Previous Article | Next Article 
J Virol, July 1998, p. 5919-5926, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Adeno-Associated Virus Vector-Mediated Transgene
Integration into Neurons and Other Nondividing Cell Targets
Ping
Wu,1
M. Ian
Phillips,2
John
Bui,2 and
Ernest F.
Terwilliger1,*
Divisions of Experimental Medicine and
Hematology/Oncology, Beth Israel Deaconess Medical Center and Harvard
Institutes of Medicine, Boston, Massachusetts
02115,1 and
Department of Physiology,
College of Medicine, University of Florida, Gainesville, Florida
326102
Received 20 June 1997/Accepted 23 March 1998
 |
ABSTRACT |
The site-specific integration of wild-type adeno-associated virus
(wtAAV) into the human genome is a very attractive feature for the
development of AAV-based gene therapy vectors. However, knowledge about
integration of wtAAV, as well as currently configured recombinant AAV
(rAAV) vectors, is limited. By using a modified Alu-PCR technique to
amplify and sequence the vector-cellular junctions, we provide the
first direct evidence both in vitro and in vivo of rAAV-mediated
transgene integration in several types of nondividing cells, including
neurons. This novel technique will be highly useful for further
delineating the mechanisms underlying AAV-mediated integration,
including issues of frequency, site preference, and DNA rearrangement
in human as well as animal cells. Results from these studies should be
beneficial for the development of the next generation of gene delivery
vectors.
 |
INTRODUCTION |
Efficient gene transfer and stable
transgene expression are two key features required for effective human
gene therapy for congenital as well as many acquired disorders.
Adeno-associated virus (AAV)-derived vectors are promising candidates
for gene therapy because of their ability to mediate highly efficient
gene transfer into several clinically relevant nondividing cell types, including neurons (7, 21, 28) and muscle cells (9, 13, 15, 22, 42), without inducing pathogenic or inflammatory side
effects. Long-term expression of transgenes after AAV vector transduction into these tissues has also been documented (13, 15,
28, 42). One possible mechanism of AAV transgene stability is
integration into the genomes of the transduced cells.
AAV is a human parvovirus with a 4.7-kb DNA genome containing two open
reading frames, which encode the viral regulatory (rep) and
structural (cap) proteins under the control of the p5, p19, and p40 promoters (25). The wild-type AAV (wtAAV) is able to integrate site specifically into the human host genome, at a particular locus (AAVS1) in chromosome 19 (16, 20, 34). This specific integration feature of AAV is believed to be mediated through its
inverted terminal repeat (ITR) and Rep68 or Rep78 protein (4, 11,
27, 38). Rep-containing AAV vectors retain this specific
integration feature, as demonstrated by our group (40) and
others (1, 35). However, the rep gene is
undesirable for engineering AAV-transducing vectors, due to its strong
inhibitory effects on gene expression and cell growth (2).
Recently, several groups (8, 14, 30, 33) demonstrated that
rep
AAV vectors could also induce DNA
integration in immortalized cell lines including 293 cells, although
not in a site-specific fashion. However, there has been no fully
convincing and direct evidence confirming the integration of AAV
recombinants in nondividing cells. Our previous observation of a
progressively increasing PCR-amplified transgene-specific signal in
high-molecular-weight DNA samples from transduced human NT neurons was
shadowed by the possibility of episomal replication and/or
single-to-double-strand conversion of the AAV vector (7).
Even recently reported Southern analysis data, claimed as evidence
of AAV-mediated integration in nondividing human CD34+
hematopoietic progenitor cells (10) and mouse muscle cells (42), could not rule out possible contributions from
undefined concatemers of episomal forms of the vectors. Furthermore,
the requirement for large amounts of genomic DNA renders this technique problematic for addressing the integration issue in small samples of
cells or tissues both in vitro and in vivo. In support of AAV vector
integration in mouse muscle cells, Fisher et al. (9) recently reported other lines of evidence, including PCR detection of
AAV vector persistence as head-to-tail concatemers, which are frequently found in the integrated stage. However, it is not clear whether episomal forms of AAV or its derivatives exist with this head-to-tail structure, and thus the possibility of episomal
contamination again could not be absolutely excluded. PCR amplification
with one primer targeting the chromosome 19 AAVS1 region is also not applicable, due to the fact that rep
AAV
vectors do not appear to integrate with the same site-specific pattern
as the wild-type virus. Thus, none of the current methodologies is able
to comprehensively characterize the frequency of integration or address
the possibility of AAV-mediated rearrangement in the integration site
(22) in nondividing populations, especially in an in vivo
setting.
In seeking a reliable method to analyze AAV-mediated integration in
neural tissues, an advanced Alu-PCR approach (24)
attracted our attention. As the major family of short interspersed
repeat DNAs in humans, Alu sequences are present at the
level of 9 × 105 copies per genome (26).
They have been well characterized as 7SL RNA dimeric retropseudogenes,
about 300 bp in length (36, 37). The high frequency of
Alu sequences, appearing on average every 4 kb in the human
genome, in combination with PCR techniques which can amplify long DNA
fragments should in theory allow identification of any integrated
exogenous DNA. One of the obvious advantages of an Alu-PCR
technique is its ability to discriminate against episomal forms of AAV
vectors by employing one primer specifically targeting the
Alu sequences in the human genome. Furthermore, it has been
shown that an Alu-equivalent sequence, B1, is present in the
rodent genome at a similar frequency. Since the rodent is one of the
most frequently used animal models for in vivo gene transfer studies,
it is important to determine whether these AAV vectors, derived from a
human virus, integrate into rodent tissues in vivo. We now report a
successful methodology applying Alu-PCR and B1-PCR to
identify rep
AAV vector-mediated DNA
integration in nondividing cells of human origin in vitro and rodent in
vivo, respectively. Our findings demonstrate stable AAV vector
integration occurring in several highly susceptible targets.
 |
MATERIALS AND METHODS |
CMV
-gal AAV vectors.
Construction and packaging of a
recombinant AAV (rAAV) plasmid, CMV
-gal (previously named
AAV
-gal), have been described in detail previously (7).
Briefly, semiconfluent 293 cells were infected with adenovirus type 5 (Ad5; provided by N. Muzyczka, University of Florida) and then
cotransfected with 18 µg of CMV
-gal vector plasmid and 6 µg of
pAd8 helper plasmid (provided by R. J. Samulski, University of
North Carolina), using a standard calcium phosphate precipitation
method. Three days posttransfection, cells were harvested and subjected
to four freeze-thaw cycles to release the cell-associated virions.
Contaminating Ad5 was inactivated by heating to 56°C for 30 min, and
any remaining plasmid DNA was removed by treatment with 25 U of
RNase-free DNase per ml at 37°C for 30 min. In some experiments,
these AAV preparations were further purified by two rounds of
ultracentrifugation on a CsCl gradient (1.38 g/ml). Packaged CMV
-gal
viral stocks were titered by the infectious center assay, a
modification of the method described by McLaughlin et al.
(23). Briefly, 50,000 293 cells were infected with serially
diluted AAV stocks (1:1 to 1:105) together with wtAAV and
Ad5, both at a multiplicity of infection (MOI) of 5. After 30 h,
cells were resuspended in 25 mM EDTA-phosphate-buffered saline and
then trapped on a nylon membrane by vacuum filtration. Total DNA was
fixed and then hybridized with a specific 32P-labeled
-galactosidase probe. The numbers of labeled dots representing the
number of infected cells containing the actively replicated CMV
-gal
were counted and plotted to determine the infectious units (IU) per ml.
The titers of our packaged viral lysates were usually in the range of
108 IU/ml.
Cells.
293 cells were maintained in Eagle's minimal
essential medium containing 10% fetal bovine serum (FBS) and
penicillin-streptomycin (pen/strep). The method for preparing human NT
neurons was described previously (39). Briefly, the
precursor NT2 cells were treated with 10 µM retinoic acid for 4 to 5 weeks and then replated at low density (1:6). One to two days later,
top layers containing differentiated cells were mechanically dislodged
and replated in culture dishes precoated with 0.01%
poly-D-lysine-1:20 Matrigel (Collaborative Research).
Cells were cultured in Dulbecco modified Eagle essential medium-10%
FBS-pen/strep plus mitotic inhibitors for 3 weeks. The enriched and
terminally differentiated neurons were maintained in Opti-MEM 1-5%
FBS-pen/strep. Human primary alveolar macrophages from bronchoalveolar
lavages were cultured in RPMI 1640-10% FBS-pen/strep. Transduction
was performed by incubating cells with packaged CMV
-gal vector at an
MOI of 5 in a limited amount of medium without serum for 90 min at
37°C. Cells were then cultured in appropriate media with serum for
another week.
Animals.
Adult male Sprague-Dawley rats (weighing 250 to
270 g; Harlan Sprague-Dawley, Inc., Indianapolis, Ind.) were
maintained in well-ventilated rooms at 24°C, 50% relative humidity,
and a 12-h/12-h daily light cycle. Purina Rat Chow and tap water were
given ad libitum. Intracerebroventricular injection of AAV vectors was performed as previously described (29). Briefly, animals
were anesthetized with pentobarbital (65 mg/kg of body weight
intraperitoneally). Five microliters of CMV
-gal vector (5 × 108 IU/ml) or artificial cerebrospinal fluid was injected
into the left lateral ventricle on the coordinates of A-P (1 mm behind the bregma), D-V (5 mm from the skull), and Lat (1.2 mm). Two weeks
postinjection, animals were euthanized and their brain tissues were
collected for DNA isolation.
Alu-PCR and Southern hybridization.
High-molecular-weight DNA was extracted from cultured cells or brain
tissues 1 to 2 weeks after CMV
-gal transduction, using Puregene DNA
isolation kits (Gentra Systems, Research Triangle Park, N.C.); 100-ng
DNA samples were subjected to Alu- or B1-PCR.
dUTP-containing primers used in the first 10 PCR cycles included one
B1, one CMV, and two Alu primers. The Alu5 (Fig.
1) and Alu3 primers were
complementary to the 5' and 3' regions of the Alu consensus
sequence, respectively. They were designed according to the description
of Minami et al. (previously named A5 and A3 [24])
with their 5' ends linked to a tag sequence. The B1-5 primer
(CAGUGCCAAGUGUUUGCUGACGCCAAGUGCUGGGAUUAAAGG)
included a sequence covering the 5' region of the B1 consensus
sequence (5) and the same tag (underlined nucleotides) used
in the Alu primers. C1 (AUUAUUGACGUCAAUGGGCGGGGGUCGUUG)
was a CMV-specific primer (Fig. 1). The GeneAmp XL PCR kit and
AmpliWax PCR Gem (both from Perkin-Elmer/Applied Biosystems, Foster
City, Calif.) were used in combination with the hot-start technique in
order to achieve the optimal DNA amplification. The rTth DNA
polymerase-XL (for extra-long [XL] amplification), the optimized
enzyme used in the kit, contains both polymerase and proofreading
activities and allows XL PCR amplification of up to 22 kb from human
genomic DNA. The first 10 cycles were conducted according to the
manufacturer's instructions. Different amounts and combinations of
either 5' or 3' primer ranging from 10 to 100 pmol were tested
empirically. Following 10 2-step cycles (94°C for 30 s and
61°C for 6 min), each sample was incubated with 1 U of uracil DNA
glycosylase at 37°C for 30 min and then heated for 10 min at 94°C
to break DNA strands at apurinic dUTP sites.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 1.
Schematic of Alu-PCR. Human genomic DNA from
CMV -gal-transduced cells was amplified by using the first set of
primers: Alu5, an Alu-specific primer containing
a tag; and C1, a CMV-specific primer. After an initial 10 cycles of
PCR, the first set of primers was destroyed by uracil DNA
glycosylase-induced nicks at dUTP (filled box). cTag5 (open box)
represents a sequence complementary to the tag sequence on the newly
synthesized strand. These PCR products were further amplified by using
an internal primer, C2, for the CMV sequence plus TagA5, containing 16 nucleotides of Tag sequence and 6 nucleotides of Alu5
sequence. C3 was used as a specific CMV oligonucleotide probe for
Southern hybridization. C4 and TagA5 were used to further amplify the
above Alu-PCR products in order to obtain discrete bands for
direct sequencing.
|
|
These initial PCR products were further amplified by using an internal
primer, C2 (Fig.
1), corresponding to the CMV sequence
(GGCGGGCCATTTACCGTAAGTTATGT), in combination with one of the
following
tag primers. TagA5 (or Tag5) (
24) and TagA3 (or
Tag3) (
24)
were so designated because they contained mainly
the tag sequence
but also a small portion (six nucleotides) of 5' and
3' regions
of the
Alu repeat, respectively. TagB
(CAAGTGTTTGCTGACGCCAAGT)
had the same tag sequence with an
additional six nucleotides derived
from the B1 repeat. After addition
of the second pair of primers
(the Tag and CMV nested primers), the
"touchdown" PCR technique
was used for further amplification. This
specific technique was
developed to minimize mispriming-induced
nonspecific PCR amplification,
especially when a complex genome is used
as a template (
6).
It started with a denaturation step at
94°C for 30 s, followed
by an annealing step for 30 s with
the temperature decreasing
1°C every second cycle from 65 to 55°C
and then an extension step
at 72°C for 5 min; 20 cycles at the final
touchdown temperature
(55°C) were followed by a final extension at
72°C for 8 min.
Aliquots of 25 to 35 µl of each reaction product (out of a 100-µl
total) were fractionated on a 1% agarose gel, transferred
to nylon
membrane, and then hybridized with a
32P-end-labeled
CMV-specific oligonucleotide probe (C3,
ACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCG
[Fig.
1]) at
64°C overnight. Membranes were stringently washed
and then subjected
to autoradiography. All of the primers targeting
the AAV vector as well
as the specific probe were in the CMV region
and at least 30 bp away
from the AAV ITR, which has been reported
to undergo frequent
rearrangement (
19) when integrated into
the host genome.
Nested PCR, cloning, and sequencing.
One microliter of the
above PCR products from CMV
-gal-transduced cells was subjected to
another run of touchdown PCR amplification using a nested CMV primer,
C4 (AACCCAAGCTTGCGGAACTCCATATATGG [Fig. 1]), in
combination with TagA5, both at 10 pmol. Ten microliters of the
amplification product was gel fractionated, transferred to a membrane,
and then hybridized with the C3 probe. The rest of the reaction was
fractionated in a 0.8% agarose gel. To reduce the background of
nonspecific genomic DNA and to enhance the amplification of signals,
the CMV-specific bands were extracted and then subjected to another
round of nested PCR using a pair of internal primers: A5N
(AAAAAGAATTCAGTGTTTGCTGACGCCAA) and C5N
(ACACCAAGCTTATATATGGGCTATGAACT). The addition of the
EcoRI and HindIII sites in A5N and C5N,
respectively, was to facilitate cloning of the PCR fragments into
plasmids. These PCR products were gel fractionated. The most intense
fragment was then extracted and cloned into pGEM11Z (Promega, Madison, Wis.). In other cases, the original Alu-PCR products were
subjected to three rounds of nested PCR, and the end products were then cloned directly into the pCR 2.1 vector according to the
manufacturer's instructions (Original TA Cloning kit; Invitrogen Co.,
Carlsbad, Calif.). Purified plasmid DNA containing the PCR fragment was then subjected to dideoxy-chain termination sequencing.
 |
RESULTS |
Development of Alu-PCR to study AAV integration.
As a first test of whether an Alu-PCR technique was
applicable for investigation of AAV vector-mediated integration in
human cells, we applied this method in human 293 cells, since AAV
vector integration is already well documented by fluorescence in situ hybridization in this cell line (8). rAAV vector-mediated
gene transfer into this cell type is highly efficient. The result of a
typical CMV
-gal transduction into 293 cells is shown in Fig. 2.

View larger version (124K):
[in this window]
[in a new window]
|
FIG. 2.
5-Bromo-4-chloro-3-indolyl- -D-galactopyranoside
(X-Gal) histochemical staining of 293 cells 2 days after transduction
with the CMV -gal vector at an MOI of 15.
|
|
The schematic drawing in Fig.
1 outlines the basic strategy of the
Alu-PCR technique. Chromosomal DNA from transduced cells
was
subjected to two rounds of PCR amplification, with the first
pair of
primers specifically targeting the 5' end of the human
Alu
sequence (
Alu5) and the CMV immediate-early (IE) promoter
(C1) in our CMV

-gal AAV vector. Two unique features were built
into
this pair of primers: (i) they were both made with dUTP instead
of
dTTP, and (ii) a tag sequence was introduced at the 5' end
of the
Alu5 primer (Fig.
1). These primers were then destroyed
by
uracil DNA glycosylase-induced cleavage at the uracil residues
after
the first 10 PCR cycles. The amplified products, encompassing
fragments
between integrated vector sequences and nearby
Alu sites,
were then further amplified by using a second pair of primers
targeting
the tag and a nested CMV sequence (C2 [Fig.
1]). Further
amplification of any initial PCR products formed between two
Alu sequences was limited due to the presence of only one
homologous
primer (TagA5) (Fig.
1, left array). A touchdown protocol
(
6,
24) was applied for the second part of the PCR
amplification
to further enhance sensitivity and specificity by
gradually decreasing
the annealing temperature to minimize products
resulting from
misprimed amplification. Various ratios of
Alu5 to C1, the first
pair of primers, were tested in order
to obtain the optimal conditions
for PCR amplification. Other optimal
cycling conditions, such
as the concentration levels of magnesium and
the annealing temperature
in the first 10 cycles, etc., were also
determined empirically.
All samples having different first primer sets
were then treated
equally for the rest of the procedure.
We further modified the original method of Minami et al.
(
24) by using rTth DNA polymerase-XL (Perkin-Elmer/Applied
Biosystems),
an optimized enzyme containing both polymerase and
proofreading
activities and allowing XL PCR amplification of up to 22 kb from
human genomic DNA. Other modifications included using a lower
concentration of magnesium (1.1 mM) and two-step PCR cycling.
Together,
these changes resulted in dramatically different amplification
efficiencies between our
Alu-PCR and that of Minami et al.
when
using the first pair of primers at a ratio of 10:100 pmol. With
this ratio, we could not detect any visible PCR products on an
ethidium
bromide-stained gel (Fig.
3a). However,
other ratios,
including 10 pmol of
Alu5 primer only and
Alu5 plus C1 at 10:10
or 100:10, all gave some smeared bands
with sizes of up to 3 kb
visible on an ethidium bromide-stained gel
(Fig.
3a). The larger
fragment sizes that we were able to amplify are
close to the average
distance, 4 kb, between copies of
Alu
in the human genome. Specific
signals detected by a
32P-labeled CMV oligonucleotide probe (C3 [Fig.
1]) were
found in
the sample from the CMV

-gal-transduced cells that was
amplified
by using the Alu5-C1 combination at a 10:10 ratio (Fig.
3b,
lane
4). These six specific bands were 2.1, 1.6, 1.2, 1.1, 0.52, and
0.4 kb in size. In contrast, a similar but not identical smeared
pattern of PCR products from the control cells (Fig.
3a, lane
9),
likely due to amplifications of adjacent
Alu sequences
located
in opposite orientations, lacked any detectable specific
hybridization
signals (Fig.
3b, lane 9). Although no PCR products were
visible
in a sample with 100 pmol of the C1 primer alone by ethidium
bromide
staining (Fig.
3a, lanes 3 and 8), a 270-bp band was detected
by the C3 probe (Fig.
3b, lane 3). This specific signal might
be the
result of amplification of head-to-head tandem concatemers
of the rAAV,
which could be present in either integrated or episomal
forms. Based on
the fact that this 270-bp fragment was not found
in the same DNA sample
subjected to
Alu-PCR with both the cellular
(
Alu5) and vector (C1) primers (Fig.
3b, lane 4), we
hypothesize
that the presence of the two primers together may inhibit
amplification
of any vector-vector templates under the conditions used.

View larger version (60K):
[in this window]
[in a new window]
|
FIG. 3.
Alu-PCR analysis on 293 cell samples. (a and
b) Cells were either untreated or transduced with a crude preparation
of CMV -gal. (a) Aliquots of 25 µl of PCR products were loaded in a
1% agarose gel containing ethidium bromide. Lane 1, control sample
without a genomic DNA template; lanes 2 to 6, 100 ng of genomic DNA
isolated 8 days after transduction of the CMV -gal vector into 293 cells; lanes 7 to 11, 100 ng DNA from control 293 cells; lanes 2 and 7, 10 pmol of Alu5 primer alone for the first 10 cycles; lanes
3 and 8, 10 pmol of C1 primer alone; lanes 1, 4, and 9, Alu5-C1 at 10 pmol: 10 pmol; lanes 5 and 10, Alu5-C1 at 100:10; lanes 6 and 11, Alu5-C1 at
10:100. (b) The gel shown in panel a subjected to Southern blot
analysis. PCR-amplified products on a nylon membrane were hybridized
with a 32P-end-labeled specific CMV oligonucleotide probe
(C3). (c and d) Alu-PCR amplification from 100 ng of genomic
DNA isolated 8 days after transduction with CsCl gradient-purified
CMV -gal. (c) Aliquots of 25 µl of PCR products loaded in an
agarose gel. Lane 1, Alu5-C1 at 10 pmol: 10 pmol; lane 2, C1
primer alone. (d) The gel shown in panel c subjected to Southern blot
analysis.
|
|
The
Alu-PCR and Southern hybridization were performed at
least five times on the same DNA sample of 293 cells treated with
the
crude preparation of CMV

-gal. A pattern of C3-detected bands
similar
to that shown in Fig.
3 was consistently and repeatably
detected. One
or two bands were absent in some instances, while
one or two additional
bands were evident in others. These differences
were likely due to
variations in the performance of the
Alu-PCR
amplification.
To minimize the possible effects of contaminating Ad5 or its proteins
on the integration of rAAV, we conducted the same analyses
on a genomic
DNA sample isolated from 293 cells following transduction
with a CsCl
gradient-purified CMV

-gal viral stock at an MOI of
5 (Fig.
3c and
d). Similar to what we observed in the samples
from 293 cells treated
with a crude preparation of the rAAV, multiple
bands (1.2, 0.8, 0.6, and 0.3 kb in size) were detected by the
C3 probe (Fig.
3d, lane 1). No
specific signals were detected
when the same sample was subjected to
Alu-PCR with only the CMV
(vector) primer (Fig.
3d, lane 2).
To further exclude the possibility that nonspecific amplification from
episomal forms of the AAV vector contributed to these
signals, we
performed the same
Alu-PCR analysis on either 0.1
or 1 ng of
the CMV

-gal plasmid, mixed with chromosomal DNA from
control 293 cells (data not shown). The absence of specific hybridization
signals
in these samples confirmed that the
Alu-PCR technique
is
specific in distinguishing integrated chromosomal copies of
the
transgene from episomal plasmids. These findings indicated
that this
Alu-PCR technique was successful in our initial trial
to
identify AAV-mediated integration in 293 cells.
Further evaluation of
Alu-PCR as a significant and reliable
tool for studies of AAV vector-mediated integration was accomplished
by
successful sequencing of vector-cellular junctions. As described
in
Materials and Methods,
Alu-PCR products derived from
CMV

-gal-transduced
293 cells were subjected to several rounds of
touchdown PCR amplification
using nested primers. The discrete bands
were purified by gel
fractionation and inserted into plasmids. Three
clones, containing
PCR fragments ranging from 400 to 1,300 bp in size,
were either
fully or partially sequenced. Detailed data for one
representative
clone containing the 0.4-kb fragment pictured in Fig.
3b, lane
4, are shown in Fig.
4. The 362 nucleotides depicted in Fig.
4 revealed sequences present in the
CMV

-gal vector, as well as
other sequences which were not vector
derived. The vector sequence
included 25 nucleotides from the 5' end of
the CMV IE promoter
and, most importantly, the 5' end of the AAV ITR
covering the
intact D, A', and B' regions. The B, C, C', and A regions
in the
5' end of the ITR (
3,
25) were deleted. The
presumptive cellular
sequences included a 73-nucleotide stretch in the
middle portion
(dash-boxed in Fig.
4a) possessing 64% homology with
the human
sequence from PAC 448E20 on chromosome Xq26.1, based on an
advanced
BLAST search conducted through the National Center for
Biotechnology
Information service. Both vector (including AAV ITR) and
cellular
sequences were present in all three clones, demonstrating that
this
Alu-PCR technique can amplify junction fragments
between
integrated AAV vectors and the flanking chromosomal DNA.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 4.
Sequence of a vector-cellular junction identified by
Alu-PCR from 293 cells transduced with the CMV -gal rAAV
vector. (a) The vector portion of the junction includes the 5' end of
the CMV IE promoter (open box) and some AAV sequences (underlined)
containing a partial AAV ITR. The cellular sequence contains a fragment
with 64% homology to a human DNA sequence on chromosome Xq26.1 (dashed
box), which is flanked by unidentified sequences not present in the
CMV -gal vector (unmarked). The actual sequence in the shaded box is
shown in panel b. The arrows in panels a and b point to the site of the
vector-cellular junction.
|
|
AAV vector integration in nondividing cells in vitro.
The same
Alu-PCR technique that we used successfully to detect AAV
integration in 293 cells was applied next in several types of
nondividing human cells. One of the cell types chosen was human NT
neurons, because our group and others have noted dramatic gene transfer
efficiencies mediated by AAV vectors into neuron populations, both in
vitro and in vivo (7, 21, 28). Other reasons for selecting
this particular cell system for in vitro integration studies included
its human origin, our previous successes using this line
(7), and the fact that it represents a highly pure population of nondividing cells exhibiting typical neuronal features (39). NT neurons at 4 weeks of age were transduced with the packaged CMV
-gal vector at an MOI of 3. One week later, chromosomal DNA was isolated and subjected to Alu-PCR amplification
using the Alu5 and C1 primers. About one-third of the
resulting PCR products were gel fractionated and subjected to
hybridization with the C3 probe labeled with 32P. A smeared
pattern of amplified products was visible in sample lanes from both
untreated and transduced NT neurons (Fig.
5a). However, specific signals detected
by the C3 probe were found only in the sample from the
CMV
-gal-transduced cells (Fig. 5b). Consistent with the results from
our previous study on 293 cells, multiple bands (1.9, 1.4, 1.1, 0.9, 0.6, 0.4, and 0.3 kb) were found in the transduced NT neuronal samples.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
Alu-PCR analysis using an Alu5
primer. (a) Aliquots of 33 µl of Alu-PCR products from 100 ng of genomic DNA were loaded on a 1% agarose gel containing ethidium
bromide. Lane 1, control human NT neurons; lane 2, NT neurons
transduced with CMV -gal for 7 days; lane 3, control human alveolar
macrophages; lane 4, transduced alveolar macrophages. (b) The gel shown
in panel a subjected to Southern blot analysis with a
32P-end-labeled specific CMV oligonucleotide probe (C3).
|
|
As in the case of vector-treated 293 cells, confirmation that fragments
being amplified by the
Alu-PCR technique represented
AAV
vector-mediated integration events in the nondividing human
NT neurons
was obtained by successful sequencing of vector-cellular
junctions.
Following several rounds of nested PCR, the end products
of
amplification were subjected directly to TA cloning. Three
clones,
containing PCR fragments ranging from approximately 200
to 800 bp in
size, were either fully or partially sequenced. Both
vector and
cellular sequences were present in all three clones.
Detailed data for
one representative clone containing the 0.3-kb
fragment pictured in
Fig.
5b, lane 2, are shown in Fig.
6. The
272 nucleotides depicted in Fig.
6 contained both vector-derived
and
non-vector-derived sequences. The vector sequence included
46 nucleotides from the 5' end of the CMV IE promoter and the
5' end of
the AAV ITR covering the intact D, A', and C' regions.
The B, B', C,
and A regions in the 5' end of the ITR (
3,
25)
were deleted.
The presumptive cellular sequences included an 88-nucleotide
stretch
(dash-underlined in Fig.
6a) possessing 98% homology with
a sequence
on human chromosome segment 9q34, based on an advanced
BLAST search. In
addition to the minor deletion of the ITR sequence
in this junction,
substantial vector rearrangement was also evident
in one of the other
clones (data not shown).

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 6.
Sequence of a vector-cellular junction identified by
Alu-PCR from human NT neurons transduced with the CMV -gal
rAAV vector. (a) The vector portion of the junction includes the 5' end
of the CMV IE promoter (open box) and some AAV sequences (underlined)
containing a partial AAV ITR. The cellular sequence includes a fragment
with 98% homology to a human DNA sequence on chromosome 9q34 (dashed
underlined). The actual sequence in the shaded box is shown in panel b.
The arrows in panels a and b point to the site of the vector-cellular
junction.
|
|
A very different type of nondividing human cell was applied at the same
time to this AAV integration study, using the
Alu-PCR
method. Primary human alveolar macrophages were chosen because,
like
neurons, they appear to be highly susceptible to AAV-mediated
transduction (
12). Macrophages were isolated by
bronchoalveolar
lavage and cultured for 1 week before CMV

-gal
exposure. About
1 week after transduction, high-molecular-weight DNA
extracted
from either treated or control cells was subjected to
Alu-PCR
and Southern hybridization. Similar results were
obtained as with
the neuronal cells, with multiple transgene-specific
signals (1.0,
0.6, and 0.3 kb) apparent only in the chromosomal DNA
sample from
cells transduced with the CMV

-gal vector (Fig.
5).
It is noteworthy that the above
Alu-PCR analyses were
performed at least three times and the results were consistent within
the same DNA sample from either the NT neurons or the alveolar
macrophages. No specific signals were detected by the C3 probe
in
either cell type when the PCR was performed with only the vector
primer
(C1) (data not shown).
To further confirm the validity of these findings, an alternative
primer,
Alu3, specifically targeting the 3' end of the human
Alu sequence, was used in place of
Alu5 in the
first 10 cycles
of
Alu-PCR amplification. Specific C3
probe-labeled bands (ranging
from 0.3 to 0.9 kb) were still detected in
CMV

-gal-transduced
NT neurons or alveolar macrophages but not in
either type of control
cell (Fig.
7).
Together, these results confirmed that
Alu-PCR
is a viable
technique for studies of AAV vector-mediated integration
and
demonstrated that
rep
AAV vectors can
integrate into the genomes of at least some types
of nondividing cells.

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 7.
Alu-PCR analysis using an Alu3 primer. (a)
Aliquots of 33 µl of Alu-PCR products from 100 ng of genomic DNA were
loaded on a 1% agarose gel containing ethidium bromide. Lane 1, control human NT neurons; lane 2, NT neurons transduced with CMV -gal
for 7 days; lane 3, control human alveolar macrophages; lane 4, transduced alveolar macrophages. (b) The gel shown in panel a subjected
to Southern blot analysis with a 32P-end-labeled specific
CMV oligonucleotide probe (C3).
|
|
AAV vector integration in rat brain in vivo.
Based on our
success using Alu-PCR to detect integration of an AAV
transgene cassette in nondividing human NT neurons, we applied an
Alu-PCR equivalent, B1-PCR, to brain samples from rats exposed to the same CMV
-gal AAV vector. Two weeks after injection of
5 µl of crude preparation of CMV
-gal viral stock (5 × 105 IU, titered by infectious center assay) into the left
lateral ventricle, genomic DNA from different brain regions was
isolated separately and subjected to CMV-B1-PCR analysis. B1-5 is a
primer covering the 5' region of the B1 consensus sequence
(5), and its 5' end is linked to the same tag sequence used
in the Alu primer (Fig. 1). Both B1-5 and the CMV-specific
primer C1 (Fig. 1) were used at 10 pmol for the first 10 cycles of PCR
amplification. The rest of the procedures, including treatment with
uracil DNA glycosylase, touchdown PCR, gel fractionation, and Southern
blot hybridization with the CMV-specific oligonucleotide probe, were carried out just as performed in the above Alu-PCR studies.
Smeared B1-PCR products were visible in samples from both control and vector-injected rats in all of the sampled brain regions, including the
frontal cerebral cortex, cerebellum, striatum, hypothalamus, and
brainstem (Fig. 8a). However, only the hypothalamic DNA sample from the
CMV
-gal-injected animal had specific signals (0.9, 0.7, and 0.5 kb)
reactive with the CMV probe (Fig. 8b).
The B1-PCR and Southern hybridization were also performed on genomic
DNA samples from rat brain injected with CsCl gradient-purified
CMV

-gal vector. One dominant fragment (0.4 kb) as well as two
faint
bands (0.8 and 0.2 kb) were observed in the hypothalamic
sample (Fig.
8c and d). Similar to the earlier studies
on genomic
DNA samples from NT neurons and alveolar macrophages, no
specific
signals were detected by the C3 probe when the same DNA
samples
were subjected to PCR analysis using only the CMV primer (Fig.
8d).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 8.
B1-PCR analysis of rat brain samples. (a) Aliquots of 30 µl of B1-PCR products from 100 ng of genomic DNA were loaded on a 1%
agarose gel containing ethidium bromide. Lanes 1 to 5, brain samples
from a rat 2 weeks after injection with artificial CSF; lanes 6 to 10, samples from a rat injected with 5 × 105 IU of a
crude preparation of the CMV -gal AAV vector; lanes 1 and 6, cerebral
cortex; lanes 2 and 7, cerebellum; lanes 3 and 8, striatum; lanes 4 and
9, brainstem; lanes 5 and 10, hypothalamus. (b) The gel shown in panel
a subjected to Southern blot analysis with a
32P-end-labeled specific CMV oligonucleotide probe (C3). (c
and d) Alu-PCR amplification from 100 ng of hypothalamic
genomic DNA isolated 2 weeks after injection with the CsCl
gradient-purified CMV -gal. (c) Aliquots of 40 µl of PCR products
were loaded in an agarose gel. Lane 1, B1-5-C1 at 10 pmol: 10 pmol;
lane 2, C1 primer alone. (d) The gel shown in panel c subjected to
Southern blot analysis.
|
|
 |
DISCUSSION |
A PCR strategy targeting Alu sequences has been used
previously to examine cellular sequences flanking integrated hepatitis B virus in human hepatoma cells (24). We have now
successfully adapted an Alu-PCR approach and an equivalent
B1-PCR technique to directly identify AAV vector-mediated integration
in nondividing cells of either human or rat origin. The samples
included a rapidly dividing human cell line, terminally differentiated
nondividing human NT neurons, primary human lung alveolar macrophages,
and rat brain tissues. Findings from the dividing cells were in good agreement with those of other groups (8, 12, 30, 33), including observations using the fluorescence in situ hybridization method to analyze metaphase spreads. The reliability of this
Alu-PCR technique in combination with Southern hybridization
was confirmed by our observations of consistent patterns of specific
signals in repeated amplifications from the same DNA sample. Most
importantly, the successful sequencing of vector-cellular junctions
identified by this new technique will enable further examination of the
integration events of rAAV vectors in primary, nondividing cells or
tissues.
Multiple transgene-specific bands were detected from each type of cells
or tissues exposed to the packaged CMV
-gal vector. It is possible
that two signals represent different amplified products targeting the
same AAV integration locus but flanked by different nearby
Alu sequences. However, the chances that all the specific
bands in a given sample were derived from a single integration site are
very slim. It is unlikely that Alu sequences reside in such
a high frequency in the genome, e.g., seven copies within a 1.8-kb span
in the case of the transduced NT neurons. In support of this view,
although only a small number of amplified junctions were sequenced, no
site duplications were noted. It also cannot be ruled out that some AAV
integration sites are undetectable by this Alu-PCR method.
These would include sites located either too far from an Alu
sequence (26) or near a particular Alu element with a sequence too divergent from the consensus and therefore unable
to anneal efficiently with the Alu primer. Nevertheless, the
detection of relatively small numbers of specific bands suggests that
rep
AAV vector-mediated integration is not
entirely random; otherwise, a greater smearing of specific signals
might be expected in the amplified chromosomal DNA samples from the
mixed cell populations. Alternatively, many integration sites may be
present but accompanied by a significant degree of bias toward a few
select sites. It is possible that the junctions amplified by
Alu-PCR are drawn primarily from these most preferred sites.
It is also noteworthy that neurons and alveolar macrophages represent
cell types known to be highly susceptible to stable AAV-mediated gene
transfer. The detection of integrated transgenes in these lineages
cannot be assumed to be characteristic of every primary cell type
following exposure to rAAV.
It is well known that Rep protein provided in trans is
critical for wtAAV-mediated site-specific integration into human
chromosome 19. Although the rep gene cassette is not encoded
by the rAAV vectors used, there are two possible sources of Rep in the
rAAV stocks. The first one is contamination by wtAAV-like particles in
the rAAV preparation. Using an infectious center assay, we detected
very low levels of wtAAV-like particles, 2 IU rather than the
105 IU of rAAV, in our crude preparations of rAAV. This
contamination was not introduced from the helper Ad5 viral stocks,
since no positive signals were detected in assays using a
rep-specific DNA probe in a cell sample treated with Ad5
alone (41a). Kube et al. (17) reported similar
findings for studies using CsCl gradient-purified rAAV stocks and
hypothesized that "wild-type AAV-like particles can be generated by
recombination events involving the recombinant AAV plasmid and the AAV
helper plasmid, pAAV/Ad, during production of recombinant AAV." A
second potential source of Rep could be Rep proteins attached to rAAV
virions. Recently, two groups have reported that functional Rep
proteins are tightly associated with and even encapsidated within wtAAV
and rAAV virions (17, 31, 32). The role of these associated
proteins in rAAV-mediated nonspecific integration remains to be
defined. However, our results from sequencing several amplified vector
junctions support the view that the strong affinity of wtAAV for a
small region of human chromosome 19 is not mimicked by the rAAV vectors
used here.
One of the main issues to be addressed in our present in vivo study was
whether this type of human viral vector could mediate transgene
integration in a rodent species. In other studies using the CMV
-gal
vector, we have noted little or no transgene expression in brain
regions following intraventricular injection of the vector. However,
using an otherwise isogenic AAV vector, AVP
-gal, in which the
transgene is driven by a native neurohormone promoter, we have detected
significant amounts of gene expression, principally in the
hypothalamus, although with weaker staining in a few other brain
regions (41). Recent studies by other groups (21,
28) have demonstrated stable AAV transduction for at least 3 months in the rat or mouse central nervous system (CNS) in vivo, yet little is known about the mechanism(s) underlying the stability of AAV
vectors in neuronal tissues. AAV-mediated integration is one
possibility. Another key issue was whether this Alu-PCR
methodology would be sufficiently sensitive to detect integrated AAV
transgenes in brain cells. This is a critical question, especially for
the brain, into which only small amounts of vector may be injected. Restricted diffusion of AAV vectors in brain tissue may also limit the
numbers of cells in any given brain region harboring an AAV vector.
We therefore developed B1-PCR, an Alu-PCR equivalent, to
examine AAV vector integration in the rat brain. By using the
CMV
-gal vector, we were able to take advantage of the same basic
methodology that we had established and optimized for human cells. Two
weeks after injection of the packaged CMV
-gal into the lateral
ventricle, transgene-specific signals were detected in the
high-molecular-weight DNA sample from the hypothalamus but not from
other regions including the frontal cerebral cortex, cerebellum,
striatum, and brainstem. This result was not surprising since
intraventricularly injected AAV vectors can easily reach the
hypothalamus, due to the close proximity of this structure to the
ventricular system; thus, a considerable amount of virus was likely
delivered into hypothalamic tissue compared to the other sampled
regions. This finding was consistent with the pattern of vector
expression detected in our earlier histochemical study using the
AVP
-gal vector. The results also support a previous report by McCown
et al. (21), suggesting that low levels of expression from
an AAV-delivered transgene in the brain were due to inactivation of the
CMV IE promoter rather than to the absence of the gene cassette. Most
importantly, our B1-PCR data indicate for the first time that a human
AAV-derived vector can integrate into the genomes of brain cells in a
rodent species and confirm the ability of the B1-PCR technique to
detect limited integration signals in vivo.
Several features of Alu-PCR analysis would appear to render
it more attractive for the study of AAV vector integration in nondividing cells than other methodologies such as Southern blot analysis (10, 42) or PCR amplification of AAV head-to-tail junctions (9). Alu-PCR directly targets the
vector-cellular junction sequences, which is not possible with
alternative methods, and therefore avoids the attendant problems in
interpretation resulting from episomal contamination. In addition, the
combination of nested PCR and sequencing provides a relatively simple
way to further examine the integration sites of AAV vectors in vivo and
to elucidate possible sequence rearrangements near the junction site in
both cellular and vector regions. By targeting a transgene possessing
an endogenous counterpart present at a low copy number, it should also
be possible to determine the actual AAV integration frequency by using
quantitative Alu-PCR to compare intensities between
endogenous and exogenous signals.
As the only known mammalian virus which can integrate into the human
genome at a specific site (18), AAV possesses uniquely attractive features for certain applications of gene therapy. The
demonstration of vector integration in treated brain and neuronal cell
samples provides strong encouragement for further development of the
AAV system for application in the CNS. Further characterization of this
event in rats should be beneficial to the broad usage of the rodent as
an animal model for investigating AAV-mediated gene delivery into the
CNS. The Alu-PCR method described here will be a useful tool
for further dissecting the mechanisms underlying this integration and
may provide insights into designing strategies for the next generation
of AAV vectors for human gene therapy.
 |
ACKNOWLEDGMENTS |
We thank Henry Koziel (Division of Pulmonary Medicine, Beth
Israel Deaconess Medical Center) for providing human lung alveolar macrophages and Jerome E. Groopman, Yongjia Yu, and In-Woo Park for
helpful discussions. We also thank Xianglin Ren for technical assistance and Janet Delahanty for editing the manuscript, as well as
Evelyn Gould and Nancy DesRosiers for assistance in preparing the
figures.
This work was supported by NIH grants P01 HL43510-06 and RO1 HL44846
and by an award to E.F.T. from the Concerned Parents for AIDS Research.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Harvard
Institutes of Medicine, 3rd Floor, 4 Blackfan Circle, Boston, MA 02115. Phone: (617) 667-0067. Fax: (617) 975-5243. E-mail:
eterwiligr{at}aol.com.
 |
REFERENCES |
| 1.
|
Balagué, C.,
M. Kalla, and W.-W. Zhang.
1997.
Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome.
J. Virol.
71:3299-3306[Abstract].
|
| 2.
|
Berns, K. I.
1990.
Parvovirus replication.
Microbiol. Rev.
54:316-329[Abstract/Free Full Text].
|
| 3.
|
Berns, K. I., and R. M. Linden.
1995.
The cryptic life style of adeno-associated virus.
Bioessays
17:237-245[Medline].
|
| 4.
|
Chiorini, J. A.,
S. M. Wiener,
R. A. Owens,
S. R. M. Kyöstiö,
R. M. Kotin, and B. Safer.
1994.
Sequence requirements for stable binding and function of Rep68 on the adeno-associated virus type 2 inverted terminal repeats.
J. Virol.
68:7448-7457[Abstract/Free Full Text].
|
| 5.
|
den Dunnen, J. T., and J. G. Schoenmakers.
1987.
Consensus sequences of the Rattus norvegicus B1 and B2 repeats.
Nucleic Acids Res.
15:2772[Free Full Text].
|
| 6.
|
Don, R. H.,
P. T. Cox,
B. J. Wainwright,
K. Baker, and J. S. Mattick.
1991.
"Touchdown" PCR to circumvent spurious priming during gene amplification.
Nucleic Acids Res.
19:4008[Free Full Text].
|
| 7.
|
Du, B.,
P. Wu,
D. M. Boldt-Houle, and E. F. Terwilliger.
1996.
Efficient transduction of human neurons with an adeno-associated virus vector.
Gene Ther.
3:254-261[Medline].
|
| 8.
|
Duan, D.,
K. J. Fisher,
J. F. Burda, and J. F. Engelhardt.
1997.
Structural and functional heterogeneity of integrated recombinant AAV genomes.
Virus Res.
48:41-56[Medline].
|
| 9.
|
Fisher, K. J.,
K. Jooss,
J. Alston,
Y. Yang,
S. E. Haecker,
K. High,
R. Pathak,
S. E. Raper, and J. M. Wilson.
1997.
Recombinant adeno-associated virus for muscle directed gene therapy.
Nat. Med.
3:306-312[Medline].
|
| 10.
|
Fisher-Adams, G.,
K. K. Wong, Jr.,
G. Podsakoff,
S. J. Forman, and S. Chatterjee.
1996.
Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.
Blood
88:492-504[Abstract/Free Full Text].
|
| 11.
|
Flotte, T. R., and B. J. Carter.
1995.
Adeno-associated virus vectors for gene therapy.
Gene Ther.
2:357-362[Medline].
|
| 12.
|
Inouye, R. T.,
B. Du,
D. Boldt-Houle,
A. Ferrante,
I.-W. Park,
S. M. Hammer,
L. Duan,
J. E. Groopman,
R. J. Pomerantz, and E. F. Terwilliger.
1997.
Potent inhibition of human immunodeficiency virus type 1 in primary T cells and alveolar macrophages by a combination anti-Rev strategy delivered in an adeno-associated virus vector.
J. Virol.
71:4071-4078[Abstract].
|
| 13.
|
Kaplitt, M. G.,
X. Xiao,
R. J. Samulski,
J. Li,
K. Ojamaa,
I. L. Klein,
H. Makimura,
M. J. Kaplitt,
R. K. Strumpf, and E. B. Diethrich.
1996.
Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector.
Ann. Thorac. Surg.
62:1669-1676[Abstract/Free Full Text].
|
| 14.
|
Kearns, W. G.
1996.
Recombinant adeno-associated virus (AAV-CFTR) vectors do not integrate in a site-specific fashion in an immortalized epithelial cell line.
Gene Ther.
3:748-755[Medline].
|
| 15.
|
Kessler, P. D.,
G. M. Podsakoff,
X. Chen,
S. A. McQuiston,
P. C. Colosi,
L. A. Matelis,
G. J. Kurtzman, and B. J. Byrne.
1996.
Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein.
Proc. Natl. Acad. Sci. USA
93:14082-14087[Abstract/Free Full Text].
|
| 16.
|
Kotin, R. M.,
R. M. Linden, and K. I. Berns.
1992.
Characterization of a preferred site on human chromosome 19q for integration of adeno-associated virus DNA by non-homologous recombination.
EMBO J.
11:5071-5078[Medline].
|
| 17.
|
Kube, D. M.,
S. Ponnazhagan, and A. Srivastava.
1997.
Encapsidation of adeno-associated virus type 2 Rep proteins in wild-type and recombinant progeny virions: Rep-mediated growth inhibition of primary human cells.
J. Virol.
71:7361-7371[Abstract].
|
| 18.
|
Linden, R. M., and K. I. Berns.
1997.
Site-specific integration by adeno-associated virus: a basis for a potential gene therapy vector.
Gene Ther.
4:4-5[Medline].
|
| 19.
|
Linden, R. M.,
P. Ward,
C. Giraud,
E. Winocour, and K. I. Berns.
1996.
Site-specific integration by adeno-associated virus.
Proc. Natl. Acad. Sci. USA
93:11288-11294[Abstract/Free Full Text].
|
| 20.
|
McCarty, D. M.,
J. H. Ryan,
S. Zolotukhin,
X. Zhou, and N. Muzyczka.
1994.
Interaction of the adeno-associated virus Rep protein with a sequence within the A palindrome of the viral terminal repeat.
J. Virol.
68:4998-5006[Abstract/Free Full Text].
|
| 21.
|
McCown, T. J.,
X. Xiao,
J. Li,
G. R. Breese, and R. J. Samulski.
1996.
Differential and persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector.
Brain Res.
713:99-107[Medline].
|
| 22.
|
McKeon, C., and R. J. Samulski.
1996.
NIDDK workshop on AAV vectors: gene transfer into quiescent cells.
Hum. Gene Ther.
7:1615-1619[Medline].
|
| 23.
|
McLaughlin, S. K.,
P. Collis,
P. L. Hermonat, and N. Muzyczka.
1988.
Adeno-associated virus general transduction vectors: analysis of proviral structures.
J. Virol.
62:1963-1973[Abstract/Free Full Text].
|
| 24.
|
Minami, M.,
K. Poussin,
C. Brechot, and P. Paterlini.
1995.
A novel PCR technique using Alu-specific primers to identify unknown flanking sequences from the human genome.
Genomics
29:403-408[Medline].
|
| 25.
|
Muzyczka, N.
1992.
Use of adeno-associated virus as a general transduction vector for mammalian cells.
Curr. Top. Microbiol. Immunol.
158:97-131[Medline].
|
| 26.
|
Nelson, D. L.,
S. A. Ledbetter,
L. Corbo,
M. F. Victoria,
R. Ramirez-Solis,
T. D. Webster,
D. H. Ledbetter, and C. T. Caskey.
1989.
Alu polymerase chain reaction: a method for rapid isolation of human-specific sequences from complex DNA sources.
Proc. Natl. Acad. Sci. USA
86:6686-6690[Abstract/Free Full Text].
|
| 27.
|
Owens, R. A.,
M. D. Weitzman,
S. R. M. Kyöstiö, and B. Carter.
1993.
Identification of a DNA-binding domain in the amino terminus of adeno-associated virus Rep proteins.
J. Virol.
67:997-1005[Abstract/Free Full Text].
|
| 28.
|
Peel, A. L.,
X. Zolotukhin,
G. W. Schrimsher,
N. Muzyczka, and P. J. Reier.
1997.
Efficient transduction of green fluorescent protein in spinal cord neurons using adeno-associated virus vectors containing cell-type specific promoter.
Gene Ther.
4:16-24[Medline].
|
| 29.
|
Phillips, M. I.,
D. Mohuczy-Dominiak,
M. Coffey,
S. M. Galli,
B. Kimura,
P. Wu, and T. Zelles.
1997.
Prolonged reduction of high blood pressure with an in vivo, nonpathogenic, adeno-associated viral vector delivery of AT1-R mRNA antisense.
Hypertension
29:374-380[Abstract/Free Full Text].
|
| 30.
|
Ponnazhagan, S.,
D. Erikson,
W. G. Kearns,
S. Z. Zhou,
P. Nahreini,
X.-S. Wang, and A. Srivastava.
1997.
Lack of site-specific integration of the recombinant adeno-associated virus 2 genomes in human cells.
Hum. Gene Ther.
8:275-284[Medline].
|
| 31.
|
Prasad, K. M., and J. P. Trempe.
1995.
The adeno-associated virus Rep78 protein is covalently linked to viral DNA in a preformed virion.
Virology
214:360-370[Medline].
|
| 32.
|
Prasad, K. M.,
C. Zhou, and J. P. Trempe.
1995.
The adeno-associated virus Rep78 protein is covalently linked to viral DNA in a preformed virion.
Virology
214:360-370.
|
| 33.
|
Rutledge, E. A., and D. W. Russell.
1997.
Adeno-associated virus vector integration junctions.
J. Virol.
71:8429-8436[Abstract].
|
| 34.
|
Samulski, R. J.,
X. Zhu,
X. Xiao,
J. D. Brook,
D. E. Housman,
N. Epstein, and L. A. Hunter.
1991.
Targeted integration of adeno-associated virus (AAV) into human chromosome 19.
EMBO J.
10:3941-3950[Medline].
|
| 35.
|
Shelling, A. N., and M. G. Smith.
1994.
Targeted integration of transfected and infected adeno-associated virus vectors containing the neomycin resistance gene.
Gene Ther.
1:165-169[Medline].
|
| 36.
|
Singer, M. F.
1982.
Highly repeated sequences in mammalian genomes.
Int. Rev. Cytol.
76:67-112[Medline].
|
| 37.
|
Weiner, A. M.,
P. L. Deininger, and A. Efstratiadis.
1986.
Nonviral retroposons: genes, pseudogenes, and transposable elements generated by the reverse flow of genetic information.
Annu. Rev. Biochem.
55:631-661[Medline].
|
| 38.
|
Weitzman, M. D.,
S. R. M. Kyöstiö,
R. M. Kotin, and R. A. Owens.
1994.
Adeno-associated virus (AAV) rep proteins mediate complex formation between AAV DNA and its integration site in human DNA.
Proc. Natl. Acad. Sci. USA
91:5808-5812[Abstract/Free Full Text].
|
| 39.
|
Wu, P.,
P. Price,
B. Du,
W. C. Hatch, and E. F. Terwilliger.
1996.
Direct cytotoxicity of HIV-1 envelope protein gp120 on human NT neurons.
NeuroReport
7:1045-1049[Medline].
|
| 40.
|
Wu, P.,
D. Ziska,
M. Bonnell,
E. Grouzmann,
W. J. Millard, and E. M. Meyer.
1994.
Differential neuropeptide Y gene expression in post-mitotic versus dividing neuroblastoma cells driven by an adeno-associated virus vector.
Mol. Brain Res.
24:27-33.
[Medline] |
| 41.
|
Wu, P.,
B. Du,
M. I. Phillips, and E. F. Terwilliger.
1997.
In
Efficient and long-term gene delivery into rat brain using adeno-associated viral vectors, abstr. 1450. In Abstracts of the 27th Annual Meeting of the Society for Neuroscience 1997.
Society for Neuroscience, New Orleans, La.
|
| 41a.
| Wu, P., et al. Unpublished data.
|
| 42.
|
Xiao, X.,
J. Li, and R. J. Samulski.
1996.
Efficient long-term gene transfer into muscle tissue of immunocompetent mice by adeno-associated virus vector.
J. Virol.
70:8098-8108[Abstract].
|
J Virol, July 1998, p. 5919-5926, Vol. 72, No. 7
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Wang, Y., Sun, Z.
(2009). Klotho Gene Delivery Prevents the Progression of Spontaneous Hypertension and Renal Damage. Hypertension
54: 810-817
[Abstract]
[Full Text]
-
Kines, K. J., Morales, M. E., Mann, V. H., Gobert, G. N., Brindley, P. J.
(2008). Integration of reporter transgenes into Schistosoma mansoni chromosomes mediated by pseudotyped murine leukemia virus. FASEB J.
22: 2936-2948
[Abstract]
[Full Text]
-
Morales, M. E., Mann, V. H., Kines, K. J., Gobert, G. N., Fraser, M. J. Jr, Kalinna, B. H., Correnti, J. M., Pearce, E. J., Brindley, P. J.
(2007). piggyBac transposon mediated transgenesis of the human blood fluke, Schistosoma mansoni. FASEB J.
21: 3479-3489
[Abstract]
[Full Text]
-
Chattopadhyay, N., Jeong, K.-H., Yano, S., Huang, S., Pang, J. L., Ren, X., Terwilliger, E., Kaiser, U. B., Vassilev, P. M., Pollak, M. R., Brown, E. M.
(2007). Calcium receptor stimulates chemotaxis and secretion of MCP-1 in GnRH neurons in vitro: potential impact on reduced GnRH neuron population in CaR-null mice. Am. J. Physiol. Endocrinol. Metab.
292: E523-E532
[Abstract]
[Full Text]
-
Tfelt-Hansen, J., Hansen, J. L., Smajilovic, S., Terwilliger, E. F., Haunso, S., Sheikh, S. P.
(2006). Calcium receptor is functionally expressed in rat neonatal ventricular cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol.
290: H1165-H1171
[Abstract]
[Full Text]
-
Turkseven, S., Kruger, A., Mingone, C. J., Kaminski, P., Inaba, M., Rodella, L. F., Ikehara, S., Wolin, M. S., Abraham, N. G.
(2005). Antioxidant mechanism of heme oxygenase-1 involves an increase in superoxide dismutase and catalase in experimental diabetes. Am. J. Physiol. Heart Circ. Physiol.
289: H701-H707
[Abstract]
[Full Text]
-
Kruger, A. L., Peterson, S., Turkseven, S., Kaminski, P. M., Zhang, F. F., Quan, S., Wolin, M. S., Abraham, N. G.
(2005). D-4F Induces Heme Oxygenase-1 and Extracellular Superoxide Dismutase, Decreases Endothelial Cell Sloughing, and Improves Vascular Reactivity in Rat Model of Diabetes. Circulation
111: 3126-3134
[Abstract]
[Full Text]
-
Tfelt-Hansen, J., Ferreira, A., Yano, S., Kanuparthi, D., Romero, J. R., Brown, E. M., Chattopadhyay, N.
(2005). Calcium-sensing receptor activation induces nitric oxide production in H-500 Leydig cancer cells. Am. J. Physiol. Endocrinol. Metab.
288: E1206-E1213
[Abstract]
[Full Text]
-
Madry, H., Cucchiarini, M., Kaul, G., Kohn, D., Terwilliger, E. F., Trippel, S. B.
(2004). Menisci Are Efficiently Transduced by Recombinant Adeno-Associated Virus Vectors In Vitro and In Vivo. Am J Sports Med
32: 1860-1865
[Abstract]
[Full Text]
-
Tfelt-Hansen, J., Schwarz, P., Terwilliger, E. F., Brown, E. M., Chattopadhyay, N.
(2003). Calcium-Sensing Receptor Induces Messenger Ribonucleic Acid of Human Securin, Pituitary Tumor Transforming Gene, in Rat Testicular Cancer. Endocrinology
144: 5188-5193
[Abstract]
[Full Text]
-
Surendran, S., Matalon, K. M., Tyring, S. K., Matalon, R.
(2003). Molecular Basis of Canavan's Disease: From Human to Mouse. J Child Neurol
18: 604-610
[Abstract]
-
Tfelt-Hansen, J., MacLeod, R. J., Chattopadhyay, N., Yano, S., Quinn, S., Ren, X., Terwilliger, E. F., Schwarz, P., Brown, E. M.
(2003). Calcium-sensing receptor stimulates PTHrP release by pathways dependent on PKC, p38 MAPK, JNK, and ERK1/2 in H-500 cells. Am. J. Physiol. Endocrinol. Metab.
285: E329-E337
[Abstract]
[Full Text]
-
Surace, E. M., Auricchio, A., Reich, S. J., Rex, T., Glover, E., Pineles, S., Tang, W., O'Connor, E., Lyubarsky, A., Savchenko, A., Pugh, E. N. Jr., Maguire, A. M., Wilson, J. M., Bennett, J.
(2003). Delivery of Adeno-Associated Virus Vectors to the Fetal Retina: Impact of Viral Capsid Proteins on Retinal Neuronal Progenitor Transduction. J. Virol.
77: 7957-7963
[Abstract]
[Full Text]
-
Schnepp, B. C., Clark, K. R., Klemanski, D. L., Pacak, C. A., Johnson, P. R.
(2003). Genetic Fate of Recombinant Adeno-Associated Virus Vector Genomes in Muscle. J. Virol.
77: 3495-3504
[Abstract]
[Full Text]
-
Passini, M. A., Wolfe, J. H.
(2001). Widespread Gene Delivery and Structure-Specific Patterns of Expression in the Brain after Intraventricular Injections of Neonatal Mice with an Adeno-Associated Virus Vector. J. Virol.
75: 12382-12392
[Abstract]
[Full Text]
-
Pitkow, L. J., Sharer, C. A., Ren, X., Insel, T. R., Terwilliger, E. F., Young, L. J.
(2001). Facilitation of Affiliation and Pair-Bond Formation by Vasopressin Receptor Gene Transfer into the Ventral Forebrain of a Monogamous Vole. J. Neurosci.
21: 7392-7396
[Abstract]
[Full Text]
-
Phillips, M. I.
(2001). Gene Therapy for Hypertension: The Preclinical Data. Hypertension
38: 543-548
[Abstract]
[Full Text]
-
Malik, A. K., Monahan, P. E., Allen, D. L., Chen, B.-G., Samulski, R. J., Kurachi, K.
(2000). Kinetics of Recombinant Adeno-Associated Virus-Mediated Gene Transfer. J. Virol.
74: 3555-3565
[Abstract]
[Full Text]
-
Xiao, X., Li, J., Tsao, Y.-P., Dressman, D., Hoffman, E. P., Watchko, J. F.
(2000). Full Functional Rescue of a Complete Muscle (TA) in Dystrophic Hamsters by Adeno-Associated Virus Vector-Directed Gene Therapy. J. Virol.
74: 1436-1442
[Abstract]
[Full Text]
-
Yang, J., Zhou, W., Zhang, Y., Zidon, T., Ritchie, T., Engelhardt, J. F.
(1999). Concatamerization of Adeno-Associated Virus Circular Genomes Occurs through Intermolecular Recombination. J. Virol.
73: 9468-9477
[Abstract]
[Full Text]
-
Nakai, H., Iwaki, Y., Kay, M. A., Couto, L. B.
(1999). Isolation of Recombinant Adeno-Associated Virus Vector-Cellular DNA Junctions from Mouse Liver. J. Virol.
73: 5438-5447
[Abstract]
[Full Text]
-
Phillips, M. I.
(1999). Is Gene Therapy for Hypertension Possible?. Hypertension
33: 8-13
[Full Text]
-
Mohuczy, D., Gelband, C. H., Phillips, M. I.
(1999). Antisense Inhibition of AT1 Receptor in Vascular Smooth Muscle Cells Using Adeno-Associated Virus-Based Vector. Hypertension
33: 354-359
[Abstract]
[Full Text]