Previous Article | Next Article ![]()
J Virol, July 1998, p. 5599-5609, Vol. 72, No. 7
Virology Division/Retrovirology Laboratory,
University of Washington School of Medicine, Seattle, Washington
981441;
Arthropod-Borne Animal Disease
Research Laboratory, Agricultural Research Service, U.S.
Department of Agriculture, Laramie, Wyoming
820712; and
Department of Microbiology,
College of Veterinary Medicine and Biomedical Sciences, Colorado
State University, Fort Collins, Colorado 805233
Received 28 January 1998/Accepted 31 March 1998
We investigated the effects of pharmacological and
lentivirus-induced immunosuppression on bluetongue virus (BTV)
pathogenesis as a mechanism for virus persistence and induction of
clinical disease. Immunologically normal and immunosuppressed sheep
were infected subcutaneously with BTV serotype 3 (BTV-3), a foreign isolate with unknown pathogenicity in North American livestock, and
with North American serotype 11 (BTV-11). Erythrocyte-associated BTV
RNA was detected earlier and at greater concentrations in sheep treated
with immunosuppressive drugs. Similarly, viral RNA and infectious virus
were detected in blood monocytes earlier and at higher frequency in
immunosuppressed animals: as many as 1 in 970 monocytes revealed BTV
RNA at peak viremia, compared to <1 in 105 monocytes from
immunocompetent sheep. Animals infected with BTV-3 had a higher virus
burden in monocytes and lesions of greater severity than those infected
with BTV-11. BTV RNA was detected by in situ hybridization in vascular
endothelial cells and cells of monocyte lineage, but only in tissues
from immunocompromised animals, and was most abundant in animals
infected with BTV-3. In contrast, reverse transcription-in situ PCR
showed BTV RNA from both viral serotypes in high numbers of tissue
leukocytes and vascular endothelial cells from both immunosuppressed
and, to a lesser extent, immunocompetent animals. Collectively, these findings show that BTV infection is widely distributed during acute
infection but replication is highly restricted in animals with normal
immunity. These findings also suggest that in addition to virulence
factors that define viral serotypes, immunosuppression could play a
role in the natural history of orbivirus infection, allowing for higher
virus burden, increased virus persistence, and greater potential for
acquisition of virus by the arthropod vector.
Bluetongue virus (BTV) is the
causative agent of bluetongue, a noncontagious, often sporadic disease
of domestic and wild ruminants (3). BTV represents 1 of 13 serogroups in the genus Orbivirus, family
Reoviridae. All members of this genus replicate in the
cytoplasm of infected cells (12) and have a double-layered protein capsid consisting of seven polypeptides, each of which is
encoded by one of 10 double-stranded RNA viral segments
(12). In temperate climates, outbreaks of BTV occur
seasonally in association with the arthropod vector of the
Culicoides species (51). The outcome of infection
varies between animals, ranging from subclinical or mild disease to
acute and fatal disease. Acute disease, as seen in sheep and some wild
ruminants, is characterized by inflammation, hemorrhage, and/or
necrosis of mucosal surfaces in the oronasal and alimentary systems
(6). Animals that survive acute infection may develop
chronic dermatitis and vesicular and erosive lesions at interdigital
and mucosal surfaces.
Prolonged viremia occurs in many BTV-infected animals and persists
despite a rapid and specific humoral (35, 48) and cellular (30) immune response. Although BTV is ultimately eliminated, mechanisms allowing for prolonged infection are poorly understood. Unlike most single-stranded RNA viruses, orbiviruses are genetically and antigenically stable throughout infection (14, 18, 19, 29). Genetic recombination can occur via BTV gene segment
reassortment; however, point mutations (viral escape mutants) do not
arise in vivo, at least at the high frequency noted with many
nonsegmented single-stranded RNA viruses. Still, there is strong
evidence for pathogenetic differences in BTV isolates (45);
however, it is not clear if these differences result from variations in
the virus or if host factors that determine susceptibility to infection ultimately determine the outcome of infection.
BTV binds the surface of erythrocytes, and cell-associated viral RNA
can be detected for several months following infection, usually long
after infectious virus has been eliminated (36). Virus and
viral antigens are internalized within erythrocyte vesicles and
concealed from the immune response. This likely contributes to virus
persistence but does not explain the wide variation in the host
response to infection. Recently, massive covert infection with
epizootic hemorrhagic disease virus, an orbivirus and close relative of BTV, was shown to precede virus-specific immunity and to
facilitate rapid disease progression (11). Animals with a
high viral burden that did not succumb to infection had weakened immune
responses and ultimately developed severe diseases. Deficiencies in BTV
immunity could explain the differential pathogenesis of BTV, including
why prolonged viremia is observed in some animals and not others.
Impairment of the immune system by drugs (33, 40),
environmental contaminants (20, 33), or UV radiation
(27) or by pathogens such as human immunodeficiency virus
(43) and measles virus (50, 52) are just a few
examples of conditions that are known to contribute to the severity of
the disease state. In this study, we investigated the effects of
pharmacological and retrovirus-induced immunosuppression in sheep as a
mechanism of orbivirus persistence and disease induction. We
demonstrated massive covert infection of vascular endothelium and cells
of monocyte lineage and propose that widespread dissemination of virus
during early stages of infection is augmented by immunosuppression and
provides another mechanism for virus persistence and acute disease.
Experimental design.
Age (4.1 ± 0.2 years)- and breed
(Rambouillet)-matched BTV-seronegative ewes were segregated into three
groups (Table 1) and housed separately in
barrier-maintained biocontainment level 3 facilities for 2 weeks prior
to treatment and/or infection. Animals in group 1 (n = 8) were healthy and had immune responses, as described below, within
normal ranges. These animals received immunosuppressive doses of
dexamethasone (40 mg intramuscullarly; Phoenix, St. Joseph, Mo.),
azothioprine (Immuran; 200 mg orally; Glaxo Wellcome, Research Triangle
Park, N.C.), and cyclophosphamide (Cytoxan; 50 mg/m2
orally; Bristol-Meyers Squibb, Princeton, N.J.) for 8 weeks prior to
experimental BTV infection. Drug dosages for dexamethasone and
cyclophosphamide were estimated based on veterinary formulary indexes
for sheep and/or cattle. The dose of azothioprine was derived from that
used for humans and adjusted for body surface area. It is important to
note that these categories of drugs are not commonly used in food
animals, and rumen metabolism may affect their absorption. During this
time, animals were monitored for clinical and laboratory indicators of
drug-related toxicities that could be confused with BTV-mediated
disease, including erythrocyte and platelet counts. Animals in group 2 (n = 8) were seropositive for ovine lentivirus (OvLV),
and all showed classic signs of chronic lentivirus infection, including
severe emaciation and interstitial pneumonia (7, 9, 10).
Animals in group 3 (n = 8) were clinically normal and
seronegative for OvLV, and they were not treated prior to experimental
BTV infection. Half of the animals in each group were infected by
subcutaneous inoculation with BTV (105 50% tissue culture
infective doses [TCID50]) serotype 3 (BTV-3), a Central
American isolate with unknown pathogenicity in North American
livestock. The remaining animals were inoculated with BTV serotype 11 (BTV-11), a serotype common to North America and an isolate obtained
during an outbreak in Colorado (44, 46).
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Effects of Pharmacological and
Lentivirus-Induced Immune Suppression on Orbivirus Pathogenesis:
Assessment of Virus Burden in Blood Monocytes and Tissues by Reverse
Transcription-In Situ PCR
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
TABLE 1.
Experimental groups
Clinical samples.
Tissue biopsy samples, including oral
mucocutaneous skin (obtained by punch biopsy), bone marrow from the
iliac crest (obtained by needle aspiration), prescapular lymph node
(obtained by tru-cut biopsy), and peripheral blood were collected at
2-day intervals for the first 2 weeks following infection and every 4 days thereafter until death. All procedures were performed under
sedation and local anesthesia. Tissues were also collected at the time
of death and included peripheral blood, skin (coronary band and oral
mucocutaneous juncture), skeletal muscle (tongue), right frontal
cerebral cortex, midbrain, spinal cord (second cervical vertebra),
right caudal lung lobe (including pulmonary artery), trachea, tonsil,
heart, spleen, kidney, liver, urinary bladder, lymph nodes
(submandibular, mediastinal, prescapular, supramammary, and
mesenteric), rumen, abomasum, and small and large bowel. Citrated blood
samples were obtained from all animals prior to inoculation and
following infection, and plasma was separated from cells by
centrifugation and stored frozen at
70°C. Mononuclear leukocytes,
which included purified monocytes (discussed below), and erythrocytes
were added to an equal volume of buffered lactose peptone (50 mM
Na2PO4, 10 mM NaH2PO4,
0.2% peptone, 10% lactose) and stored at 4°C for preservation of
virus infectivity. Tissues were fixed for 48 h in 4% deionized paraformaldehyde. Paraffin-embedded sections were examined for viral
RNA by in situ hybridization and RT-in situ PCR. Tissues were also
snap-frozen in OCT (optical cutting temperature) compound (Miles Inc.,
Elkhart, Ind.) for detection of viral antigens by immunohistochemistry.
Measurements of immunosuppression. A variety of tests were used collectively to assess lentivirus- and drug-induced immunosuppression, including (i) complete blood cell counts, (ii) plasma immunoglobulin G (IgG) and IgM concentrations, (iii) peripheral blood lymphocyte (PBL) proliferative response to phytohemagglutinin (PHA-P; Sigma Chemical, St. Louis, Mo.), (iv) PBL CD4/CD8 ratios, and (v) quantitative expression of interleukin-2 receptor (IL-2R) (CD25) and major histocompatibility class II (MHC-II) DR, DQ antigens in PHA-stimulated PBL. Immunological and hematological tests were performed in all animals (groups 1 to 3) prior to BTV infection (Table 1) and at 8 weeks following drug treatment (group 1). Plasma immunoglobulin concentrations were determined by radial immunodiffusion using commercial kits (Bethyl Laboratories, Montgomery, Tex.). Peripheral blood mononuclear cells were separated on Histopaque (specific gravity, 1.077; Sigma), and adherent cells were depleted by adhesion to fibronectin-coated (20 µg/ml; Gibco, Grand Island, N.Y.) plastic surfaces (8). Greater than 94% of nonadherent cells were shown to be PBL based on reactivity with monoclonal antibodies (MAbs) to T cells (clone SBU-T1; University of Melbourne, Victoria, Australia) and B cells (clone B-B2; Veterinary Medical Research and Development [VMRD], Pullman, Wash.). Conversely, adherent cells were >96% CD14 positive (clone M; VMRD) and were designated monocytes. PBL (106/ml) were stimulated with PHA (5 µg/ml) for 24 and 48 h, and IL-2R (clone A5/IL-2R; VMRD) and MHC-II (clone 28.1; VMRD) expression was determined by flow cytometry (EPICS V; Coulter Corp., Hialeah, Fla.). The peripheral blood CD4/CD8 ratio was determined similarly, using MAbs to the ovine CD4 (SBU-T4 clones 44.38 and 44.97; University of Melbourne) and CD8 (SBU-T8 clone 38.65; University of Melbourne) human homologs. Lastly, lymphocyte proliferation in response to PHA stimulation was assessed by [5'-3H]thymidine (3HT; Amersham Corp., Arlington Heights, Ill.) incorporation and as described previously (25). Briefly, 2 × 106 PHA-stimulated (24 and 48 h of stimulation) and unstimulated PBL were incubated with 1 µCi of 3HT (18 h, 37°C, 5% CO2). Cell proliferation was a measurement of 3HT uptake and was assessed by liquid scintillation beta particle emission (Packard Instrument Co., Grove, Ill.).
Viruses. Animals were infected by subcutaneous injection with 105 TCID50 of BTV-3 (Central American strain) or BTV-11 (Colorado front-range strain) (Table 1). BTV-3 is exogenous to North America but found commonly in other parts of the world and for purposes of this study was isolated from Culicoides insignis in Central America (41). Unlike BTV-11, which was isolated from sheep during a disease outbreak in North America, the pathogenesis of BTV-3 in North American livestock is not known. The virus inocula were prepared in baby hamster kidney (BHK) cells, and first-passage cell culture supernatants were used for animal and cell culture inoculation. The concentration of viruses used for animal inoculations was based on previous animal infection studies (46).
Animals with classical signs of lentivirus infection were shown to harbor OvLV by methods described previously, including virus isolation (8) and in situ hybridization (9, 10). To assess the effects of lentivirus infection on BTV replication, monocytes were infected in vitro with OvLV strain 85/34 (37) and then later coinfected with BTV-3 or BTV-11. All animal inoculations and laboratory procedures utilizing foreign viruses were performed in a biocontainment level 3 facility.Plasma antibody. Plasma was assessed for BTV and OvLV antibodies by indirect enzyme-linked immunosorbent assay (ELISA) (Veterinary Diagnostic Technology, Inc., Wheat Ridge, Colo.). In addition, serial twofold dilutions of thawed plasma starting with a 1:100 dilution were used to estimate antiviral antibody concentrations to BTV-3 and BTV-11 nonstructural (NS1, NS2, and NS3) and major structural (VP3, VP7, VP2, and VP5) proteins by immunoblot analysis using methods described previously (8). Antibody titers were expressed as the reciprocal of the highest dilution of a sample which revealed the specific band of the viral polypeptide.
In vitro analysis of viral coinfection. Peripheral blood was obtained from retrovirus- and orbivirus-free sheep (21-95, 22-95, and 23-95). Monocytes were isolated and purified as described earlier and applied at 106 cells per well in fibronectin-coated eight-quadrant chamber slides. The cells were treated with phorbol 12-myristate 13-acetate (1 ng/ml; Sigma) and then maintained in RPMI 1640 medium (Gibco) supplemented with 100 U of penicillin, 100 µg of streptomycin, and 0.25 µg of amphotericin B per ml, 2 mM L-glutamine, 25 mM HEPES buffer, 5 µM 2-mercaptoethanol, 10% fetal calf serum, and 10% conditioned medium (F0165 monocyte/macrophage maintenance medium; Pan Data Systems, Rockville, Md.). Under these conditions, monocyte-derived macrophages were shown to maintain viability for at least 21 days.
Approximately 20 ng of viral capsid antigen (OvLV at a multiplicity of infection [MOI] of ~0.02) derived from OvLV strain 85/34 was applied to cultures of 106 ovine monocytes. After 2 h of absorption, the cultures were washed and incubated for another 48 h, and infection was verified by immunocytochemistry as described previously (7, 10). Monocyte cultures were then inoculated with 105 TCID50 of BTV-3 or BTV-11. Following 2 h of incubation with BTV, the cultures were washed, and virus infection and replication were assessed at 24-h intervals by end-point RT-PCR (11) and antigen capture ELISA (37, 39), respectively. The lower limits of detection were 10 virus copies per 50-µl sample by RT-PCR and 0.3 ng of viral capsid antigen per ml by capture ELISA.Gross and microscopic pathology. Animals were euthanatized at the height of clinical disease and/or peak viremia, and gross lesions were identified. Paraformaldehyde-fixed, paraffin-embedded tissues were sectioned (5 µm) by routine methods, stained with hematoxylin and eosin, and examined by incident light microscopy.
Virus burden in blood monocytes and tissues. Experiments were performed to estimate the virus burden in peripheral blood monocytes and selected tissues from sheep naturally infected with OvLV (group 2) and those experimentally infected with BTV-3 and BTV-11 (Table 1, groups 1 to 3).
(i) Virus isolation. Isolation of BTV from peripheral blood erythrocytes and monocytes and from biopsy tissues of bone marrow, skin, and prescapular lymph node at sequential time points following infection was attempted. Tissues were also collected at postmortem for virus isolation and included brain, cervical spinal cord, heart, lung, mediastinal lymph node, spleen, kidney, liver, rumen, and small intestine. Monolayer cultures (25-cm2 tissue culture flasks) of BHK cells were inoculated with lysates of bone marrow and erythrocytes (107 cells), solid tissues (0.5 cm3), or serial fourfold dilutions of monocytes (starting at 8 × 106 cells). The cultures were maintained in RPMI 1640 medium as described earlier. The monolayers were observed daily for cytopathic effects, passaged at 6-day intervals, and maintained for a minimum of 18 days or until cytopathic effects were observed. The cells were then harvested (1% trypsin and sodium EDTA) and cytocentrifuged to glass microscope slides (Superfrost Plus; Fisher Scientific, Pittsburgh, Pa.). The slides were treated with 100% acetone for 10 min at 4°C, air dried, and then reacted with digoxigenin (DIG)-labeled RNA probes to BTV-10 as described previously (11).
(ii) Solution-based RT-PCR. Serial fourfold dilutions of peripheral blood erythrocytes and monocytes (starting with 8.0 × 106 cells in triplicate) were prepared as lysates by incubating the diluted cells in 20 µg of proteinase K followed by 1× PCR buffer containing 0.45% Tween 20. Viral RNA was extracted with phenol-chloroform-isoamyl alcohol (25:24:1; United States Biochemical, Cleveland, Ohio), and nested RT-PCR was performed as described previously (11). Briefly, double-stranded viral RNA was denatured by using 50% formamide (United States Biochemical) and heat (70°C, 10 min). Sample RNA was added to the RT reaction mix (RT-PCR kit; Perkin-Elmer, Norwalk, Conn.) containing both the antisense (BT10N1-1164C)- and sense (BT10N1-107)-strand primers (see below) and then incubated at 42°C for 1 h followed by 95°C for 5 min. The oligonucleotide primers used in the RT reaction and PCR were designed based on conserved sequence within the BTV gene segment 6 (49). The conditions of the first PCR were 95°C for 0.5 min, 52°C for 1 min, 72°C for 2 min, and 5 min in the final cycle, with a total of 40 cycles. The second PCR consisted of 25 cycles under the same conditions of the first PCR. Cloned (pGEM vector kit; Promega, Madison, Wis.), and purified cDNA from gene segment 6 of BTV-10 was used as a positive control. Additional negative controls consisted of sterile water, erythrocyte lysates from sheep negative for BTV by serology, and plasmid vector DNA. Amplification products were resolved by electrophoresis in 2% agarose gels, blotted to Gene-Screen Plus nylon membranes (DuPont NEN, Wilmington, Del.), and hybridized with BTV-specific DIG-11-dUTP-labeled DNA probes designed to be internal to the amplification product. BTV-10-infected and uninfected BHK cells and DIG-labeled plasmid DNA (pGEM; 1 kb) were used as controls for all hybridization reactions.
(iii) Immunochemistry. MAbs to conserved epitopes to capsid proteins of BTV VP7 (50 µg/ml; 10D4.90, IgG1) and OvLV p25 (50 µg/ml; 3F, IgG1) were reacted with chamber slide preparations of monocytes and snap-frozen cryostat-sectioned tissues. The procedures utilized an avidin-biotin-peroxidase complex technique with diaminobenzidine as the chromogen (ABC Vectastain kit; Vector Laboratories, Burlingame, Calif.), performed by methods described previously (7, 8). Irrelevant MAbs (IgG1) to bovine herpesvirus 1 glycoprotein, BTV-11-infected and uninfected BHK cells, OvLV strain 85/34-infected and uninfected goat synovial cells, and a variety of tissues from sheep that were negative for BTV and OvLV by serology and PCR were used as controls.
(iv) In situ hybridization.
A full-length copy of the coding
region of gene segment 6 from BTV-10 (1,769 bp; GenBank accession no.
Y00422) was cloned into a transcription vector under the control of T7
and SP6 RNA polymerase promoters (PCR II; Invitrogen, San Diego,
Calif.). The construct was linearized and used as a template for
transcription using T7 and SP6 polymerase and DIG-labeled
ribonucleotides (DIG RNA labeling mix; Boehringer Mannheim,
Indianapolis, Ind.). The resulting transcripts were precipitated with
ethanol and quantified spectrophotometrically. The specificity and
working concentrations of the final products were determined by dot
blot analysis (11). Probes derived from BTV-10 were shown to
react with BTV-3 and BTV-11 with high affinity. Experiments were also
performed to evaluate the sensitivity of BTV-specific RNA probes.
Briefly, BHK cells were infected with BTV-10 at MOIs of 0.1, 1, and 10 for 1, 4, 12, and 24 h. Cytocentrifuged preparations of fixed (Permeafix) cells containing known copy numbers of virus were then
hybridized to BTV-specific riboprobes. Using this technique, cells
containing
20 virus copies could be detected. In addition, full-length cDNA from the OvLV p25gag (visna
virus strain 1514) was labeled with 35S by random priming
(Boehringer Mannheim). Probe construction and hybridization conditions,
including controls, were as described previously (9, 10).
OvLV probe sensitivity approximated 20 virus copies.
(v) PCR-driven RT In Situ hybridization. Following deparaffinization, tissue sections were rehydrated, washed in diethyl pyrocarbonate-treated water, and treated overnight at 37°C in a RNase-free DNase I solution (Boehringer Mannheim). The sections were then treated with the RT mix according to the manufacturer's recommendations (RT-PCR kit; Perkin-Elmer). Conditions for in situ PCR were similar for both BTV and OvLV. Briefly, a solution containing 10× PCR buffer (50 mM KCl, 10 mM Tris HCl [pH 8.3]), 4 mM MgCl2, 0.01% gelatin, 200 µM deoxynucleoside triphosphates, 50 pM each primer, and Taq polymerase (0.15 U/µl) was made. The PCR primers were specific for BTV gene segment 6 (BT10N1-107, 5'-3' [TCACCACAATGGACTTGCAGTCAC]; BT10N1-1164C, 3'-5' [CGACGCCGGTACAGAGTCTACA]) and OvLV p25gag gene (VVgpr.i3, 5'-3' [ACATAGGGAAGTTTACCCTATTGTG]; VVgpr.i4, 3'-5' [TCTATTCCCAGGCATCATAACCAATAC]). Both resulted in amplification products of about 300 bp. The PCR mixture was then added to tissue sections in volumes that ranged from 40 to 60 µl, depending on the size of the section, and coverslipped. Coverslips were anchored with nail polish, and edges were covered with mineral oil to prevent evaporation. The slides were then placed directly on the aluminum block of a thermocycler (Omnigene model HB-OS-BB; Hybaid, Woodbridge, N.J.). After 30 cycles, each consisting of denaturation at 94°C for 1 min and annealing at 55°C for 2 min, followed by polymerization for 2 min at 72°C, the slides were removed and treated for 5 min with xylenes to remove mineral oil and for 5 min in 100% ethanol and then air dried. Amplified DNA was detected by hybridization with DIG-labeled RNA probes specific for full-length BTV gene segment 6 or DIG-labeled DNA probes specific for full-length OvLV p25gag (as for in situ hybridization). Both probes were internal to the amplification product, and the BTV RNA probe was transcribed in sense orientation. The remainder of the procedure, including controls, was as described for in situ hybridization.
Data analysis. Data are presented as the mean ± standard error of the mean. Differences between two independent groups were evaluated by using the Mann-Whitney U test. Differences between more than two independent groups were evaluated by using the Kruskal-Wallis rank-sum test. Statistical analysis was performed with StatView 4.0 (Abacus Concepts, Berkeley, Calif.) software and a Macintosh Centris 650 computer. P values of <0.05 were considered significant.
| |
RESULTS |
|---|
|
|
|---|
Measurements of immunosuppression. Treatment groups are identified in Table 1. Animals treated with immunosuppressive drugs demonstrated minor elevations in peripheral blood neutrophils ([9.6 ± 1.4] × 103/µl), a slight decrease in lymphocytes ([1.6 ± 0.6] × 103/µl), and lowered serum cortisol concentrations (1.2 ± 0.4 µg of baseline cortisol/dl) within 2 months following drug treatment (all values were less than the reported standard mean). The leukogram and biochemical profiles of lentivirus-infected sheep, including serum cortisol, were within normal limits, although there was an inversion of the normal CD4 to CD8 ratio (22.3% CD4/43.6% CD8) in three (525, 9336, and 3678) of six OvLV-seropositive sheep. Both drug-treated and lentivirus-infected animals had depressed lymphocyte proliferative responses to PHA (1,593 ± 304 cpm) compared to untreated animals (45,314 ± 1,230) (P < 0.001). Similarly, immunosuppressed animals showed reduced expression of the cell surface antigens IL-2R (23.4 ± 5.3) and MHC-II (54.8 ± 9.7) compared to uninfected animals (38.5 ± 6.9 and 74.6 ± 11.2, respectively) (P < 0.05). Plasma IgM and IgG concentrations were similar between all groups.
Characterization of chronic-productive OvLV infection. In addition to inverted CD4/CD8 ratios and depressed lymphocyte proliferative responses, all OvLV-seropositive animals had clinical signs of emaciation, lymphadenopathy, and respiratory distress. Postmortem histopathological findings included widespread lymphocytic infiltrative and proliferative lesions: lesions characteristic of chronic OvLV infection and suggestive of immune dysfunction (9). OvLV RNA localized in high copy number to CD14-bearing cells (monocytes/macrophages) within the pulmonary interstitium (Fig. 1A) and within the prescapular and mediastinal lymph nodes. In situ PCR revealed OvLV DNA in high numbers of monocytes/macrophages (CD14), which were found in greatest density within the pulmonary interstitium and proximal to lymphoid aggregates (Fig. 1B).
|
Effects of immunosuppression on BTV pathogenesis. Peripheral blood and biopsy tissues were collected at sequential time points following BTV infection and then assessed for viral nucleic acid, viral proteins, and infectious virus. Because we found no difference when comparing the input virus (BTV-3 and BTV-11) and concentrations of BTV RNA in erythrocytes and monocytes (P < 0.05), results are presented as a summation of both virus serotypes within the specific treatment group (Fig. 2 and 4). In contrast, there were differences in BTV-3 and BTV-11 replication in monocytes; thus, these data are presented independently (Fig. 5).
|
Kinetics of infection in sequential blood and biopsy samples. The times from subcutaneous inoculation to first detection of virus in peripheral blood, and concentrations of virus in blood, were compared between different treatment groups. The presence of erythrocyte-associated viral RNA (Fig. 2) and erythrocyte-associated infectious virus (Fig. 3) was determined. Because viral RNA was found in peripheral blood, in most cases within 24 h of inoculation, initial detection was not dependent on amplification within regional lymph nodes. Although erythrocyte-associated BTV RNA was rapidly detected in the blood of animals in all experimental groups, viral RNA was detected at highest concentrations in animals that received immunosuppressive drugs (Fig. 2; P < 0.05). Infectious virus was also bound to erythrocytes but was not detected for at least 2 to 3 days following infection and was most abundant in animals that had been treated with immunosuppressive drugs or had chronic OvLV infection (Fig. 3).
|
1 in
105 monocytes from untreated clinically normal sheep
(P < 0.01). Immunosuppressed animals that were
infected with BTV-3 had higher numbers of monocytes yielding infectious
virus (Fig. 5A) at all time points compared to those infected with
BTV-11 (Fig. 5B) (P < 0.05). Activated lymphocytes
have also been reported as target cells for BTV (24),
although our preliminary studies did not confirm these findings. BTV
RNA was rarely detected by PCR in cultured lymphocytes (cultures with
>99% CD2+ cells), and infectious virus was never isolated
from this cell population in assays using the same indicator cell line
as for monocytes.
|
|
Serological and pathological features. Plasma antibody to BTV could be detected as early as 8 days following infection in most animals. The concentration of specific antibody and antibody reactivity to specific viral proteins did not vary between treatment groups or between animals infected with different BTV serotypes (P > 0.05 [Table 1]). Clinical signs were generally mild and sporadic and included lethargy, fever, and lameness. Gross pathological changes included widespread edema and erythema of mucous membranes and surrounding skin (mouth, anus, and urogenital tract), findings suggestive of acute vascular crises. Although gross postmortem lesions were generally mild and nonspecific, several animals (19, 24, 525, 3678, and 9336) showed mild petechial hemorrhages on the pleural surface of the lung, base of the pulmonary artery, and/or serosal surface of the rumen and reticulum, lesions characteristic of acute orbivirus infection. In contrast, histological lesions were common (Fig. 6) and were most severe in animals that had received immunosuppressive therapy and in sheep infected with BTV-3. We identified a wide variety of microscopic lesions, including acute endothelial hypertrophy associated with vascular stasis (Fig. 6A; most infected animals), pulmonary interstitial congestion and intra-alveolar hemorrhage (Fig. 6B; sheep 16, 24, 525, 1416, and 3678), and hemorrhage into the myocardium (Fig. 6C; sheep 16, 24, 525, and 9336) in association with vascular thrombosis and necrosis (Fig. 6D). Multifocal hemorrhage was also present in most lymph nodes (Fig. 6E; most immunosuppressed animals) and was found throughout the central nervous system (CNS), including the cervical spinal cord, midbrain, and cerebrum (Fig. 6F; sheep 18, 24, 525, 1416, 3678, and 9336). Surprisingly, none of the animals with CNS lesions showed gross neurological deficits. Hepatic (Fig. 6G) and renal (Fig. 6H) hemorrhage and/or congestion were found in most animals in all treatment groups. Again, signs of hepatic or renal failure were not observed. Of the few animals that were allowed to recover from acute infection, four (22, 24, 1416, and 9336) of eight had chronic inflammatory lesions in the myocardium (Fig. 7A) and/or skin at mucocutaneous junctures (Fig. 7B), and all four were immunosuppressed.
|
|
Localization of BTV proteins and transcripts.
Cells and
tissues from which BTV was isolated by cocultivation did not express
the VP7 capsid antigen by immunochemistry. From these same samples,
cell-associated viral RNA was rarely detected by in situ hybridization
and, when present, was found only in endothelial and mononuclear cells
within lymphoid tissues (e.g., spleen, lymph nodes, palantine tonsil,
and Peyer's patches) and only from animals with concurrent OvLV
infection or those that had received immunosuppressive drugs.
Furthermore, tissues from animals containing detectable viral RNA
(i.e.,
20 virus copies) were all infected with BTV-3. Interestingly,
monocyte-derived macrophages expressed high levels of VP7 capsid
antigen (Fig. 8A) following 48 h in
culture. Collectively, these findings suggest that viral gene
expression is restricted in the host, including animals with measurable
immunosuppression.
|
Localization of BTV RNA by RT in situ PCR. In contrast to in situ hybridization, viral RNA was detected by RT-in situ PCR in vast numbers of vascular endothelium, particularly in thin-walled vessels, in the myocardium (Fig. 8B), pericardial sac, lung, CNS (cerebrum, midbrain, and spinal cord) and most lymphoid tissues from both immunosuppressed and, to a lesser extent, clinically normal animals. Infection of endothelium was frequently associated with hemorrhage attributable to microvascular degeneration. Viral transcripts were also localized within the cytoplasm of mononuclear leukocytes with morphological characteristics of monocytes/macrophages (Fig. 8C, inset) within the submandibular lymph node (Fig. 8C), palantine tonsil (Fig. 8D), spleen (Fig. 8E), Peyer's patches of the ileum (Fig. 8F), pulmonary interstitium (Fig. 8G), and bone marrow (Fig. 8H) and to cells lining hair follicles in areas of chronic inflammation, ulceration, and vesicle formation (Fig. 7B, inset). Viral RNA was also detected, although infrequently, in histologically normal tissues in association with vascular endothelium and/or resident mononuclear leukocytes.
Staining was predominantly extranuclear (Fig. 8C, inset), as would be expected with an RNA virus thought to have only a cytoplasmic replication cycle. Omitting PCR resulted in a much reduced or absent hybridization signal. Mispriming events, nonspecific hybridizations, and other potential causes of false reactions were discounted, because control samples gave predicted results, including cytoplasmic localization of viral RNA. Histologic sections from all tissue samples that were positive by RT-in situ PCR were subjected to protease-digestion prior to RNA extraction, and the presence of BTV RNA was confirmed by solution-based RT-PCR. Experiments using BHK cell culture infected with a specific MOI of BTV-3 and -11 showed that cells containing
20 genomic copies could be detected by in situ
hybridization, and as few as one virus copy was detected by RT-in situ
PCR. Collectively, these results show that RT-in situ PCR was specific
for BTV and that virus burden was generally very low (i.e., <20 virus
copies per cell), yet infection was widespread and high numbers of
individual cells were infected.
| |
DISCUSSION |
|---|
|
|
|---|
Because of the wide range in individual response to BTV infection, we investigated the effects of immunosuppression on virus pathogenesis in breed- and age-matched sheep experimentally infected with antigenically distinct BTV isolates. Erythrocyte-associated BTV RNA was detected by solution-based PCR usually within 24 h following infection, several days before infectious virus was first isolated, and remained at high levels for the duration of the study. The association of BTV with erythrocytes does not progress beyond virus adsorption. Instead, virions persist within invaginations of the cell membrane (36, 49). Presumably because of this virus-cell association, viremia (35 to 42 days) and antigenemia (160 days) are prolonged (2, 31). In contrast, peripheral blood monocytes can be infected with BTV, as shown both in vitro (1, 24, 55) and in vivo (2, 17). However, the extent of infection in immunocompetent animals is thought to be minimal: usually less than 1 in 105 peripheral blood mononuclear cells harbors infectious BTV (17). Thus, the significance of monocyte infection in the pathogenesis of BTV is still largely unknown. Our results showed that monocytes are permissive to BTV infection, and animals with impaired immunity demonstrated significantly higher monocyte-associated virus burdens for a longer period of time. These findings suggest that immunosuppression could play a role in the natural history of orbivirus infection, allowing for increased virus persistence. Interestingly, differences were not observed when viral serotypes and RNA concentrations in monocytes were compared; yet BTV-3 replicated to a significantly higher titer in primary monocytes than did BTV-11. This finding suggests that both serotypes can enter monocytes but differ in capacity to replicate. Phenotypic differences in viral strains are common. Lentiviruses with "rapid-high" and "slow-low" growth potential have been described (37).
After an initial burst of virus replication in monocytes, replication ensued in regional lymph nodes, followed by release and systemic spread of virus to resident mononuclear leukocytes in the lung, CNS, and lymphoid and hematogenous tissues and to vascular endothelium in a wide variety of tissues. The profound differences in disease expression observed in different ruminant species following orbivirus infection are thought to be related to the extent of virus infection of endothelial cells (16, 35). Our findings support these earlier studies by demonstrating massive covert infection of vascular endothelium and mononuclear leukocytes, particularly in animals with impaired immunity. Widespread dissemination of BTV during early stages of infection may also provide a mechanism for accelerated disease and increased viral persistence by evasion of host immunity. Furthermore, because there was a difference between immunosuppressed and untreated animals in erythrocyte- and monocyte-associated virus burden and because these differences could not be accounted for by antigen-specific immune mechanisms, nonspecific mechanisms of immunity are likely to be important in controlling BTV in early infection. BTV infection of endothelium results in the rapid release of a variety of cytokines including gamma interferon (16, 26). Drug (33, 40)- and retrovirus (28)-induced immunosuppression is known to down-regulate cytokine gene expression and, in turn, may contribute to BTV persistence and/or pathogenesis.
Severe fluctuations in temperature, UV radiation, prolonged transportation, and overcrowding are known to have an adverse affect on the ruminant immune system (42) by impeding the production of arachidonic acid and synthesis of leukotrienes and prostaglandins. Exogenous corticosteroids such as dexamethasone block cell membrane-associated phospholipase A2 and prevent the production of arachidonic acid, which in turn affects leukopoiesis and leukocyte circulation. Alternatively, azothioprine is a purine analog that is quickly metabolized to the toxic derivative, 6-mercaptopurine. Its action affects predominantly T cells, although its onset of action is slow, often requiring greater than 1 month to take effect. In contrast, cyclophosphamide is a powerful alkylating agent. It causes rapid and severe immunosuppression by preferentially suppressing B cells. When these drugs are used in combination, as in the present study, a significant state of immunosuppression can be achieved. Animals treated with immunosuppressive drugs or those with chronic lentivirus infection, including those receiving high doses of cyclophosphamide, were shown to have normal antibody responses to BTV; however, most showed decreased lymphocyte proliferative responses to mitogens, decreased expression of cell surface antigens associated with cellular activation (MHC-II and IL-2R), and/or inverted CD4/CD8 lymphocyte ratios, all indicators of cellular immune dysfunction. Immunosuppression of mice by cyclophosphamide was shown to change the course of herpes simplex virus infection. Treatment affected dendritic cells and T cells, which normally prevent viral spread to the pancreas, CNS, and lymphoreticular organs (5). Similarly, immunosuppressed mice infected with murine herpesvirus had 2- to 3.5-times-higher viral burdens, and greater tissue distribution of virus-infected cells, and virus was recovered for longer periods of time (40).
OvLV infection is common in North America and has been associated with immune dysfunction (7, 9, 10). Infection has been reported to result in inverted CD4/CD8 T-lymphocyte ratios (32), decreased numbers of mature plasma cells within hyperplastic lymph nodes (21), decreased lymphocyte-generated IL-2 (22), decreased concanavalin A-induced suppressor cell activity (23), depressed cutaneous delayed-type hypersensitivity responses (47), decreased responses of PBL and bronchoalveolar lavage cells to mitogens (4), and increased pulmonary opportunistic infections (7). Although there was no evidence that OvLV altered BTV replication in blood monocytes infected in vitro, animals with chronic OvLV infection showed weakened cellular immunity and, in addition to having higher BTV burdens in monocytes and higher numbers of BTV-infected cells in tissues, had a wider range of BTV-associated lesions. Proliferative and infiltrative lesions associated with chronic OvLV infection may provide the optimal microenvironment for BTV replication and dissemination. In addition to their immunosuppressive properties, lentiviruses are known to have bidirectional interaction with other viruses (28). They can interact and alter and/or accelerate the disease course. For instance, HIV up-regulates herpesvirus genome expression and promotes transmissibility. This has been demonstrated in vitro through experiments showing transactivation, CD4 up-regulation, Fc receptor induction, pseudotype formation, cytokine production, and antigen presentation (15, 28, 34, 38).
Vascular degeneration and hemorrhage were present in a wide variety of tissues, mostly from animals treated with immunosuppressive drugs or with concurrent OvLV infection. The lesions were acute (lacked evidence of inflammation or a reparative process) and nonexpansive and were found exclusively in immunosuppressed animals, mostly those infected with BTV-3. Studies in mice have shown that intracranial BTV infection typically results in cerebral hemorrhage and necrosis (53). Others have shown that neurovirulence is attributed to genomic differences in viral serotypes (13) and the ability of viruses to gain access to the CNS (54). We observed high numbers of vascular endothelial cells in the CNS of immunocompromised animals to be infected with BTV-3, yet viral gene expression remained low. Furthermore, there was no evidence of neuronal or glial cell infection. These findings suggest that BTV-3 may have an increased tropism for the CNS, at least under circumstances of impaired immunity. In a related study, we have shown that deer infected with epizootic hemorrhagic disease virus, an orbivirus closely related to BTV, had significant CNS involvement manifest by widespread cerebral hemorrhage and massive infection of vascular endothelium (11).
Our results show that widespread dissemination of BTV occurs during early stages of infection and is heightened in animals with impaired immunity. This may provide a mechanism for accelerated disease and, for animals that survive, increased viral persistence. These findings also suggest that in addition to virulence factors that define viral serotypes, immunosuppression could play a role in the natural history of orbivirus infection, allowing for higher virus burden, increased virus persistence, accelerated disease, and greater potential for acquisition of virus by the arthropod vector.
| |
ACKNOWLEDGMENTS |
|---|
We thank Katherine D. Bardsley and Tamarind Keating for technical assistance and manuscript preparation, Walter J. Tabachnick for helpful discussions and manuscript critique, Lee H. Thompson for providing viruses, and Edward McGriff, Leonard Santistevan, and Darlene Tabachnick for animal care. We also acknowledge the Wyoming State Veterinary Laboratory for hematological and clinical chemistry analyses.
This study was supported by funds from the USDA, Agricultural Research Service, the Colorado State University Experimental Station (1-56271), and the Public Health Service (AI36613).
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: University of Washington School of Medicine, Department of Laboratory Medicine, Vaccine/Virology Division, Room T293X, Seattle, WA 98195. Phone: (206) 685-6894. Fax: (206) 685-3639. E-mail: sjbrodie{at}u.washington.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Barratt-Boyes, S. M.,
P. V. Rossitto,
J. L. Stott, and N. J. MacLachlan.
1992.
Flow cytometric analysis of in vitro bluetongue virus infection of bovine blood mononuclear cells.
J. Gen. Virol.
73:1953-1960 |
| 2. | Barratt-Boyes, S. M., and N. J. MacLachlan. 1994. Dynamics of viral spread in bluetongue virus infected calves. Vet. Microbiol. 40:361-371[Medline]. |
| 3. | Barratt-Boyes, S. M., and N. J. MacLachlan. 1995. Pathogenesis of bluetongue virus infection of cattle. J. Am. Vet. Med. Assoc. 9:1322-1329. |
| 4. | Begara, I., L. Juj'an, D. S. Collie, H. R. Miller, and N. J. Watt. 1995. In vitro response of lymphocytes from bronchoalveolar lavage fluid and peripheral blood to mitogen stimulation during natural maedi-visna virus infection. Vet. Immunol. Immunopathol. 49:75-88[Medline]. |
| 5. | Berkowitz-Balshayi, C., A. Rosen-Wolff, G. Darai, and Y. Becker. 1995. Immunosuppression of mice by cyclophosphamide (CyP) and cyclosporin A (CsA) changes the course of HSV-1 infection and the distribution of viral DNA in target organs. In Vivo 9:155-162[Medline]. |
| 6. | Brewer, A. W., and N. J. MacLachlan. 1994. The pathogenesis of bluetongue virus infection of bovine blood cells in vitro: ultrastructural characterization. Arch. Virol. 136:287-298[Medline]. |
| 7. | Brodie, S. J., K. A. Marcom, L. D. Pearson, B. C. Anderson, A. de la Concha-Bermejillo, J. A. Ellis, and J. C. DeMartini. 1992. The effects of virus load in the pathogenesis of lentivirus-induced lymphoid interstitial pneumonia. J. Infect. Dis. 166:531-541[Medline]. |
| 8. | Brodie, S. J., L. D. Pearson, G. D. Snowder, and J. C. DeMartini. 1993. Host-virus interaction as defined by amplification of viral DNA and serology in lentivirus infected sheep. Arch. Virol. 130:413-428[Medline]. |
| 9. | Brodie, S. J., L. D. Pearson, M. C. Zink, H. M. Bickle, B. C. Anderson, K. A. Marcom, and J. C. DeMartini. 1995. Ovine lentivirus expression and disease: virus replication, but not entry, is restricted to macrophages of specific tissues. Am. J. Pathol. 146:1-13[Medline]. |
| 10. | Brodie, S. J., H. M. Bickle, and J. C. DeMartini. 1995. Ovine lentivirus-associated subclinical encephalomyelitis: virological markers in cerebrospinal fluid are predictive of central nervous system disease. Clin. Immunol. Immunopathol. 77:14-18[Medline]. |
| 11. | Brodie, S. J., K. D. Bardsley, J. O. Mecham, K. Diem, S. E. Norelius, and W. C. Wilson. Epizootic hemorrhagic disease: analysis of tissues by amplification and in situ hybridization reveals widespread orbivirus infection at low copy number. J. Virol. 72:3863-3871. |
| 12. |
Calisher, C. H.
1995.
Medically important arboviruses of the United States and Canada.
Clin. Microbiol. Rev.
7:89-116 |
| 13. |
Carr, M. A.,
C. C. de Mattos,
C. A. de Mattos, and B. I. Osburn.
1994.
Association of bluetongue virus gene segment 5 with neuroinvasiveness.
J. Virol.
68:1255-1257 |
| 14. | Cheney, I. W., M. Yamakawa, P. Roy, J. O. Mecham, and W. C. Wilson. 1996. Molecular characterization of the segment 2 gene of epizootic hemorrhagic disease virus serotype 2: gene sequence and genetic diversity. Virology 224:555-560[Medline]. |
| 15. | Clouse, K. A., P. B. Robbins, B. Fernie, J. M. Ostrove, and A. S. Fauci. 1989. Viral antigen stimulation of the production of human monokines capable of regulating HIV-1 expression. J. Immunol. 143:470-475[Abstract]. |
| 16. | Coen, M. L., J. A. Ellis, D. T. O'Toole, and W. C. Wilson. 1991. Cytokine modulation of the interaction between bluetongue virus and endothelial cells in vitro. Vet. Pathol. 28:524-532[Abstract]. |
| 17. | de la Concha-Bermejillo, A., C. E. Schore, C. A. Dangler, C. C. de Mattos, C. A. de Mattos, and B. I. Osburn. 1992. Comparison of slot blot nucleic acid hybridization, immunofluorescence, and virus isolation techniques to detect bluetongue virus in blood mononuclear cells from cattle with experimentally induced infection. Am. J. Vet. Res. 53:2245-2250[Medline]. |
| 18. | de Mattos, C. A., C. C. P. de Mattos, B. I. Osburn, and N. J. Maclachlan. 1994. Heterogeneity of the L2 gene of field isolates of bluetongue virus serotype 17 from the San Joaquin Valley of California. Virus Res. 31:67-87[Medline]. |
| 19. | de Mattos, C. C. P., C. A. de Mattos, B. I. Osburn, and N. J. MacLachlan. 1994. Evolution of the L2 gene of strains of bluetongue virus serotype 10 isolated in California. Virology 201:173-177[Medline]. |
| 20. | de Swart, R. L., P. S. Ross, H. H. Timmerman, H. W. Vos, P. J. Reijnders, J. G. Vos, and A. D. Osterhaus. 1995. Impaired cellular immune response in harbour seals (Phoca vitulina) feeding on environmentally contaminated herring. Clin. Exp. Immunol. 101:480-486[Medline]. |
| 21. | Ellis, J. A., and J. C. DeMartini. 1985. Immunomorphologic and morphometric changes in pulmonary lymph nodes of sheep with progressive pneumonia. Vet. Pathol. 22:32-41[Abstract]. |
| 22. | Ellis, J. A., and J. C. DeMartini. 1985. Partial purification and assay in normal sheep and sheep with ovine progressive pneumonia. Vet. Immunol. Immunopathol. 8:15-25[Medline]. |
| 23. | Ellis, J. A., and J. C. DeMartini. 1985. Evidence of decreased concanavalin A induced suppressor cell activity in the peripheral blood and pulmonary lymph nodes of sheep with ovine progressive pneumonia. Vet. Immunol. Immunopathol. 8:93-106[Medline]. |
| 24. | Ellis, J. A., M. L. Coen, N. J. MacLachlan, W. C. Wilson, E. S. Williams, and A. J. Leudke. 1993. Prevalence of bluetongue virus expression in leukocytes from experimentally infected ruminants. Am. J. Vet. Res. 54:1452-1456[Medline]. |
| 25. | Fiscus, S. A., J. C. DeMartini, and L. D. Pearson. 1982. Mitogen-induced blastogenesis of peripheral blood and efferent lymph lymphocytes from sheep. Am. J. Vet. Res. 43:629-632[Medline]. |
| 26. | Foster, N. M., A. J. Luedke, I. M. Parsonson, and T. E. Walton. 1991. Temporal relationships of viremia, interferon activity, and antibody responses of sheep infected with several bluetongue virus strains. Am. J. Vet. Res. 52:192-196[Medline]. |
| 27. | Garssen, J., W. Goettsch, F. de Gruijl, W. Slob, and H. van Loveren. 1996. Risk assessment of UVB effects on resistance to infectious diseases. Photochem. Photobiol. 64:269-274[Medline]. |
| 28. | Griffiths, P. D. 1996. Herpesviruses and AIDS. J. Antimicrob. Chemother. 37(Suppl. B):87-95. |
| 29. |
Holland, J. J.,
K. Spindler,
F. Horodyski,
E. Grabau,
S. Nichol, and S. VandePol.
1982.
Rapid evolution of RNA genomes.
Science
215:1577-1585 |
| 30. | Jeggo, M. H., R. C. Wardley, and J. Brownlie. 1984. A study of the role of cell-mediated immunity in bluetongue virus infection in sheep, using cellular adoptive transfer techniques. Immunology 52:403-410[Medline]. |
| 31. |
Katz, J.,
D. Alstad,
G. Gustafson, and J. Evermann.
1994.
Diagnostic analysis of the prolonged bluetongue virus RNA presence found in the blood of naturally infected cattle and experimentally infected sheep.
J. Vet. Diagn. Invest.
6:139-142 |
| 32. | Kennedy-Stoskopf, S., C. M. Zink, and O. Narayan. 1989. Pathogenesis of ovine lentivirus-induced arthritis: phenotypic evaluation of T lymphocytes in synovial fluid, synovium, and peripheral circulation. Clin. Immunol. Immunopathol. 52:323-330[Medline]. |
| 33. | Kinlen, L. 1992. Immunosuppressive therapy and acquired immunological disorders. Cancer Res. 52(Suppl. 19):5474-5476. |
| 34. | Lusso, P., A. De Maria, M. Malnati, F. Lori, S. E. DeRocco, M. Baseler, and R. C. Gallo. 1991. Induction of CD4 and susceptibility to HIV-1, infection of human CD8+ T lymphocytes by human herpesvirus 6. Nature 349:533-535[Medline]. |
| 35. | MacLachlan, N. J., G. Jagels, P. V. Rossitto, P. F. Moore, and H. W. Heidner. 1990. The pathogenesis of experimental bluetongue virus infection of calves. Vet. Pathol. 27:223-229[Abstract]. |
| 36. | MacLachlan, N. J., R. A. Nunamaker, J. B. Katz, M. M. Sawyer, G. Y. Akita, B. I. Osburn, and W. J. Tabachnick. 1994. Detection of bluetongue virus in the blood of inoculated calves: comparison of virus isolation, PCR assay, and in vitro feeding of Culicoides variipennis. Arch. Virol. 136:1-8[Medline]. |
| 37. |
Marcom, K. A.,
S. J. Brodie,
L. D. Pearson, and J. C. DeMartini.
1992.
Analysis of ovine lentivirus infectivity and replication using a focal immunoassay and an antigen-capture ELISA.
J. Clin. Microbiol.
30:2852-2858 |
| 38. | McKeating, J. A., P. D. Griffiths, and R. A. Weiss. 1990. HIV susceptibility conferred to human fibroblasts by cytomegalovirus-induced Fc receptor. Nature 343:659-661[Medline]. |
| 39. | Mecham, J. O. 1993. Detection of bluetongue virus from blood of infected sheep by use of an antigen-capture enzyme-linked immunosorbent assay after amplification of the virus in cell culture. Am. J. Vet. Res. 54:370-372[Medline]. |
| 40. | Mistr'ikov'a, J., D. Furd'ikov'a, I. Oravcova, and J. Rajc'ani. 1996. Effect of immunosuppression on Balb/c mice infected with murine herpesvirus. Acta Virol. 40:41-44[Medline]. |
| 41. | Mo, C. L., L. H. Thompson, E. J. Homan, M. T. Oviedo, E. C. Greiner, J. Gonzalez, and M. R. Saenz. 1994. Bluetongue virus isolations from vectors and ruminants in Central America and the Caribbean. Am. J. Vet. Res. 55:211-215[Medline]. |
| 42. | Morrison, W. I. 1986. In The ruminant immune system in health and disease. Cambridge University Press, New York, N.Y. |
| 43. | Nelson, J. A., P. Ghazal, and C. A. Wiley. 1990. Role of opportunistic viral infections in AIDS. AIDS 4:1-10[Medline]. |
| 44. | Parsonson, I. M. 1990. Pathology and pathogenesis of bluetongue infections. Curr. Top. Microbiol. Immunol. 162:119-141[Medline]. |
| 45. | Parsonson, I. M. 1992. Overview of bluetongue virus infection of sheep, p. 713-724. In T. E. Walton, and B. I. Osburn (ed.), Bluetongue, African horse sickness, and related orbiviruses. CRC Press, Boca Raton, Fla. |
| 46. | Parsonson, I. M., L. H. Thompson, and T. E. Walton. 1994. Experimentally induced infection with bluetongue virus serotype 11 in cows. Am. J. Vet. Res. 55:1529-1534[Medline]. |
| 47. | Pyrah, I. T., and N. J. Watt. 1996. Immunohistochemical study of the depressed cutaneous DTH response in sheep naturally infected with an ovine lentivirus (Maedi-Visna virus). Clin. Exp. Immunol. 104:32-36[Medline]. |
| 48. | Richards, R. G., N. J. MacLachlan, H. W. Heidner, and F. J. Fuller. 1988. Comparison of virologic and serologic responses of lambs and calves infected with bluetongue virus serotype 10. Vet. Microbiol. 18:233-242[Medline]. |
| 49. |
Shad, G.,
W. C. Wilson,
J. O. Mecham, and J. F. Evermann.
1997.
Bluetongue virus detection: a safer reverse-transcriptase polymerase chain reaction for prediction of viremia in sheep.
J. Vet. Diagn. Invest.
9:118-124 |
| 50. | Starr, S. E. 1996. Novel mechanism of immunosuppression after measles. Lancet 348:1257-1258[Medline]. |
| 51. | Tabachnick, W. J. 1996. Culicoides variipennis and bluetongue-virus epidemiology in the United States. Annu. Rev. Entomol. 41:23-43[Medline]. |
| 52. | Tishon, A., M. Manchester, F. Scheiflinger, and M. B. Oldstone. 1996. A model of measles virus-induced immunosuppression: enhanced susceptibility on neonatal human PBLs. Nat. Med. 2:1250-1254[Medline]. |
| 53. | Venter, E. H., J. J. van der Lugt, and G. H. Gerdes. 1993. Detection of bluetongue virus RNA in cell cultures and in the central nervous system of experimentally infected mice using in situ hybridization. Onderstepoort J. Vet. Res. 60:39-45[Medline]. |
| 54. |
Waldvogel, A. S.,
J. L. Stott,
K. R. E. Squire, and B. I. Osburn.
1986.
Strain-dependent virulence characteristics of bluetongue virus serotype 11.
J. Gen. Virol.
67:765-769 |
| 55. |
Whetter, L. E.,
N. J. MacLachlan,
D. H. Gebhard,
H. W. Heidner, and P. F. Moore.
1989.
Bluetongue virus infection of bovine monocytes.
J. Gen. Virol.
70:1663-1676 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»