonia virus of mice P gene does contain a C-like ORF, which expresses two small basic proteins (2). Similarly, for the more distantly related Rhabdoviridae, vesiculoviruses like vesicular stomatitis virus express two C proteins whereas lyssaviruses like rabies virus do not contain a C ORF of any size (30). We note that the term "C protein" refers only to the origin of its coding sequence with reference to that of SeV; it is not as yet clear whether the different proteins carry out similar functions.
The SeV C proteins (Cprime, C, Y1, and Y2) are relatively small basic proteins (175 to 215 residues), whose intracellular localization shows little or no specificity (27, 38). Only very small amounts of the C proteins are found bound to nucleocapsids intracellularly or in reconstitution experiments with transfected cell extracts (unpublished data); this presumably accounts for their vast underrepresentation in virions. Nevertheless, consistent with their presence on nucleocapsids, the C proteins appear to play a role in viral RNA synthesis. When mRNA synthesis is studied with transfected cell extracts containing the P and L proteins, elimination of C protein coexpression (by placing a stop codon just downstream of AUG201/Y2 [P/Cstop]) was found to strongly increase mRNA synthesis in vitro. Moreover, its reexpression from a separate plasmid eliminated this increase (8). The ability of C to negatively affect viral RNA synthesis depended on its coexpression with P and L, and C may therefore act during formation of the P3-L polymerase complex. Similarly, when SeV minigenome replication is reconstituted in transfected cells by using P genes which do (P/Cwt) and do not (P/Cstop) express C proteins, C protein coexpression was also found to be strongly inhibitory, in a promoter-specific manner. The genomic promoter (which also contains the start site for N mRNA synthesis) was particularly sensitive to inhibition by C protein, in contrast to genome synthesis from the antigenomic promoter (6). The C proteins also have the remarkable property of preferentially inhibiting the replication of minigenomes containing mutant promoters (26) or minigenomes which were not of hexamer length (31). In this respect, the C proteins appeared to function as viral fidelity (or stringency) factors. In infectious-virus recoveries from DNA, C protein coexpression (from the P gene support plasmid needed to initiate viral RNA synthesis) must also be repressed for a successful outcome (6, 12). It is possibly this fidelity function of C which needs to be repressed. The temporary lack of stringency of the viral polymerase may be beneficial here, since our full-length clone expresses an antigenome transcript with three extra G residues at its 5' end and is therefore not of hexamer length.
More recently, the SeV C proteins have been found to play a positive role in infections of mice (a natural host). These conclusions were based on studies of SeVMVC, an avirulent cell culture-derived mutant of the highly virulent SeVM, which differs from SeVM by only two substitutions; F170S in the protein encoded by the C gene (silent in the P ORF) and E2050A in the protein encoded by the L gene (18, 37). To examine which amino acid substitutions were responsible for the avirulence, rSeVZ carrying the C gene of either the virulent M strain (rSeVZ-CM) or the avirulent MVC strain (rSeVZ-CMVC) within the virulent Z strain background were prepared. Only the chimeric rSeVZ carrying the CMVC gene was found to be avirulent, suggesting that the normal function of the C proteins was required for virulence in mice, i.e., for multiple cycles of virus replication (13). These experiments offered the first evidence that the SeV C proteins provide a function required for virus replication, at least in mice.
This paper reports the preparation and characterization of rSeV strains which specifically do not express the Cprime, C, or Cprime plus C proteins, by mutating their ribosomal start codons. Our results suggest that (i) the functions of the C proteins are complex, in that they display both positive and negative effects on viral RNA synthesis during the course of the infection, and (ii) the functions of the individual C proteins must be partly different.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell cultures and viruses. LLC-MK2 and BHK cell lines were grown in minimal essential medium supplemented with 5% fetal calf serum. Wild-type (wt) and rSeV stocks were prepared in the allantoic cavity of 9-day-old embryonated chicken eggs and harvested after 3 days at 33°C. Titer determination and plaque isolation of rSeV were carried out for 3 to 9 days at 33°C in LLC-MK2 cells covered with a 0.3% agarose overlay containing 1.2 µg of acetyl-trypsin per ml. The 50% egg infective dose (EID50) of each viral stock was determined by injecting serial dilutions into the allantoic cavity of hen eggs as above. The presence of virus in the allantoic fluids was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10% polyacrylamide) and staining with Coomassie brilliant blue on material pelleted at 10,000 × g for 30 min through a TNE (10 mM Tris-Cl, pH 7.4, 100 mM NaCl, 1 mM EDTA)-25% glycerol cushion in an Eppendorf centrifuge. To determine the 50% tissue culture infective dose (TCID50), 4-cm petri dishes of BHK cells were infected in duplicate with serial dilutions of the virus stocks, and the cytopathic effect was monitored visually until 40 h postinfection (p.i.). At this time, cytoplasmic extracts were prepared and the levels of N protein contained in three different amounts of the extracts were determined by Western blotting with monoclonal anti-N877 antibody (25).
Generation of mutant SeV (DNA) genomes.
pGem-P/C carrying
TCT81/C' and GCG114/C mutations in the
initiation codons of the P/C mRNA have been described previously
(8). pGem-P/C combining these mutations was constructed by
fusion PCR on pGem P/C-TCT81/C' DNA. The product was
digested with SacI (in the upstream polylinker) and
EagI (position 1005 on the P/C mRNA) and then subcloned
into pGem P/C-TCT/C'. Sendai viruses containing the various
mutations in the C protein start sites were recovered from DNA by
taking advantage of the recombinogenic nature of the vaccinia
virus-based recovery system, as previously described (12,
13). Briefly, pFL3 (full-length DNA clone) was modified to
contain a deletion encompassing most of the N and P genes (pFL3-
1),
such that a rSeV could not be generated simply by the recombination of
pFL3-
1 DNA with that of the individual pGEM-N and pGEM-P support
plasmids. A shuttle vector (pN/PXho/M) containing the
deleted region plus flanking sequences into which the mutated P/C genes
were cloned was then constructed as follows. PCR was performed with a
positive-sense primer carrying an XhoI site at position 69 (of the untranslated region of the P/C mRNA) and a negative-sense
primer complementary to position 1178. The products were digested with
XhoI and EagI and inserted into the same sites of
pN/PXhoI/M. The various mutated P/C genes were then
recovered in viruses via recombination of the various
pN/PXho/M vectors with pFL3-
1. In all cases, the
relevant regions were verified by reverse transcription-PCR and DNA
sequencing.
Generation of rSeV with an alternate expression of C
proteins.
The recovery system was essentially as described
previously (12, 13). Briefly, one 9-cm dish of HeLa cells
(ca. 80% confluent) was infected with 3 PFU of vaccinia virus TF7-3
per cell (11). The cultures were transfected 1 h later
with 1.5 µg of pGEM-L, 2.5 µg of pGEM-N, 4.5 µg of
pGEM-HAP/Coff (which do not express C
proteins), 15 µg of pFL3-
1, and 5 µg of one of the
pN/PXho/M shuttle vectors carrying the desired mutation. At
24 h later, 1-
-D-arabinofuranosylcytosine (100 µg/ml) was added to inhibit vaccinia virus replication, and 24 h
after that, the cells were scraped into their medium and injected into
two or three 10-day-old embryonated chicken eggs. At 3 days later, the
allantoic fluids were harvested and reinjected undiluted into eggs. For
further passages, the stocks were generally diluted 1/1,000 before
injection. The presence of viruses in the allantoic fluids was
determined as above.
Primer extension analysis of viral RNAs. Total RNA was extracted from virus-infected cells with Trizol (Gibco-BRL) and analyzed by primer extension using with Moloney murine leukemia virus reverse transcriptase (Gibco-BRL) and 200,000 cpm of each of the following 32P-5'- primers, which had been purified on sequencing gels: NP126 (5'-126CGGCCATCGTGAACTTTGGC107-3' [numbers refer to map coordinates of the entire genome]) for estimation of antigenomes and N mRNAs and L15,270 (5'-15,270GAAGCTCCGCGGTACC15,285-3') for genomes.
Immunoblotting. C protein levels were determined by Western blotting of cytoplasmic extracts of BHK cells infected with the various viral stocks, using a rabbit anti-C polyclonal antiserum with the CSPD light detection system (Boehringer). Immunoblotting was also carried out on viruses released from cell cultures, purified by being pelleted through a TNE-25% glycerol cushion from the medium of infected BHK cells, with monoclonal anti-N877 antibody (25).
Determination of mouse pathogenicity. Specific-pathogen-free 7-week-old (female) C57BL/6 mice (Iffo Credo) were infected intranasally with 106 PFU of the various viruses. The mice were observed for symptoms and weighed daily. Groups of three mice were sacrificed on days 2, 5, 7, and 8 or 9, and the number of PFU present in 10% lung homogenates was determined on LLC-MK2 cells. The lung homogenates were also injected into 9-day-old embryonated hen eggs and passaged twice. BHK cells were infected with this allantoic fluid, and viral protein expression was monitored by immunoblotting for the N and C proteins. Total RNA was also extracted from the lung homogenates with Trizol (Gibco-BRL). cDNA was prepared with Moloney murine leukemia virus reverse transcriptase (Gibco) and amplified with the Expand high-fidelity PCR system (Boehringer) with the primers mentioned above. The PCR product DNA was sequenced.
Specific-pathogen-free, 3-week-old male mice [ICR/CRJ(CD-1) strain; Clea, Inc.] were infected intranasally with 25 µl of serially diluted virus under ether anesthesia. The mice were observed for symptoms and weighed daily. The 50% lethal dose (LD50) was calculated by the method of Reed and Muench (29). The cell infectious unit (CIU) was essentially equivalent to PFU.| |
RESULTS |
|---|
|
|
|---|
Failure to recover a totally C-minus Sendai virus. Measles virus (MeV) expresses a single C protein from its P gene, and Radecke and Billeter (28) have recovered a rMeV which cannot express its C protein due to the introduction of a stop codon into this ORF. This rMeV-Cminus strain replicated normally in cell culture, indicating that the MeV C protein does not play an essential role in the cellular replication of this paramyxovirus, at least in cell culture. A similar situation has also been found for the more distantly related rhabdovirus vesicular stomatitis virus (21). We have also attempted to recover a rSeV which cannot express any of its four C proteins, by placing a stop codon in the C ORF just downstream of the Y2 start codon (ATG201/Y2) to terminate all four C proteins (8). A full-length SeV genome expression plasmid containing the Cstop mutation was constructed by exchanging the SalI fragment of pFL3 (which includes the N-terminal region of the P/C gene) with one containing the Cstop mutation (Fig. 2). As a positive control, the SalI fragment was always exchanged with itself at the same time. Virus recoveries from pFL3 and pFL3-Cstop were carried out in parallel (by using the pGEM-P/Cstop support plasmid, so that the Cstop mutation of pFL3-Cstop could not be lost by recombination), and the resulting viruses were amplified in hen eggs. In four separate attempts, sufficient virus was present in the pFL3 recoveries that 60 µl of the second-passage allantoic fluid showed a strong pattern of SeV structural proteins when analyzed by SDS-PAGE and Coomassie blue staining. This corresponded to reference stocks containing ca. 109 to 1010 EID50/ml (Fig. 3). However, we were unable to detect virus from the pFL3-Cstop transfections by this test, even when 200 µl of sixth-passage allantoic fluid was examined.
|
|
)], which
was detectable only at extremely low PFU.
rSeV expressing two or three C proteins. To eliminate the expression of individual C proteins, we mutated their start codons individually or in combination, as detailed in Fig. 1. The mutations were first constructed in the pGEM-P/C support plasmids, so that these genes could be controlled for their ability to express the various C proteins. Mutation of ACG81/C' to TCT and ATG114/C to GCG eliminated expression of the Cprime and C proteins respectively, as expected (data not shown [cf. Fig. 1]). Mutation of ATG114/C to GCG introduces an Asp4Gly substitution in the P protein, but the only suitable P-silent mutation (ATG114/C to ACG) is unreliable in this case. The Asp4Gly substitution had no noticeable effect on the ability of P to support minigenome RNA synthesis in transfected cells. Our attempts to eliminate Y1 and Y2 expression by simultaneously mutating ATG183/Y1 and ATG201/Y2 to ACG (both silent in the P ORF) were unsuccessful. These mutations had only a minor effect in reducing Y1 and Y2 expression. Further, their simultaneous mutation to GCG more strongly reduced but did not eliminate Y1 and Y2 expression (data not shown). The Y proteins appear to be initiated by an unusual mechanism, in which the codon-anticodon interactions at the ribosomal start site are considerably less important than at standard start sites (23). Hence, we have so far been unable to prepare rSeV strains which express Cprime and C but not Y1 and Y2.
Recombinant SeV-[Cprime-minus] was routinely recovered from the transfections with either pGEM-HAP/Coff or pGEM-P/Cstop as the support plasmid, and this virus grew to the same levels as that recovered from the wt control (by the second passage in eggs). Immunoblots of BHK cells infected with this virus showed that Cprime protein expression was specifically ablated whereas C, Y1, and Y2 protein levels were normal (Fig. 1). Recombinant SeV-[C-minus] was also routinely recovered from the transfections but only with pGEM-HAP/Coff as the support plasmid. Immunoblots of BHK cells infected with [C-minus] showed that C protein expression was specifically ablated whereas Cprime protein accumulation was normal. However, Y1, and Y2 protein levels had risen strongly, so that their combined level easily replaced that of the missing C protein (Fig. 1). [Cprime/C-minus], the start codon double mutant, in contrast, was recovered from the transfections in only one-third of the attempts and again only with pGEM-HAP/Coff as the support plasmid, and it reached titers suitable for high-multiplicity cell culture infection by passage 4 (see below). Immunoblots of extracts of cells infected with [Cprime/C-minus] showed that Cprime and C protein expression was specifically ablated and that Y2 protein levels alone had risen strongly. It is possible that some of the increase in Y1 and Y2 levels when C or Cprime plus C expression is ablated is simply due to increased initiation at ATG183/Y1 and ATG201/Y2 when ATG114/C is no longer functional. The increasing difficulty in recovering rSeV strains which do not express the Cprime, C, and Cprime plus C proteins is in line with our inability to recover a totally C-minus virus.Titers of the rSeV stocks. Allantoic fluid stocks suitable for high-multiplicity infections of cell cultures (5 × 108 to 20 × 108 PFU/ml) were routinely prepared in recoveries of [Cprime-minus] and [C-minus], as in the parallel rSeVZ or rSeVZ-NH wt controls [Ge (MK2), Fig. 3]. These virus stocks also contained roughly similar amounts of virus proteins (data not shown; see Materials and Methods). [Cprime/C-minus] (the double mutant) was recovered twice (dm1 and dm2), and although fourth- passage stocks of these viruses contained considerable amounts of viral proteins (only ca. 10-fold less than the wt stock [Fig. 3]), we were unable to determine the titers of the double-mutant stocks in Geneva. In contrast to the three other rSeV strains, which formed clear plaques 1 to 2 mm in diameter by day 4, the double mutant did not form visible plaques by day 5, when our serum-free monolayers began to disintegrate. A fresh stock of dm2, however, did form very small plaques by day 7 in Kobe (Fig. 4), albeit with a titer of only 4 × 106 PFU/ml, i.e., 3 log units lower than that for the wt control (6 × 109 PFU/ml) (Fig. 3).
|
Infection of cells in culture. Parallel 4-cm-diameter BHK cultures (ca. 107 cells) were infected with 2 (MK2) PFU of wt, [Cprime-minus], or [C-minus] per cell and 2 (BHK) TCID50 of dm2Ge per cell [2 PFU of wt virus per cell is equivalent to 10 to 20 (BHK) TCID50/cell (Fig. 3)]. Infected cultures were harvested at various times after infection, and the relative amounts of viral genomes, antigenomes, and N mRNAs present in equal samples of the total RNA (one-quarter of each dish) were estimated by duplex primer extension (Fig. 5A and B). Relative to the wt infection, the [Cprime-minus] and [C-minus] infections led to the accumulation of significantly more viral RNA, and this was most apparent in the [Cprime-minus] infections, where the accumulation occurred earlier and to higher levels. The double-mutant infection, in contrast, led to the accumulation of relatively little viral RNA by 20 h p.i. From 20 to 30 h p.i., however, a large increase in the amounts of the three viral RNAs occurred in this infection. In particular, N mRNAs had now accumulated to higher levels than in the wt and [C-minus] infections (but remained below those of the [Cprime-minus] infection) and the genome and antigenome levels approached those of the wt infection by 30 h p.i. N mRNA levels continued to increase until 40 h p.i. in the double-mutant infection and reached levels equivalent to the peak of the [Cprime-minus] infection, whereas the N mRNA levels decreased from 30 to 40 h p.i. infection in the three other infections. Similarly, genomes continued to accumulate from 30 to 40 h p.i. in the double-mutant infection, such that their abundance was equal to those in the [Cprime-minus] and [C-minus] infections at this time, which were all fourfold higher than in the wt infection at 40 h p.i. Independent isolates of all three mutant viruses (e.g., dm1 and dm2) behaved similarly in cell culture infections (data not shown).
|
|
Infection of mice. Groups of 7-week-old, specific-pathogen-free C57BL/6 mice were inoculated intranasally with 106 PFU of [Cprime-minus] or [C-minus], as well as SeVZ as a virulent wt virus control. As an avirulent virus control, the same mice were also infected with SeVMVC, which is avirulent for 3-week-old (outbred) ICR mice (18, 37). All the mice were weighed daily as a general indicator of their health (Fig. 7A), since loss of body weight is a useful indicator of SeV pathogenicity in these animals (20). Groups of three mice were sacrificed at various times p.i., and the virus titers (PFU on MK2 cells) in their lungs homogenates were determined.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
It has been suspected for some time that the paramyxovirus C proteins play an important role in natural infections. In contrast to the V proteins (which are coded for in part by the other ORF that overlaps the P ORF [Fig. 1]) (32, 34), C proteins are expressed in all viruses of the Respirovirus and Morbillivirus genera. Furthermore, in long-term persistent MeV infections of the human brain (subacute sclerosing parencephalitis), where expression of the M protein and the cytoplasmic tail of the F protein are often lost by point mutations which close these ORFs, the C protein ORF has always remained intact (4). The paramyxovirus C proteins have nevertheless remained a riddle, since it has never been clear why some viruses express four C proteins and some express only one. More recently, characterization of the C gene of an avirulent mutant virus has provided evidence that these proteins are required for multiple cycles of replication in mice but dispensable for growth in hen eggs or cell culture (13). This latter property, however, is unlikely to represent the pressure maintaining the integrity of this overlapping ORF, especially in reference strains that have been passaged in eggs for countless generations. This paper provides more direct evidence that the SeV C proteins play an important role in virus replication at the cellular level, as well as hinting at why this virus expresses a nested set of four C proteins. We have been unable to prepare a totally C-minus virus which grows to detectable levels in eggs, even though we have recovered rSeV strains which cannot express their V and/or W proteins by the same approach (9, 10). We have, however, been able to prepare rSeV strains that cannot express their Cprime, C, or Cprime plus C proteins, by mutating their ribosomal start codons. The characterization of their infections of cell culture (and eggs) has added insight into the possible function(s) of these proteins.
In one respect, our results agree with previous findings that coexpression of either Cprime or C individually (along with the P and L proteins) leads to an inhibition of RNA synthesis in transfected cell extracts whereas coexpression of Y1 and Y2 was not inhibitory (8). These results suggested that one function of Cprime or C is to negatively affect viral mRNA synthesis. In this view, viral transcription is less inhibited in the [C-minus] infection than in the wt infection due to the absence of C, and the overaccumulation of Y1/Y2 cannot compensate for this absence. Similarly, transcription has apparently been even less inhibited in the [Cprime-minus] infections, presumably because Cprime is the more inhibitory of the two. However, in contrast to [Cprime-minus] infections, where the viral RNAs overaccumulate precociously, the simultaneous absence of both Cprime and C in the double-mutant infections leads to a delay in viral RNA accumulation. This suggests that Cprime and C also provide a positive function without which the onset of viral RNA accumulation is delayed. We presume that either the Cprime or C proteins (but not the Y proteins) can supply this required function in natural infections. Viruses unable to express either protein individually would have this function provided by the remaining Cprime or C protein and would not undergo a delay in viral RNA accumulation.
Although viral RNA synthesis is delayed in the double-mutant infection, once started, it quickly leads to the overaccumulation of the viral RNAs as seen in the [Cprime-minus] infection, consistent with the absence of the inhibitory Cprime (and C) protein. The remaining Y1 and Y2 proteins apparently cannot compensate for the absence of Cprime and C in this delay, but this may be misleading. It is presumably the presence of Y1 and Y2 expression in the Cprime and C-minus infection that accounts for the relative viability of the double-mutant virus with respect to rSeV-Cstop. Y1 and Y2 may to some extent also provide the required function, but less efficiently, accounting for the delay in the onset of viral RNA accumulation. Furthermore, we note that in contrast to transfected-cell systems, where (ectopic) C protein expression inhibits minigenome replication in a promoter-specific manner, we have seen no evidence for this in natural virus infections. Although mutation in the C gene (13, 18) or elimination of Cprime and/or C expression (Fig. 5) leads to significantly higher levels of mRNA, the ratios of antigenomes to genomes remain unaltered. The inhibitory effects of C may thus act primarily on mRNA transcription in natural virus infections, as opposed to acting on antigenome synthesis. We also note that the simultaneous ablation of all C protein expression (Cstop) does not adversely affect genome amplification in transfected cells (6, 31), as it does during natural virus infections. We presume that the positive function of C required early in natural virus infection is somehow bypassed in the transfected-cell system, where SeV protein expression is no longer under the control of the viral genome.
The view that Cprime and C provide a positive function for virus replication is supported by the specific infectivities of these virus stocks prepared in eggs. Viruses in which Cprime or C have been individually ablated grow only slightly less well in eggs than wt virus does (i.e., the titers of their stocks are only 4- and 10-fold lower by PFU and EID50, respectively [Fig. 3]). The double-mutant virus stock, however, contains 3 log units less (MK2) PFU than does the wt virus and 6 log units less EID50 (even though the amount of virus protein in these allantoic fluids is reduced by only 1 log unit). As before, either Cprime or C (but not the Y proteins) can presumably supply this required function (for growth in eggs), and so only the double mutant displays the highly debilitated phenotype. One explanation for the exaggerated effect on EID50 is that amplification of the infectious unit is more exponential here and may require more cycles of replication to be detected. Infections that liberate fewer virus particles (Fig. 6) and with lower specific infectivities (Fig. 3) might be expected to be associated with a particularly low EID50. Nevertheless, the double-mutant stocks would contain almost as many virions as the wt virus stocks would when eggs are inoculated with high doses, since fewer cycles of replication are needed to reach these levels.
In spite of the similar abilities of [Cprime-minus] and [C-minus] to be amplified in eggs, [Cprime-minus] accumulated to high levels in the lungs of these infected mice and remained highly virulent for this animal host (like SeVZ) whereas infectious virus did not accumulate in the lungs of [C-minus]-infected mice, and this virus infection was strongly attenuated. These results further suggest that the Cprime and C proteins cannot be functionally equivalent in all respects, since C can apparently replace Cprime for virulence in mice whereas Cprime (or Y1 and Y2) cannot replace C for this property. This latter result is somewhat surprising, since Cprime contains all the sequences of C plus an 11-amino-acid N-terminal extension. This difference in virulence may be due to less [C-minus] than [Cprime-minus] being liberated during the initial infection of the mouse respiratory epithelium, similar to what is seen in BHK cells (Fig. 6), allowing the host antiviral defense mechanisms enough time to operate. Some of these antiviral defense mechanisms (e.g., natural killer cells) would presumably be absent from hen eggs.
The view of the SeV C proteins that emerges from this study is that
their expression is complex because the different C proteins carry out
nonoverlapping functions to some extent. For example, Cprime and C (but not Y1 and Y2) act as inhibitors of viral
RNA synthesis, and C (but not Cprime, Y1, or Y2) is
specifically required for virulence (multiple cycles of replication) in
an animal host. Furthermore, some (but not all) of these proteins are
also apparently required for an essential function(s) in virus
replication at the cellular level, which remains to be elucidated. This
functional complexity, due to a nested set of C proteins, is made
possible by the translational gymnastics used by this mRNA to
direct ribosomal initiation at the various start codons (7).
Cprime is initiated at a non-ATG codon (ACG81),
where the bases at positions +5 and +6, in addition to those at
positions
3 and +4, play an important role (5, 15). P, V,
and W (all ATG104) and C (ATG114) are initiated
by leaky scanning ribosomes, since mutating ACG81 to ATG
ablates initiation from ATG104/P and ATG114/C.
Initiation from ATG183/Y1 and ATG201/Y2, in
contrast, does not appear to be due to a leaky scanning mechanism, since the translation of Y1 and Y2 in these constructs is either unaffected or enhanced (7). Rather, initiation from
ATG183/Y1 and ATG201/Y2 appears to be due to a
shunting mechanism, in which ribosomes are translocated from a region
upstream of ACG81 directly to an acceptor site, which
includes ATG183/Y1 and ATG201/Y2
(23). The tripartite leader of adenovirus late mRNAs
mediates a similar shunting mechanism, and in this case shunting is
promoted by heat shock (39). Translation of the four SeV C
proteins does not respond to heat shock (data not shown). However, the
relative amounts of the various P gene products sometimes differ widely in cell culture infections (e.g., Y1 and Y2 are sometimes undetectable [Fig. 2] and the ratio of Cprime to C varies
severalfold). Translation of the four SeV C proteins might respond to
other stress-related modifications of translational capacity, such as
those induced by interferon (35). Different mechanisms of
translational initiation (non-ATG codons, leaky scanning, and ribosomal
shunting) may have different requirements for initiation factors. If
so, the relative amounts of the various P gene products may be
determined in part by the stress-related modifications of the host cell
translational apparatus. These products would then be well placed to
act as sensors of the host antiviral defense mechanisms, particularly
those of the innate immune system, and to thwart this defense
accordingly.
Our results suggest that Cprime and C provide a positive function for viral RNA accumulation early in intracellular virus replication but that they act as inhibitors at later times. Although these two properties of the C proteins act in opposite directions, it is possible that they are, in fact, the same property. Whereas the relative ratios of P, L, and the N:RNA template are constant throughout the virus life cycle, the C proteins are very abundant at the later stages of infection but are largely excluded from virions. Intracellular viral RNA synthesis thus begins with relatively little C in proportion to P, L, and N:RNA, and this ratio increases as the infection proceeds. The opposite effects of C early and late in infection could then be due to the different ratios of C to the other viral components involved in RNA synthesis. Exactly how C acts in modulating RNA synthesis is far from clear. The C proteins (as glutathione S-transferase fusion proteins) bind the L protein (17) but apparently act through P, since their inhibitory effects (on viral RNA synthesis in transfected cells) are relieved by overexpressing P and not by overexpressing L (8, 31). We have suggested that high concentrations of C act as viral fidelity factors by somehow causing the viral polymerase to be more selective in its choice of promoters and that this results in a less active enzyme (31). It is possible that the low concentrations of C found intracellularly at the start of the replicative cycle interact with the P-L polymerase in a similar manner but that these limited interactions have a positive (as opposed to a negative) effect on polymerase activity. If so, the trace amounts of these proteins found in virions could play an important role in the initiation of viral RNA accumulation in infected cells.
It is also possible that the C proteins exert their positive effects indirectly, by helping to form active polymerase complexes intracellularly prior to virion release. The vif protein (viral infectivity factor) is a late-gene product of most lentiviruses and acts during virus assembly to allow the formation of particles competent for the early steps of infection (reviewed in reference 33). The effect of vif is probably indirect, since (like the SeV C proteins) there is very little vif protein in virions. Human immunodeficiency virus type 1 strains with mutations in the vif gene efficiently produce virus particles, but these fail to carry out proviral DNA synthesis due to improperly packed nucleoprotein cores (16, 36). Cprime/C-minus SeV prepared in eggs have higher particle/PFU ratios than do wt or single-mutant virions (Fig. 3). The delay in viral RNA accumulation seen at the start of the double-mutant infections may then be due not only to the paucity of C proteins at this time but also to improperly assembled viral cores [P + L + N:RNA] contained in these virions.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Genetics and Microbiology, University of Geneva School of Medicine, CMU, 9 Ave. de Champel, CH1211 Geneva, Switzerland. Phone: 41 22 702 5657. Fax: 41 22 702 5702. E-mail: Daniel.Kolakofsky{at}medecine.unige.ch.
Present address: Microbiology and Tumorbiology Center, Karolinska
Institutet, S-171 77 Stockholm, Sweden.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Alkhatib, G.,
B. Massie, and D. J. Briedis.
1988.
Expression of bicistronic measles virus P/C mRNA by using hybrid adenoviruses: levels of C protein synthesized in vivo are unaffected by the presence or absence of the upstream P initiator colon.
J. Virol.
62:4059-4069 |
| 2. |
Barr, J.,
P. Chambers,
P. Harriott,
C. R. Pringle, and A. J. Easton.
1994.
Sequence of the phosphoprotein gene of pneumonia virus of mice: expression of multiple proteins from two overlapping reading frames.
J. Virol.
68:5330-5334 |
| 3. |
Bellini, W. J.,
G. Englund,
S. Rozenblatt,
H. Arnheiter, and C. D. Richardson.
1985.
Measles virus P gene codes for two proteins.
J. Virol.
53:908-919 |
| 4. | Billeter, M. A., R. Cattaneo, P. Spielhofer, K. Kaelin, M. Huber, A. Schmid, K. Baczko, and V. ter Meulen. 1994. Generation and properties of measles virus mutations typically associated with subacute sclerosing panencephalitis. Ann. N. Y. Acad. Sci. 724:367-377[Abstract]. |
| 5. | Boeck, R., and D. Kolakofsky. 1994. Positions +5 and +6 can be major determinants of the efficiency of non-AUG initiation codons for protein synthesis. EMBO J. 13:3608-3617[Medline]. |
| 6. |
Cadd, T.,
D. Garcin,
C. Tapparel,
M. Itoh,
M. Homma,
L. Roux,
J. Curran, and D. Kolakofsky.
1996.
The Sendai paramyxovirus accessory C proteins inhibit viral genome amplification in a promoter-specific fashion.
J. Virol.
70:5067-5074 |
| 7. | Curran, J., P. Latorre, and D. Kolakofsky. 1998. Translational gymnastics on the Sendai virus P/C mRNA. Semin. Virol. 8:351-357. |
| 8. | Curran, J., J.-B. Marq, and D. Kolakofsky. 1992. The Sendai virus nonstructural C proteins specifically inhibit viral mRNA synthesis. Virology 189:647-656[Medline]. |
| 9. | Delenda, C., S. Hausmann, D. Garcin, and D. Kolakofsky. 1997. Normal cellular replication of Sendai virus without trans-frame nonstructural V protein. Virology 228:55-62[Medline]. |
| 10. | Delenda, C., G. Taylor, S. Hausmann, D. Garcin, and D. Kolakofsky. 1998. Sendai viruses with altered P, V, and W protein expression. Virology 242:327-337[Medline]. |
| 11. |
Fuerst, T. R.,
E. G. Niles,
F. W. Studier, and B. Moss.
1986.
Eukaryotic transient-expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase.
Proc. Natl. Acad. Sci. USA
83:8122-8126 |
| 12. | Garcin, D., T. Pelet, P. Calain, L. Roux, J. Curran, and D. Kolakofsky. 1995. A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: generation of a novel copy-back nondefective interfering virus. EMBO J. 14:6087-6094[Medline]. |
| 13. | Garcin, D., M. Itoh, and D. Kolakofsky. 1997. A point mutation in the Sendai virus accessory C proteins attenuates virulence for mice, but not virus growth in cell culture. Virology 238:424-431[Medline]. |
| 14. | Giorgi, C., B. M. Blumberg, and D. Kolakofsky. 1983. Sendai virus contains overlapping genes expressed from a single mRNA. Cell 35:829-836[Medline]. |
| 15. | Grunert, S., and R. J. Jackson. 1994. The immediate downstream codon strongly influences the efficiency of utilization of eukaryotic translation initiation codons. EMBO J. 13:3618-3630[Medline]. |
| 16. | Höglund, S., A. Ohagen, K. Lawrence, and D. Gabudzda. 1994. Role of vif during packing of the core of HIV-1. Virology 201:349-355[Medline]. |
| 17. | Horikami, S. M., R. E. Hector, S. Smallwood, and S. A. Moyer. 1997. The Sendai virus C protein binds the L polymerase protein to inhibit viral RNA synthesis. Virology 235:261-270[Medline]. |
| 18. | Itoh, M., Y. Isegawa, H. Hotta, and M. Homma. 1997. Isolation of an avirulent mutant of Sendai virus with two amino acid mutations from a highly virulent field strain through adaptation to LLC-MK2 cells. J. Gen. Virol. 78:3207-3215[Abstract]. |
| 19. | Kato, A., K. Kiyotani, Y. Sakai, T. Yoshida, and Y. Nagai. 1997. The paramyxovirus Sendai virus V protein encodes a luxury function required for viral pathogenesis. EMBO J. 16:678-587. |
| 20. | Kiyotani, K., S. Takao, T. Sakaguchi, and T. Yoshida. 1990. Immediate protection of mice from lethal Sendai virus infection by a temperature sensitive mutant (HVJpi) possessing homologous interfering capacity. Virology 177:65-74[Medline]. |
| 21. | Kretzschmar, E., R. Peluso, M. J. Schnell, M. A. Whitt, and J. K. Rose. 1996. Normal replication of vesicular stomatitis virus without C proteins. Virology 216:309-316[Medline]. |
| 21a. | Kurotani, A., K. Kiyotani, A. Kato, T. Shioda, Y. Saki, K. Mizumoto, T. Yoshida, and Y. Nagai. 1998. The paramyxovirus, Sendai virus, C proteins are categorically nonessential gene products but silencing their expression severely impairs viral replication and pathogenesis. Genes Cells 3:111-124. [Abstract] |
| 22. | Lamb, R. A., and R. G. Paterson. 1991. The nonstructural proteins of paramyxoviruses, p. 181-210. In D. W. Kingsbury (ed.), The paramyxoviruses. Plenum Press, New York, N.Y. |
| 23. | Latorre, P., D. Kolakofsky, and J. Curran. The Sendai virus Y proteins are initiated by a ribosomal shunt. Submitted for publication. |
| 24. | Murphy, F. A., C. M. Fauquet, and D. H. L. Bishop. 1994. Sixth report of the international committee on taxonomy of viruses. Arch. Virol. Suppl. 10:268-274. |
| 25. | Orvell, C., and M. Grandien. 1982. The effects of monoclonal antibodies on biological activities of structural proteins of Sendai virus. J. Immunol. 129:2779-2787[Medline]. |
| 26. | Pelet, T., C. Delenda, O. Gubbay, D. Garcin, and D. Kolakofsky. 1996. Partial characterization of a Sendai virus replication promoter and the rule of six. Virology 224:405-414[Medline]. |
| 27. | Portner, A., K. C. Gupta, J. M. Seyer, E. H. Beachey, and D. W. Kingsbury. 1986. /87. Localization and characterization of Sendai virus nonstructural C and C' proteins by antibodies against synthetic peptides. Virus Res. 6:109-121[Medline]. |
| 28. | Radecke, F., and M. A. Billeter. 1996. The nonstructural C protein is not essential for multiplication of Edmunston B strain measles virus in cultured cells. Virology 217:418-421[Medline]. |
| 29. | Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hyg. 23:493-497. |
| 30. |
Spiropoulou, C. F., and S. T. Nichol.
1993.
A small highly basic protein is encoded in overlapping frame within the P gene of vesicular stomatitis virus.
J. Virol.
67:3103-3110 |
| 31. | Tapparel, C., S. Hausmann, T. Pelet, J. Curran, D. Kolakofsky, and L. Roux. 1997. Inhibition of Sendai virus genome replication due to promoter-increased selectivity: a possible role for the accessory C proteins. J. Virol. 71:9588-9599[Abstract]. |
| 32. | Thomas, S. M., R. A. Lamb, and R. G. Paterson. 1988. Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5. Cell 54:891-902[Medline]. |
| 33. | Trono, D. 1995. HIV accessory proteins: leading roles for the supporting cast. Cell 82:189-192[Medline]. |
| 34. |
Vidal, S.,
J. Curran, and D. Kolakofsky.
1990.
Editing of the Sendai virus P/C mRNA by G insertion occurs during mRNA synthesis via a virus-encoded activity.
J. Virol.
64:239-246 |
| 35. | Vilcek, J., and G. C. Sen. 1996. Interferons and other cytokines, p. 375-399. In B. N. Fields, D. N. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa. |
| 36. |
von Schwedler, U.,
J. Song,
C. Aiken, and D. Trono.
1993.
vif is crucial for human immunodeficiency virus type 1 proviral DNA synthesis in infected cells.
J. Virol.
67:4945-4955 |
| 37. | Wang, X.-L., M. Itoh, H. Hotta, and M. Homma. 1994. A protease activation mutant, MVCES1, as a safe and potent live vaccine derived from currently prevailing Sendai virus. Virology 68:3369-3373. |
| 38. | Yamada, H., S. Hayata, T. Omata-Yamada, H. Taira, K. Mizumoto, and K. Iwasaki. 1990. Association of the Sendai virus C protein with nucleocapsids. Arch. Virol. 113:245-253[Medline]. |
| 39. |
Yueh, A., and R. J. Schneider.
1996.
Selective translation initiation by ribosome jumping in adenovirus-infected and heat-shocked cells.
Genes Dev.
10:1557-1567 |
This article has been cited by other articles:
| |||||||||||||||