Previous Article | Next Article 
J Virol, June 1998, p. 5198-5206, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Relative Rates of Retroviral Reverse Transcriptase
Template Switching during RNA- and DNA-Dependent DNA
Synthesis
Robert R.
Bowman,1
Wei-Shau
Hu,2,3 and
Vinay K.
Pathak2,4,*
Department of Genetics and Developmental
Biology,1
Mary Babb Randolph Cancer
Center,2
Department of Microbiology and
Immunology,3 and
Department of
Biochemistry,4 West Virginia University,
Morgantown, West Virginia 26506
Received 3 November 1997/Accepted 11 February 1998
 |
ABSTRACT |
Retroviral reverse transcriptases (RTs) frequently switch templates
during DNA synthesis, which can result in mutations and recombination.
The relative rates of in vivo RT template switching during RNA- and
DNA-dependent DNA synthesis are unknown. To determine the relative
rates of RT template switching during copying of RNA and DNA templates,
we constructed spleen necrosis virus-based retroviral vectors
containing a 400-bp direct repeat. The directly repeated sequences were
upstream of the polypurine tract (PPT) in the RB-LLP vector; the same
direct repeats flanked the PPT and attachment site (att) in
the RB-LPL vector. RT template switching events could occur during
either RNA- or DNA-dependent DNA synthesis and delete one copy of the
direct repeat plus the intervening sequences. RB-LLP vectors that
underwent direct repeat deletions during RNA- and DNA-dependent DNA
synthesis generated viral DNA that could integrate into the host
genome. However, any deletion of the direct repeats in the RB-LPL
vector that occurred during RNA-dependent DNA synthesis resulted in
deletion of the essential PPT and att site and generated a
dead-end viral DNA product. Thus, only RB-LPL vectors that underwent
direct repeat deletions during DNA-dependent DNA synthesis could
integrate to form proviruses. The RB-LLP and RB-LPL vectors were
permitted to undergo a single replication cycle, and the frequencies of
direct repeat deletions were determined by PCR and Southern analysis of
the resulting proviruses. A comparison of the frequency of direct
repeat deletions in the RB-LLP and RB-LPL vectors indicated that the in
vivo rates of RT template switching during RNA- and DNA-dependent DNA
synthesis are nearly identical.
 |
INTRODUCTION |
Reverse transcription is an
essential step of the retroviral life cycle (1, 40, 41).
During this process, the virally encoded reverse transcriptase (RT)
copies viral RNA into a double-stranded DNA (5). RT has a
propensity to undergo frequent template switching events by
dissociating and reassociating with the template (42). Two
such template switching events, minus-strand strong-stop and plus-strand strong-stop DNA transfers, are necessary for completion of
reverse transcription (17). Because these template switching events are obligatory to viral replication, it has been hypothesized that RT evolved to frequently switch templates (42). In
addition to the two strong-stop DNA transfers, which occur at the ends of the template, RT can also undergo additional internal template switching events (12, 21, 23, 27, 28, 30, 31, 49). The
internal template switching events can be either intramolecular (same
template) or intermolecular (copackaged template). Intramolecular template switches can result in deletions, deletions with insertions, insertions, and duplications, whereas intermolecular template switches
can result in homologous or nonhomologous recombination (21). Thus, the template switching property of RT plays an
important role in generating variation in retroviral populations.
Another consequence of RT template switching is that directly repeated
sequences in viral genomes are deleted at very high frequencies. Direct
repeat instability in retroviral vectors and in viral genomes has been
previously observed (6, 22, 29, 33, 43). The rates of direct
repeat deletions were recently determined for a single replication
cycle of spleen necrosis virus (SNV) and murine leukemia virus (MLV)
(8, 23, 30). It was shown that direct repeats of 110, 383, 788, and 1,333 bp in SNV-based vectors were deleted at high rates of
41, 40, 85, and 93%, respectively (23, 30). In addition, a
701-bp direct repeat in an MLV-based vector was shown to be deleted at
rates of 57% when the repeated sequences were in tandem and 89% when
the repeats were separated by the MLV packaging sequence
(8). We recently determined that the RT template switching
events that lead to deletions of the direct repeat are primarily
intramolecular (21). We also observed that retroviral
recombination exhibits high negative interference, whereby viruses that
exhibit one intermolecular RT template switch have a higher probability
of exhibiting another intermolecular RT template switch
(21).
RT template switching events that lead to deletions of the direct
repeat can potentially occur either during RNA-dependent (minus-strand)
DNA synthesis or during DNA-dependent (plus-strand) DNA synthesis.
Although previous in vitro studies have suggested that RT template
switching occurs at a higher rate during RNA-dependent DNA synthesis
than during DNA-dependent DNA synthesis (16, 26), the
relative in vivo rates of RT template switching during RNA- and
DNA-dependent DNA synthesis are unknown. Since direct repeat deletions
occur at a high rate and can be easily identified, they provide a good
model system for studying RT template switching events. Previously, we
proposed that the high frequency of direct repeat deletions occurred
primarily during RNA-dependent DNA synthesis (23). It was
postulated that the RNase H activity of RT continually degrades the RNA
template 18 to 20 nucleotides (nt) behind the site of polymerization.
Therefore, the nascent DNA strand and the template RNA would be
expected to be held together by only a few hydrogen bonds, which would
in turn be expected to promote dissociation of the nascent DNA and RT
from the template. Once dissociated, the nascent DNA and the RT may
reassociate with the point of dissociation or with the homologous point
in the 5' direct repeat. Reassociation with the 5' direct repeat would
be favored by increased base pairing, leading to deletion of the direct
repeat and intervening sequence.
In an effort to shed light on the relative rates with which RT switches
templates during RNA- and DNA-dependent DNA synthesis, we designed a
strategy to distinguish the two template switching events in vivo. Our
results indicate that RT template switching events occur at nearly
equal rates during RNA- and DNA-dependent DNA synthesis.
 |
MATERIALS AND METHODS |
Definitions.
pRB-LLP, pRB-LPL, pVP212, pRB-PPT, and pWH342
refer to plasmids, and RB-LLP, RB-LPL, VP212, RB-PPT, and WH342 refer
to the viruses derived from these plasmids.
Plasmid construction.
SNV-based retroviral vectors pRB-LLP
and pRB-LPL were derived from the previously described retroviral
vector pVP212 (30). Standard molecular cloning procedures
were used (36). To construct pRB-LLP, pVP212 was first
partially digested with XmnI and treated with calf
intestinal phosphatase (CIP; Boehringer Mannheim Biochemicals [BMB])
to dephosphorylate the ends. A 70-bp blunt-ended polylinker was then
ligated into the XmnI site to generate pRB-RFE. The
polylinker was designed to contain ClaI, XhoI,
NdeI, EcoRV, and EcoRI restriction sites. The sequence of the polylinker was
5'ATCGATTATTATCCTGCTCGAGCCTGATAGCCCATATGTTAGTCCGACGATATCCGCCGATGGTGAATTC3'. pRB-RFE was cut with EcoRI and then treated with CIP
followed by Klenow fragment (BMB) to generate dephosphorylated blunt
ends. pUC-Nco was derived from pUC19 by replacement of the pUC19
polylinker with an 8-bp NcoI linker. A 400-bp fragment of
the lacZ
peptide gene was generated by digestion of
pUC-Nco with HaeII, followed by treatment with T4 DNA
polymerase to generate blunt ends. The exact size of the
lacZ
fragment is 399 bp; this fragment will be referred
to as the 400-bp fragment for the sake of simplicity. The
HaeII fragment was isolated by gel elution and ligated into the EcoRI site of pRB-RFE to generate pRB-LLP.
pRB-LPL was derived by digestion of pVP212 with NotI
followed by treatment with CIP and Klenow fragment to generate
dephosphorylated blunt ends. The same HaeII fragment
isolated from pUC-Nco was inserted into the NotI site to
generate pRB-LPL.
pRB-PPT was derived by partial digestion of pRB-LPL with
NcoI followed by self-ligation. pRB-PPT contains one copy of
the
lacZ
fragment and lacks the polypurine tract (PPT)
and
att site.
pWH342 was derived from the previously described vector pEB232F
(
3). pEB232F was digested with
HindIII and
XbaI, followed
by treatment with Klenow fragment to generate
blunt ends. The
resulting DNA fragment was self-ligated to generate
pWH342, a
vector that contains the promoter region of the
lacZ
gene but
lacks the PPT and
att site.
Cells, transfections, and infections.
D17 and C3A2 cells
(obtained from the American Type Culture Collection) were maintained in
Dulbecco's modified Eagle's medium (ICN) supplemented with 6% bovine
calf serum (HyClone Laboratory), penicillin (50 U/ml) (Gibco), and
streptomycin (50 µg/ml) (Gibco). D17 is a dog osteosarcoma cell line
that can be infected with SNV (34). C3A2 is a D17-derived
reticuloendotheliosis virus-based helper cell line that can efficiently
package RNAs containing SNV encapsidation sequence (46). The
selective drugs puromycin (Sigma) and G418 (an analog of neomycin;
Gibco) were present at final concentrations of 1.75 µg/ml (3.2 µM)
and 400 µg/ml (0.58 mM), respectively.
Cells were transfected by the previously described dimethyl
sulfoxide-Polybrene method (
24). For virus infection, D17
cells
were plated at a density of 2 × 10
5 cells on
60-mm-diameter plates or 10
6 cells on 100-mm-diameter
dishes. Twenty-four hours later, cells
were infected with 0.2 ml of
virus (60-mm-diameter dishes) or
1 ml of virus (100-mm-diameter dishes)
in the presence of Polybrene
(50 µg/ml [final concentration]) as
previously described (
20).
Transfected or infected cells
were placed on puromycin selection
48 h later or G418 selection
24 h later.
Viral transfections, infections, and titer comparisons.
The
titers of retroviral vectors pRB-LLP, pRB-LPL, pVP212, pRB-PPT, and
pWH342 were compared by the following method. The DNA of each
retroviral vector was cotransfected into C3A2 helper cells with pBSpac
at a ratio of 10 µg to 1 µg of plasmid DNAs. Plasmid pBSpac
contains the puromycin N-acetyltransferase gene (7,
45). The transfected C3A2 cells were selected for puromycin resistance, pooled, expanded, and replated at a density of 2 × 106 cells per 100-mm-diameter dish. The culture medium was
changed on day 1. On day 2, the culture medium containing virus was
harvested and used to infect D17 cells. The average virus titers were
determined from two to nine independent experiments.
PCR analysis of proviral DNAs.
Proviral DNAs were amplified
by PCR (19, 35) in an automated thermal cycler (OmniGene)
with two primers that annealed to RB-LLP and RB-LPL proviruses. The 5'
primer annealed to the region of each provirus containing the pBR
origin of replication and was comprised of the sequence
5'-GGACAGGTATCCGGTAAGCGGCAGGGTC-3'. The 3' primer annealed
to the U3 region of each provirus and was comprised of the sequence
5'-GCTTCTCGAATCGGCTGCATTTCTCGGCATC-3'. DNA purification, PCR
amplification, and restriction enzyme digestions were performed by
standard techniques (36). A 5% polyacrylamide gel was used
for separation of DNA fragments generated by restriction digestion.
Southern analysis of proviral DNAs.
Genomic DNAs were
isolated and proviral structures were analyzed by Southern blot
hybridizations using standard procedures (36). A 1.9-kb
fragment of pVP212 containing the pBR and F1 origins of replication
(ori) and a 0.4-kb lacZ
fragment were separately used to
generate probes with the random-priming method (13) (Random
Hexamer kit; BMB) and [
-32P]dCTP (ICN Pharmaceuticals,
Inc.). The specific activities of these probes were greater than
109 cpm/µg. Genomic DNAs were digested with restriction
enzymes, separated by agarose gel electrophoresis, and transferred to
nylon membranes as specified by the manufacturer (GeneScreen; Dupont NEN Research Products). The probes were hybridized to the nylon membranes and subsequently exposed to autoradiography film (Kodak) and/or a PhosphorImager cassette (Molecular Dynamics). Quantitation of bands was accomplished with the ImageQuant program (Molecular Dynamics).
 |
RESULTS |
Construction of retroviral vectors with direct repeats.
Two
SNV-based retroviral vectors, pRB-LLP and pRB-LPL, were constructed to
determine the relative rates of in vivo RT template switching during
RNA- and DNA-dependent DNA synthesis. Both vectors contained a neomycin
phosphotransferase gene which was expressed from the long terminal
repeat promoter (Fig. 1A). Both vectors also contained two copies of a 400-bp lacZ
gene fragment.
The pRB-LLP vector contained both copies of the lacZ
fragment 5' of the PPT. In contrast, the pRB-LPL vector contained one
copy of the lacZ
fragment 5' of the PPT and another copy
3' of the PPT and att site. Both vectors were designed so
that the distance between the two lacZ
fragments was 70 bp. Deletion of the 400-bp direct repeat in the pRB-LLP vector during
either RNA- or DNA-dependent DNA synthesis was expected to result in
viral DNA that could integrate to form a provirus. On the other hand,
deletion of the 400-bp direct repeat in the pRB-LPL vector during
RNA-dependent DNA synthesis was expected to result in deletion of the
intervening PPT and att site. Deletion of the PPT would be
expected to prevent initiation of plus-strand DNA synthesis and
generate a dead-end product. Deletion of the direct repeat in the
pRB-LPL vector during DNA-dependent DNA synthesis was expected to
generate heteroduplex viral DNA that could integrate to form a
provirus. In addition to the 400-bp direct repeat, the pRB-LLP and
pRB-LPL vectors also contained a 110-bp direct repeat 5' of the 400-bp
direct repeat that has previously been shown to delete at a rate of 30 to 41% per replication cycle (21, 30). The 110-bp direct
repeat was included in the vectors to determine whether RT template
switching events that lead to deletion of the 400-bp direct repeat
affect the frequency of deletion of the 110-bp direct repeat. To
experimentally determine whether the deletion of the PPT and
att site from the pRB-LPL vector would result in failure to
complete reverse transcription, we also constructed pRB-PPT and pWH342
(Fig. 1A). These vectors were similar to pRB-LPL except that one copy
of the lacZ
fragment plus the PPT and att site
were deleted from both of these vectors. Because of these deletions,
pRB-PPT and pWH342 were not expected to complete reverse transcription
and form proviruses. Finally, the relative efficiencies of viral
replication of the pRB-LLP, pRB-LPL, pRB-PPT, and pWH342 vectors were
determined by comparison to the control vector pVP212, which is very
similar to pRB-LLP except that it contains only one copy of the
lacZ
gene (Fig. 1A).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
Structures of SNV-based retroviral vectors and
experimental protocol to determine the relative rates of direct repeat
deletions during minus-strand and plus-strand DNA synthesis. (A) All
vectors contain a neomycin phosphotransferase gene (neo) and
the pBR and F1 origins of replication (ori). The vectors pRB-LLP,
pRB-LPL, pRB-PPT, and pVP212 contain a 400-bp lacZ
fragment (lac). pWH342 contains the promoter region of the
lacZ fragment. pRB-LLP contains a direct repeat of the
lacZ fragment 5' of the PPT. pRB-LPL contains one copy of
lacZ 5' of the PPT and a second copy of
lacZ 3' of the PPT within the U3 region of the 3' long
terminal repeat (LTR). The distances between the two copies of the
repeated sequences are the same in pRB-LLP and pRB-LPL. All vectors
also contain a 110-bp direct repeat (open boxes). The PPT and
att site were deleted from both pRB-PPT and pWH342. pVP212
contains one copy of lacZ fragment 5' of the PPT and
att site. (B) Experimental protocol. C3A2 helper cells were
cotransfected with pRB-LLP or pRB-LPL in the presence of pBSpac, an
expression vector which confers resistance to puromycin. Pools of
puromycin-resistant helper cells were expanded; virus was harvested
from the helper cells and used to infect D17 target cells. The infected
D17 cells were selected for resistance to G418. Genomic DNAs were
isolated from either single-cell clones or pools of G418-resistant
cells. The DNAs from single-cell clones were analyzed by PCR, and the
DNAs from pools of cells were analyzed by Southern hybridization. Some
of the single-cell clones were also analyzed by Southern
hybridization.
|
|
Protocol for analysis of template switching and virus titers.
The experimental approach taken to directly compare in vivo RT template
switching during RNA- and DNA-dependent DNA synthesis in one
replication cycle is outlined in Fig. 1B. One replication cycle is
defined as the steps of viral replication necessary for the generation
of a provirus in the target cells from the vector DNA in the helper
cells. This process includes RNA transcription in the helper cells and
reverse transcription in the target cells. The vectors pRB-LLP and
pRB-LPL were separately cotransfected into C3A2 helper cells along with
pBSpac, a plasmid that contains the puromycin
N-acetyltransferase gene. The transfected cells were
selected for puromycin resistance, and the resulting colonies were
separately pooled and expanded. Viruses produced from the cells were
used to infect D17 target cells, and the infected cells were selected
for G418 resistance. Genomic DNAs were isolated from single-cell clones
and from pools of the D17 target cells. The frequencies of direct
repeat deletions were quantified by PCR amplification and restriction
analysis of single-cell clones. These frequencies were then verified by
examining a much larger number of proviruses by Southern analysis of
the target cell pools.
Virus titers were determined by quantitation of G418-resistant D17
colonies after infection. The results of four independent
experiments
performed with both pRB-LLP and pRB-LPL vectors are
summarized in Table
1. The average virus titers of pRB-LPL
(275
CFU/ml) were approximately 2.5-fold lower than the virus titers
of
pRB-LLP (700 CFU/ml). Deletion of the direct repeat in the
pRB-LPL
vector during RNA-dependent DNA synthesis was expected
to delete the
intervening PPT and
att site and generate a dead-end
product. Therefore, the virus titers obtained were consistent
with the
expectation that the viral titers of pRB-LPL would be
lower than the
viral titers of pRB-LLP. Four additional infections
were also performed
in order to obtain more single-cell clones
for PCR analysis (data not
shown).
PCR amplification and restriction analysis of target cell clones to
determine the frequencies of direct repeat deletions.
To determine
the frequencies of direct repeat deletions, the infected D17 target
cell clones were individually propagated and 3' regions of the proviral
genomes were amplified by PCR. The locations of the PCR primers and the
sizes of DNA fragments expected after digestion with BglI
are shown in Fig. 2A. Digestion with
BglI of PCR products derived from RB-LLP proviruses without deletion was expected to yield 1.1-, 0.47-, and 0.62-kb fragments. In
contrast, digestion with BglI of PCR products derived from RB-LLP proviruses with deletion was expected to yield only a 1.1- and a
0.62-kb fragment. Thus, for pRB-LLP the presence of the 0.47-kb
fragment was indicative of a provirus that did not undergo a direct
repeat deletion.

View larger version (37K):
[in this window]
[in a new window]
|
FIG. 2.
Analysis of target cell clones for direct repeat
deletions. (A) Locations of primers used for PCR amplification and
expected fragments after digestion with BglI. Structures of
the 3' ends of RB-LPL and RB-LLP proviruses without (above) and with
(below) direct repeat deletion are shown. The large arrowheads indicate
the approximate locations and directions of primers used for PCR
amplification. The locations of BglI restriction sites
(Bgl) are shown above the proviruses without direct repeat
deletions. All other abbreviations are as for Fig. 1A. BglI
digestion of PCR products derived from RB-LPL proviruses is expected to
generate 1.1-kb (or 1.0-kb) and 0.56-kb fragments from proviruses
without or with deletion of the 400-bp direct repeat. A 0.47-kb
fragment is expected only from RB-LPL proviruses without deletion of
the 400-bp direct repeat. Similarly, BglI digestion of PCR
products derived from RB-LLP proviruses is expected to generate 1.1-kb
(or 1.0-kb) and 0.62-kb fragments from proviruses without or with
deletion of the 400-bp direct repeat. A 0.47-kb fragment is expected
only from RB-LLP proviruses without deletion of the 400-bp direct
repeat. (B) Representative restriction digestion analysis of PCR
products derived from RB-LPL and RB-LLP proviruses. Lanes 1 and 2, RB-LLP proviruses with and without, respectively, direct repeat
deletion; lanes 3 and 4, RB-LPL proviruses with and without,
respectively, direct repeat deletion. The approximate sizes of the
restriction fragments are shown. Lane M, molecular weight marker.
|
|
Similar PCR amplification and restriction digestion analysis of
proviruses derived from pRB-LPL were also performed (Fig.
2A).
Digestion with
BglI of PCR products derived from RB-LPL
proviruses
without deletion was expected to yield 1.1-, 0.47-, and
0.56-kb
fragments. In contrast, digestion with
BglI of PCR
products derived
from RB-LPL proviruses with deletion was expected to
yield only
a 1.1- and a 0.56-kb fragment. Thus, the presence of the
0.47-kb
fragment was indicative of a RB-LPL provirus that did not
undergo
a direct repeat deletion.
The 1.1-kb fragment contained another 110-bp direct repeat that was
previously shown to delete at a frequency of 30 to 41%
per replication
cycle (
21,
30). The 110-bp direct repeat was
located 5' of
the 400-bp direct repeat in pRB-LLP and pRB-LPL,
and deletion of this
direct repeat was not expected to interfere
with virus replication.
Based on previous studies, approximately
30 to 40% of the proviruses
analyzed were expected to generate
a 1.0-kb fragment rather than a
1.1-kb fragment.
Representative restriction analysis of a provirus with deletion of the
400-bp direct repeat and a provirus without deletion
of the 400-bp
direct repeat for both RB-LLP and RB-LPL are shown
in Fig.
2B.
Digestion with
BglI of the PCR product derived from
a RB-LLP
provirus generated a 1.1-kb and a 0.62-kb fragment indicating
that the
provirus had deleted one copy of the 400-bp direct repeat
(lane 1).
Similar analysis of another RB-LLP provirus generated
1.1-, 0.62-, and
0.47-kb fragments (lane 2). The presence of the
0.47-kb fragment
indicated that this provirus had retained the
400-bp direct repeat.
Identical restriction analysis of PCR products derived from a RB-LPL
provirus with deletion of the 400-bp direct repeat and
another RB-LPL
provirus without deletion of the 400-bp direct
repeat are shown in
lanes 3 and 4, respectively. A 1.1- and a
0.56-kb fragment were
generated from the PCR product shown in
lane 3; however a 1.0-, a
0.56-, and a 0.47-kb fragment were generated
from the PCR product shown
in lane 4. These analyses indicate
that the RB-LPL provirus in lane 3 underwent deletion of the 400-bp
direct repeat whereas the RB-LPL
provirus in lane 4 did not undergo
deletion of the 400-bp direct
repeat. The presence of the 1.0-kb
band in lane 4 indicated that this
provirus also underwent deletion
of the 110-bp direct repeat. The
parental RB-LPL and RB-LLP vectors
containing both copies of the direct
repeats were used as positive
controls for all PCRs. PCR amplification
of the vector DNAs always
yielded only products that contained both
copies of the direct
repeats, indicating that under the conditions
used, direct repeat
deletions did not occur during PCR (data not
shown).
The PCR amplification and restriction analysis illustrated in Fig.
2
were performed on 43 cell clones infected with RB-LLP
and 40 cell
clones infected with RB-LPL (Table
2).
These clones
were derived from eight independent infections with each
vector
and represent separate infection events. Most of these clones
were isolated from separate plates of infected cells (34 of 43
for
RB-LLP and 36 of 40 for RB-LPL). In the few cases where two
clones were
derived from the same plate, one clone generated a
1.1-kb band and
another generated a 1.0-kb band, indicating that
the two cell clones
were generated from independent infection
events (data not shown).
The data indicated that deletion of the 400-bp direct repeat occurred
more frequently in RB-LLP proviruses than in RB-LPL
proviruses.
Approximately 86% of the RB-LLP proviruses (37 of
43) underwent
deletion of the 400-bp direct repeat either during
transfection of the
helper cells or during reverse transcription.
In contrast,
approximately 62% of the RB-LPL proviruses (25 of
40) underwent
deletion of the 400-bp direct repeat. The difference
between these
frequencies of direct repeat deletions was statistically
significant
(
P = 0.02, two-proportions test). The lower frequency
of direct repeat deletions observed for the RB-LPL vector than
for the
RB-LLP vector is consistent with the expectation that
only deletions
occurring during DNA-dependent DNA synthesis can
be observed in this
population.
We also compared the frequencies of 110-bp direct repeat deletions in
RB-LLP and RB-LPL proviruses with and without deletion
of the 400-bp
direct repeat. Approximately 33% of the RB-LLP proviruses
(2 of 6) and
27% of the RB-LPL proviruses (4 of 15) that did not
have deletions of
the 400-bp direct repeat had deletions of the
110-bp direct repeat. In
contrast, 51% of the RB-LLP proviruses
(19 of 37) and 76% of the
RB-LPL proviruses (19 of 25) in which
the 400-bp direct repeat was
deleted also had deletions of the
110-bp direct repeat. Thus,
proviruses that were deleted of the
400-bp direct repeat had deletions
of the 110-bp direct repeat
at a higher frequency than proviruses that
were not deleted of
the 400-bp direct repeat (38 of 62 versus 6 of 21,
P = 0.02, two-proportions
test).
Southern analysis of pools of transfected and infected cells to
determine the frequencies of direct repeat deletions.
Deletion
frequencies in pRB-LLP and pRB-LPL were also determined by Southern
blotting analysis (Fig. 3). Genomic DNAs
from four pools of cells infected with RB-LLP and four pools of cells infected with RB-LPL were analyzed (the sizes of the pools ranged from
1,700 to 8,800 colonies per pool). In addition, four pools of C3A2
helper cells transfected with pRB-LLP DNA were analyzed to determine
the extent to which direct repeat deletions occurred during
transfection and selection of the helper cells.

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 3.
Southern analysis of C3A2 helper cells transfected with
pRB-LLP and pools of D17 cells infected with RB-LLP or RB-LPL. (A)
Structures of the 3' ends of RB-LLP and RB-LPL proviruses without
deletion of the 400-bp direct repeat (above) and with deletion of the
400-bp direct repeat (below) are shown. Restriction digestion with
HindIII (H) plus NotI
(N) of genomic DNAs from the C3A2 helper cells transfected
with RB-LLP is expected to generate a 3.0-kb band from the undeleted
proviruses and a 2.5-kb band from the deleted proviruses. The black
bars below the RB-LLP undeleted provirus represent the 1.9-kb fragment
used to generate the ori probe and the 0.4-kb lacZ
fragment used to generate the lacZ probe for Southern
analysis. Restriction digestion with HindIII
(H) plus BamHI (Bam) of genomic DNAs
from pools of D17 cells infected with RB-LLP is expected to generate a
3.5-kb band from the undeleted proviruses and a 3.1-kb band from the
deleted proviruses. Similarly, restriction digestion with
HindIII (H) plus BamHI
(Bam) of genomic DNAs from pools of D17 cells infected with
RB-LPL is expected to generate a 3.5-kb band from the undeleted
proviruses and a 3.0-kb band from the deleted proviruses. All other
abbreviations are as for Fig. 1A. (B)
HindIII-plus-NotI digestion of DNAs from four
pools of pRB-LLP-transfected C3A2 cells followed by hybridization to
the lacZ probe. The intensities of the 3.0-kb band
representing the undeleted vectors and the 2.5-kb bands representing
the deleted vectors were quantitated by PhosphorImager analysis.
Frequencies of deletions of the 400-bp direct repeat based on the
ratios of the intensities of the 2.5-kb band to the 3.0-kb band are
shown below the lanes. (C) HindIII-plus-BamHI
digestion of DNAs from four pools of RB-LLP-infected D17 cells (lanes 1 to 4) and four pools of RB-LPL-infected D17 cells followed by
hybridization to the ori probe (lanes 5 to 8). The intensities of the
3.5-kb band representing the undeleted proviruses and the 3.1- or
3.0-kb bands representing the deleted proviruses for RB-LLP and RB-LPL,
respectively, were also quantitated by PhosphorImager analysis. The
estimated frequencies of deletion of the 400-bp direct repeat are shown
below the lanes.
|
|
The restriction sites used and the sizes of the resulting fragments are
shown in Fig.
3A. Genomic DNAs from pools of C3A2
cells transfected
with pRB-LLP were digested with
HindIII plus
NotI and hybridized to a 0.4-kb
lacZ
probe
(Fig.
3A, upper left
panel). It was necessary to use the
lacZ
probe rather than the
ori probe because the genome
of the C3A2 helper cells contains
several copies of plasmid sequences
that are expected to hybridize
to the ori probe and complicate
analysis. Viral DNAs without deletion
of the 400-bp direct repeat were
expected to generate a 3.0- or
2.9-kb fragment and DNAs with direct
repeat deletions were expected
to generate a 2.5- or 2.4-kb fragment
(Fig.
3A, left panels).
In this Southern analysis, the 3.0- and 2.9-kb
fragments were
not separated and are referred to as 3.0-kb fragments,
and the
2.5- and 2.4-kb fragments were not separated and are referred
to as 2.5-kb fragments. Southern analysis indicated that the 3.0-kb
fragments were clearly evident in DNAs from the pools of cells
transfected with pRB-LLP, while the 2.5-kb fragments were detectable
at
low levels in all four of the pools analyzed (Fig.
3B, left
panel).
Additional faint bands larger than 3.0 kb, which most
likely represent
nonspecific binding to the genomic DNA, were
visible. Quantitation of
the 3.0- and 2.5-kb bands indicated that
the signal intensity of the
3.0-kb bands was approximately 28
fold higher than that of the 2.5-kb
bands. The undeleted 3.0-kb
fragments were expected to have a
twofold-higher signal intensity,
since these bands were expected to
contain two copies of the
lacZ
fragment to hybridize to
twice as much of the
lacZ
probe. Since
the 3.0-kb band
was expected to have a twofold-higher signal intensity,
the molar ratio
of the 3.0-kb band to the 2.5-kb band was 14:1.
Therefore,
approximately 7% of the pRB-LLP DNAs underwent direct
repeat deletions
during the process of transfection and selection
of helper cell clones.
Southern hybridization analysis of four independent RB-LLP- and
RB-LPL-infected D17 cell pools was also performed (Fig.
3B,
right
panel). Genomic DNAs from the pools were separately isolated
and
digested with
HindIII plus
BamHI. RB-LLP
proviruses without
deletion of the 400-bp direct repeat were expected
to generate
a 3.5- or 3.4-kb fragment, and RB-LLP proviruses with
deletion
of the 400-bp direct repeat were expected to generate a 3.1- or
3.0-kb fragment (Fig.
3A, left panels). In this Southern analysis,
the 3.5- and 3.4-kb fragments were not separated and are referred
to as
3.5-kb fragments, and the 3.1- and 3.0-kb fragments were
not separated
and are referred to as 3.1-kb fragments. Similarly,
RB-LPL proviruses
without deletion of the 400-bp direct repeat
were expected to generate
a 3.5- or a 3.4-kb fragment, and RB-LPL
proviruses with deletion of the
400-bp direct repeat were expected
to generate a 3.0- or 2.9-kb
fragment (Fig.
3A, right panels).
In this Southern analysis, the 3.5- and 3.4-kb fragments were
not separated and are referred to as 3.5-kb
fragments, and the
3.0- and 2.9-kb fragments were not separated and are
referred
to as 3.0-kb fragments. The digested DNAs were hybridized to a
1.9-kb probe fragment derived from the ori region of the RB-LPL
vector.
The results obtained from four pools of cells infected
with RB-LLP
indicated that most of the proviruses underwent deletion
of the 400-bp
direct repeat (Fig.
3C, lanes 1 to 4). In comparison,
the results
obtained from four pools of cells infected with pRB-LPL
indicated that
a lower proportion of the proviruses underwent
deletion of the 400-bp
direct repeat (Fig.
3C, lanes 5 to 8).
Quantitation of the 3.5-kb
undeleted bands and the 3.1- or 3.0-kb
deleted bands was performed to
determine the frequencies of direct
repeat deletions. The results
indicated that on average 88% (±3%)
of the RB-LLP proviruses
underwent direct repeat deletions and
58% (±7%) of the RB-LPL
proviruses underwent direct repeat deletions.
Thus, the direct repeat
deletion frequencies of RB-LLP and RB-LPL,
as determined by Southern
analysis, were very similar to the frequencies
determined by PCR
amplification and restriction digestions (86%
for RB-LLP and 62% for
RB-LPL).
Deletion of the PPT and attachment sites reduces the efficiency of
provirus formation.
The deletion frequencies obtained from pRB-LPL
suggested that direct repeat deletions occurred at a high rate during
DNA-dependent DNA synthesis. This interpretation was based on the
assumption that any direct repeat deletions that occurred during
RNA-dependent DNA synthesis would result in the deletion of the PPT and
att site and generate a dead-end product. To validate this
assumption, we generated two vectors, pRB-PPT and pWH342, which were
similar to pRB-LPL but lacked the PPT and att sites. Our
rationale for using two independently constructed vectors was to rule
out the possibility of cryptic PPT or att sites being
inadvertently present in the vectors, which would permit completion of
viral replication. For both vectors, initiation of DNA-dependent DNA
synthesis from the PPT primer and subsequent proviral formation were
expected to be greatly decreased, leading to a severe reduction in
virus titers. Independent and parallel transfections and infections were performed, and the virus titers obtained with pRB-PPT and pWH342
were compared to the virus titers obtained with the control vectors
pVP212 and pRB-LLP. As shown in Table 3,
the virus titers obtained from pVP212 and pRB-LLP vectors were
approximately 400 CFU/ml. In contrast, the virus titers obtained from
pRB-PPT and pWH342 were approximately 10 CFU/ml. Therefore, deletion of
the PPT and att site from pRB-PPT and pWH342 resulted in a
40-fold reduction in the efficiency of provirus formation. The 40-fold reduction in the virus titers represents the minimum reduction in the
virus titers as a result of PPT deletions, since it is conceivable that
higher virus titers from the control vectors would further increase the
difference between the virus titers.
Southern analysis of clones of infected cells indicates efficient
DNA repair of heteroduplex viral DNAs.
Deletion of the direct
repeats during DNA-dependent DNA synthesis of the pRB-LPL vector is
expected to generate a heteroduplex viral DNA (Fig.
4A). The host cell DNA repair machinery
may resolve these heteroduplexes in three different ways. First, it is
possible that the sequence of the plus strand will be used as a
template to replace the sequence of the minus strand (Fig. 4A, Repair
to plus-strand). If this occurs, each daughter cell will inherit a
provirus with a direct repeat deletion following integration of the
viral DNA and cell division of the infected cells. The resulting cell
clones will be homogeneous with respect to the provirus genotype.
Second, it is possible that the sequence of the minus strand will be
used as a template to replace the sequence of the plus strand (Fig. 4A,
Repair to minus-strand). If so, then both of the daughter cells that
form after cell division will inherit a provirus without direct repeat
deletion, and the resulting cell clone will be homogeneous with respect
to the provirus genotype. Third, if DNA repair does not take place,
then the heteroduplex viral DNA will integrate into the host cell
chromosome, with one strand containing a direct repeat deletion and the
other strand containing both copies of the direct repeat (Fig. 4A, No
repair). After cell division, one daughter cell will inherit a provirus with direct repeat deletion, and the other daughter cell will inherit a
provirus without direct repeat deletion. The resulting cell clone will
be heterogeneous, containing both deleted and undeleted proviruses.
Thus, the frequency of cell clones that are heterogeneous with respect
to the provirus genotype can be used to determine whether efficient DNA
repair of the heteroduplex DNAs occurred before integration and cell
division.

View larger version (62K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of RB-LPL-infected single-cell clones for
potential DNA repair of heteroduplex viral DNA. (A) Potential effects
of DNA repair of heteroduplex viral DNA on colony phenotypes. Black
ovals represent cells containing a provirus with deletion of the 400-bp
direct repeat; white ovals represent cells containing a provirus that
was not deleted of the 400-bp direct repeat. All other abbreviations
are as for Fig. 1A. Deletion of the 400-bp direct repeat during
plus-strand synthesis of RB-LPL is expected to generate a heteroduplex
viral DNA. If the heteroduplex DNA is repaired to the plus-strand, then
homogeneous colonies containing deleted proviruses will form (Repair to
plus-strand). If the heteroduplex DNA is repaired to the minus strand,
then homogeneous colonies containing undeleted proviruses will form
(Repair to minus-strand). If the heteroduplex DNA is not repaired prior
to viral DNA integration and cell division, a mixed colony containing
both deleted and undeleted proviruses will form (No repair). LTR, long
terminal repeat. (B) Southern analysis of RB-LPL single-cell clones.
The genomic DNAs isolated from 12 single-cell clones of infected D17
cells were analyzed to determine the presence of mixed-colony
phenotypes. Each DNA was digested with HindIII plus
NotI and hybridized to radioactively labeled ori probe (Fig.
3A). All 12 clones underwent direct-repeat deletions as determined by
PCR amplification and restriction digestion analysis. In all 12 clones,
only the 3.0-kb fragment characteristic of a deleted provirus was
present, indicating that these clones were derived from homogeneous
colonies.
|
|
Because selective amplification of the RB-LPL proviruses with deletion
of the 400-bp direct repeats (1.6- or 1.5-kb fragments)
occurred under
the amplification conditions used, PCR analysis
of the cell clones
could not be used to determine heterogeneity
with respect to the
provirus genotype (data not shown). We therefore
analyzed 12 RB-LPL
cell clones by Southern analysis to determine
whether any of the cell
clones were heterogeneous and contained
both undeleted and deleted
proviruses. Since all direct repeat
deletions in the RB-LPL vector
occurred during DNA-dependent DNA
synthesis, all of these clones were
derived from heteroduplex
viral DNAs. Genomic DNAs isolated from the
cell clones were digested
with
HindIII plus
BamHI and hybridized to the ori probe. The results
are shown
in Fig.
4B. Any cell clones heterogeneous with respect
to the provirus
genotype were expected to generate a 3.5-kb band
from the undeleted
proviruses and a 3.0-kb band from the deleted
proviruses. The results
obtained clearly showed that only the
3.0-kb band was generated from
all 12 cell clones (Fig.
4B), indicating
that none of the cell clones
were heterogeneous and contained
only the deleted proviruses. These
results suggested that efficient
DNA repair of the heteroduplex DNAs
occurred. The DNA repair could
have taken place either before
integration of viral DNA into the
chromosome or after integration but
before replication of the
provirus through cell division.
 |
DISCUSSION |
RT switches templates at similar rates during RNA- and
DNA-dependent DNA synthesis.
The frequencies of deletion of the
400-bp direct repeat observed for the pRB-LPL and pRB-LLP vectors can
be used to estimate the frequencies of RT template switching during
RNA- and DNA-dependent DNA synthesis. Data generated from PCR analysis
provided a more quantitative measure of the frequencies of direct
repeat deletions and were used for the analysis. The observed and
estimated fractions of proviruses that underwent direct repeat
deletions during RNA- and DNA-dependent DNA synthesis are shown in Fig.
5. As discussed earlier, deletions that
are observed for the pRB-LPL vector represent only RT template
switching events occurring during DNA-dependent DNA synthesis. Based on
the PCR analysis, the frequency of RT template switching events that
lead to direct repeat deletions during DNA-dependent DNA synthesis of
RB-LPL was 62%, and the ratio of RB-LPL proviruses with and without
direct repeat deletions was 62%/38%. It should be noted that
approximately 7% of the RB-LPL vector DNAs are expected to undergo
direct repeat deletions during the process of transfection and
selection of helper cells. Since viruses derived from these DNAs with
direct repeat deletions are expected to lack the PPT and att
site, they are not expected to complete reverse transcription,
integrate, and generate proviruses. Therefore, it is not necessary to
adjust the 62% frequency of direct repeat deletions during
DNA-dependent DNA synthesis.

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 5.
Illustration of the rationale used to extrapolate
frequencies of RT template switching during RNA- and DNA-dependent DNA
synthesis. Deletion of the direct repeat (black boxes) may occur during
either transfection of the vectors into packaging cells, RNA-dependent
DNA synthesis, or DNA-dependent DNA synthesis during replication of the
RB-LLP or the RB-LPL vectors. Approximately 7% of the viral DNAs
undergo deletion during transfection (Fig. 3B). Direct repeat deletion
during transfection or RNA-dependent DNA synthesis of the RB-LPL vector
results in the generation of a dead-end (Dead) product. Therefore, it
is not necessary to adjust the rates of deletion during RNA-dependent
DNA synthesis of the RB-LPL vector for the rate of deletion during
transfection. The frequencies of RB-LPL deleted proviruses (62%) and
undeleted proviruses (38%) are shown. The frequencies of RB-LLP
undeleted proviruses (14%) is also shown. Approximately 86% of the
RB-LLP vectors underwent direct repeat deletions during either
transfection or RNA-dependent DNA synthesis. Since 7% of the viral
DNAs were deleted during transfection, approximately 79% (86% 7%)
of the RB-LLP vectors underwent direct repeat deletion during RNA- and
DNA-dependent DNA synthesis. The frequencies of RB-LLP proviruses that
underwent direct repeat deletions during RNA-dependent DNA synthesis
(56%) and DNA-dependent DNA synthesis (23% of total) were
extrapolated from the observed frequencies of direct repeat deletions
for the RB-LPL vector (see Discussion). Only 37% (100% [56% + 7%]) of the RB-LLP proviruses that did not undergo direct repeat
deletion during transfection or RNA-dependent DNA synthesis were
capable of deleting the direct repeat during DNA-dependent DNA
synthesis.
|
|
In contrast to pRB-LPL, the frequency of direct repeat deletions
observed for the pRB-LLP vector represents RT template switching
events
occurring during transfection, RNA-dependent DNA synthesis,
and
DNA-dependent DNA synthesis. Based on the PCR analysis, the
frequency
of RT template switching events that resulted in direct
repeat
deletions of RB-LLP was 86%. It was determined that approximately
7%
of the direct repeat deletions in RB-LLP vectors occurred during
the
process of transfection and selection of helper cells (Fig.
3B).
Therefore, we estimate that approximately 79% (86%

7%)
of RB-LLP
proviruses underwent a direct repeat deletion either
during RNA- or
DNA-dependent DNA synthesis. The ratio of the RB-LLP
proviruses with
and without direct repeat deletions during reverse
transcription was
79%/14%. It is important to note that only RB-LLP
proviruses that
retain the direct repeat either during RNA-dependent
DNA synthesis or
during transfection can serve as substrates for
direct repeat deletions
during DNA-dependent DNA synthesis. An
unknown fraction of the RB-LLP
proviruses (designated
x) underwent
deletions during
DNA-dependent DNA synthesis, and the remaining
fraction of the RB-LLP
proviruses (79%
x) underwent deletions
during
RNA-dependent DNA synthesis. Therefore, the ratio of RB-LLP
proviruses
that did and did not undergo deletions during DNA-dependent
DNA
synthesis was
x/14%. Assuming that the same fraction of
RB-LLP
and RB-LPL proviruses undergo deletions during DNA-dependent DNA
synthesis, we can estimate that approximately 23% of the RB-LLP
proviruses deleted the direct repeat during DNA-dependent DNA
synthesis
(if
x/14% = 62%/38%, then
x = 62% × 14%/38% = 23%).
Since an estimated 23% of the RB-LLP proviruses
deleted the direct
repeat during DNA-dependent DNA synthesis, 56% of
the proviruses
deleted the direct repeat during RNA-dependent DNA
synthesis (79%

23%). Based on this analysis, an estimated 56% of
the RB-LLP
proviruses underwent direct repeat deletions during
RNA-dependent
DNA synthesis, and 62% of the RB-LPL proviruses
underwent direct
repeat deletions during DNA-dependent DNA synthesis.
These results
indicate that the rates of RT template switching during
RNA- and
DNA-dependent DNA synthesis are nearly identical.
On the surface, a comparison of the frequencies of deletions for RB-LLP
during RNA-dependent and DNA-dependent DNA synthesis
may suggest that
direct repeat deletions occur at different rates
during RNA- and
DNA-dependent DNA synthesis (56% versus 23%).
However, it is
important to note that approximately 63% of the
RB-LLP proviruses
underwent direct repeat deletions during transfection
or RNA-dependent
DNA synthesis (56% during RNA-dependent DNA synthesis
and 7% during
transfection); therefore, only 37% of the viruses
could potentially
delete the direct repeats during DNA-dependent
DNA synthesis. We have
extrapolated that 62% of the proviruses
that could undergo direct
repeat deletion during DNA-dependent
DNA synthesis did so (37% × 0.62 = 23%). Therefore, 56% of the
RB-LLP viruses underwent
direct repeat deletion during RNA-dependent
DNA synthesis, and 62% of
the remaining viruses underwent direct
repeat deletion during
DNA-dependent DNA synthesis.
It is important to note that the rate of RT template switching during
DNA-dependent DNA synthesis may represent an underestimate.
Direct
repeat deletions during DNA-dependent DNA synthesis are
expected to
generate heteroduplex DNAs, a fraction of which may
be corrected to the
undeleted minus strand by host DNA repair
mechanisms (discussed below).
The previously proposed model for high-frequency deletion of direct
repeats was based on other published studies indicating
that RNase H
continually degrades the template RNA 18 to 20 nt
behind the site of
DNA polymerization (
10,
11,
14,
15,
18,
48). In vitro
studies have indicated that the RNase H
activity of RT is important for
RT template switching (
16,
26).
In the latter study, only
template switching events that occurred
when the polymerase reached the
end of the template were analyzed
(
26). In addition, these
studies have shown that the RNase H
activity plays an important role in
the minus-strand strong-stop
DNA transfer. Although some in vitro
studies have suggested that
the RNase H degradation of the template and
DNA synthesis activities
are coupled (
11,
15,
18,
48), other
in vitro studies have
suggested that RNase H degradation may not be
coupled to the synthesis
of nascent DNA (
9,
37-39). The
results of this study are consistent
with the view that the RNase H
degradation in vivo may not be
coupled to DNA synthesis, since the
frequency of direct repeat
deletions during RNA-dependent DNA synthesis
was not higher than
the deletion frequency during DNA-dependent DNA
synthesis. These
results extend our previous studies, which indicate
that substitutions
and frameshift mutations occur at similar rates
during RNA- and
DNA-dependent DNA synthesis (
25).
Alternatively, it is possible
that RNase H degradation of the template
RNA facilitates RT template
switching during RNA-dependent DNA
synthesis, and other mechanisms
promote RT template switching during
DNA-dependent DNA synthesis.
Mechanisms that may promote RT template
switching during DNA-dependent
DNA synthesis include strand
displacement synthesis, secondary
structure of the template DNA, and
low affinity of the RT for
the DNA template.
Heteroduplex viral DNAs are efficiently repaired by host cell DNA
repair mechanisms.
The results of this study indicate that
heteroduplex viral DNAs, generated as a result of direct repeat
deletions during DNA-dependent DNA synthesis of pRB-LPL, were
efficiently repaired. The potential repair of the heteroduplex DNAs can
result in three types of cell clones (Fig. 4). First, DNA repair of the
viral DNAs may not occur. In this case, heteroduplex colonies would be
expected. Since all of the cell clones analyzed were homogeneous,
containing only proviruses with direct repeat deletions, we conclude
that efficient DNA repair of the viral DNAs occurred. Second, DNA
repair may not exhibit strand specificity. If so, then 50% of the
time, the deleted plus strand may get repaired by using the undeleted
minus strand as a template. Consequently, the observed frequency of direct repeat deletions for the RB-LPL proviruses (62%) would be an
underestimate, and the actual rate of direct repeat deletions during
DNA-dependent DNA synthesis may approach 100%. Second, DNA repair may
exhibit strand specificity and preferentially correct the plus strand
by using the undeleted minus strand as a template; then the rate of RT
template switching during DNA-dependent DNA synthesis may be much
higher as well. However, since 62% of the proviruses exhibited direct
repeat deletion, only 38% of the proviruses could have been corrected
to the undeleted form by DNA repair. Therefore, DNA repair mechanisms
did not preferentially correct the plus strand by using the minus
strand as a template. Third, if strand-specific repair occurred and
preferentially corrected the undeleted minus strand by using the
deleted plus strand as a template, then the observed frequency of
direct repeat deletions for the RB-LPL proviruses (62%) would be an
accurate estimate of the actual rate of RT template switching during
DNA-dependent DNA synthesis.
Repair of viral DNAs containing small heteroduplexes has been
previously described (
2,
32). In these studies, the
efficiency
or potential strand specificity of DNA repair could not be
determined.
DNA repair of 16-nt loops in nonviral DNAs has been
observed to
occur efficiently (
44); the repair of the loops
exhibited strand
specificity and required the presence of a nick in
close proximity
to the heteroduplex. Since the retroviral integration
process
creates a gap at the 5' end of the minus strand, which would be
approximately 600 bp from the heteroduplex, it is possible that
strand-specific repair of the RB-LPL heteroduplex DNAs occurred
and
preferentially corrected the undeleted minus strand by using
the
deleted plus strand as a template.
In this study, the ability of retroviral vectors lacking a PPT and
att site to complete reverse transcription and form
proviruses
was analyzed. Surprisingly, the vectors without PPT and
att site
were able to form proviruses at 2% efficiency
relative to the
wild-type vectors. The viral DNAs produced from these
vectors
are expected to lack the 5'
att site and may have
integrated into
the target cells by aberrant integration events or by a
mechanism
not involving viral integrase.
Finally, proviruses that underwent deletion of the 400-bp direct repeat
also were deleted of the 110-bp direct repeat at a
higher than expected
frequency, suggesting that direct repeat
deletions exhibit high
negative interference (
4,
47). This
observation suggests
that RTs that undergo one template switch
event have a higher
probability of undergoing another template
switch event. We have
previously shown that retroviral recombination
exhibits high negative
interference, whereby viruses that exhibit
one intermolecular template
switch have a higher probability of
exhibiting another intermolecular
template switch. It should be
noted that direct repeat deletions
primarily occur by intramolecular
template switching events whereas
retroviral recombination requires
intermolecular template switching
events (
21). Experiments to
verify that intramolecular RT
template switching events exhibit
high negative interference are in
progress.
 |
ACKNOWLEDGMENTS |
We thank Jeffery Anderson, Benjamin Beasley, Que Dang, Krista
Delviks, Elias Halvas, John Julias, Evguenia Svarovskaia, Yegor Voronin, and Wenhui Zhang for critical reading of the
manuscript.
This work was supported by Public Health Service grants CA58875 to
V.K.P. and CA58345 to W.-S.H. from the National Institutes of Health.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Mary Babb
Randolph Cancer Center, West Virginia University, Morgantown, WV 26506. Phone: (304) 293-0495. Fax: (304) 293-4667. E-mail:
VPATHAK{at}WVUMBRCC1.hsc.wvu.edu.
 |
REFERENCES |
| 1.
|
Baltimore, D.
1970.
Viral-dependent DNA polymerase.
Nature
226:1209-1211[Medline].
|
| 2.
|
Berwin, B., and E. Barklis.
1993.
Retrovirus-mediated insertion of expressed and non-expressed genes at identical chromosomal locations.
Nucleic Acids Res.
21:2399-2407[Abstract/Free Full Text].
|
| 3.
|
Bowman, E. H.,
V. K. Pathak, and W.-S. Hu.
1996.
Efficient initiation and strand transfer of polypurine tract-primed plus-strand DNA prevents strand transfer of internally initiated plus-strand DNAs.
J. Virol.
70:1687-1694[Abstract].
|
| 4.
|
Chase, M., and A. H. Doerman.
1958.
High negative interference over short segments of the genetic structure of bacteriophage T4.
Genetics
43:332-353[Free Full Text].
|
| 5.
|
Coffin, J. M.
1996.
Retroviridae: the viruses and their replication, p. 1767-1848.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, vol. 3. Raven Press, New York, N.Y.
|
| 6.
|
Czernilofsky, A. P.,
A. D. Levinson,
H. E. Varmus,
J. M. Bishop,
E. Tisher, and H. M. Goodman.
1980.
Nucleotide sequence of an avian sarcoma virus oncogene (src) and proposed amino acid sequence of gene product.
Nature
287:198-203[Medline].
|
| 7.
|
de la Luna, S.,
I. Soria,
D. Pulido,
J. Ortin, and A. Jimenez.
1988.
Efficient transformation of mammalian cells with constructs containing a puromycin-resistance-marker.
Gene
62:121-126[Medline].
|
| 8.
|
Delviks, K.,
W.-S. Hu, and V. K. Pathak.
1997.
vectors: murine leukemia virus-based self-inactivating and self-activating retroviral vectors.
J. Virol.
71:6128-6224[Abstract].
|
| 9.
|
Destefano, J. J.,
R. G. Buiser,
L. M. Mallaber,
T. W. Meyers,
R. A. Bambara, and P. J. Fay.
1991.
Polymerization and RNase H activities of the reverse transcriptases from avian myeloblastosis, human immunodeficiency, and Moloney murine leukemia viruses are functionally uncoupled.
J. Biol. Chem.
266:7423-7431[Abstract/Free Full Text].
|
| 10.
|
Destefano, J. J.,
R. G. Buiser,
L. M. Mallaber,
R. A. Bambara, and P. J. Fay.
1991.
Human immunodeficiency virus reverse transcriptase displays a partially processive 3' to 5' endonuclease activity.
J. Biol. Chem.
266:24295-24301[Abstract/Free Full Text].
|
| 11.
|
Destefano, J. J.,
L. M. Mallaber,
P. J. Fay, and R. A. Bambara.
1993.
Determinants of the RNase H cleavage specificity of human immunodeficiency virus reverse transcriptase.
Nucleic Acids Res.
21:4330-4338[Abstract/Free Full Text].
|
| 12.
|
Dougherty, J. P., and H. M. Temin.
1988.
Determination of the rate of base-pair substitution and insertion mutations in retrovirus replication.
J. Virol.
62:2818-2822.
|
| 13.
|
Feinberg, A. P., and B. Volgelstein.
1983.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:6-13[Medline].
|
| 14.
|
Fu, T. B., and J. Taylor.
1992.
When retroviral reverse transcriptases reach the end of their RNA templates.
J. Virol.
66:4271-4278[Abstract/Free Full Text].
|
| 15.
|
Furfine, E. S., and J. E. Reardon.
1991.
Reverse transcriptase · RNase H from the human immunodeficiency virus.
J. Biol. Chem.
266:406-412[Abstract/Free Full Text].
|
| 16.
|
Garces, J., and R. Wittek.
1991.
Reverse-transcriptase-associated RNase H activity mediates template switching during reverse transcription in vitro.
Proc. R. Soc. Lond.
243:235-239.
[Medline] |
| 17.
|
Gilboa, E.,
S. W. Mitra,
S. Goff, and D. Baltimore.
1979.
A detailed model of reverse transcription and tests of crucial aspects.
Cell
18:93-100[Medline].
|
| 18.
|
Gopalakrishnan, V.,
J. A. Peliska, and S. J. Benkovic.
1992.
Human immunodeficiency virus type 1 reverse transcriptase: spatial and temporal relationship between the polymerase and RNase H activities.
Proc. Natl. Acad. Sci. USA
89:10763-10767[Abstract/Free Full Text].
|
| 19.
|
Higuchi, R.
1989.
Simple and rapid preparation of samples for PCR, p. 31-38.
In
H. A. Erlich (ed.), PCR technology; principles and applications for DNA amplification. Stockton Press, New York, N.Y.
|
| 20.
|
Hu, W.-S., and H. M. Temin.
1990.
Genetic consequences of packaging two RNA genomes in one retroviral particle: pseudodiploidy and high rate of genetic recombination.
Proc. Natl. Acad. Sci. USA
87:1556-1560[Abstract/Free Full Text].
|
| 21.
|
Hu, W.-S.,
E. H. Bowman,
K. Delviks, and V. K. Pathak.
1997.
Homologous recombination occurs in a distinct retroviral subpopulation and exhibits high negative interference.
J. Virol.
71:6028-6036[Abstract].
|
| 22.
|
Hughes, S., and E. Kosik.
1984.
Mutagenesis of the region between env and src of the SR-A strain of Rous sarcoma virus for purpose of constructing helper and independent vectors.
Virology
136:89-99[Medline].
|
| 23.
|
Julias, J. G.,
D. Hash, and V. K. Pathak.
1995.
E vectors: Development of novel self-inactivating and self-activating retroviral vectors for safer gene therapy.
J. Virol.
69:6839-6846[Abstract].
|
| 24.
|
Kawai, S., and M. Nishizawa.
1984.
New procedures for DNA transfection with polycation and dimethyl sulfoxide.
Mol. Cell. Biol.
4:1172-1174[Abstract/Free Full Text].
|
| 25.
|
Kim, T.,
R. A. Mudry, Jr.,
C. A. Rexrode II, and V. K. Pathak.
1996.
Retroviral mutation rates and A-to-G hypermutations during different stages of retroviral replication.
J. Virol.
70:7594-7602[Abstract].
|
| 26.
|
Luo, G., and J. Taylor.
1990.
Template switching by reverse transcriptase during DNA synthesis.
J. Virol.
64:4321-4328[Abstract/Free Full Text].
|
| 27.
|
Mansky, L. M., and H. M. Temin.
1994.
Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase.
J. Virol.
69:5087-5094[Abstract].
|
| 28.
|
Mansky, L. M., and H. M. Temin.
1995.
Lower mutation rate of bovine leukemia virus relative to that of spleen necrosis virus.
J. Virol.
68:494-499[Abstract/Free Full Text].
|
| 29.
|
Omer, C. A.,
K. Pogue-Geile,
R. Guntaka,
K. A. Stakus, and A. J. Faras.
1983.
Involvement of directly repeated sequences in the generation of deletions of the avian sarcoma virus src gene.
J. Virol.
47:380-382[Abstract/Free Full Text].
|
| 30.
|
Pathak, V. K., and H. M. Temin.
1990.
Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: substitutions, frameshifts, and hypermutations.
Proc. Natl. Acad. Sci. USA
87:6019-6023[Abstract/Free Full Text].
|
| 31.
|
Pathak, V. K., and H. M. Temin.
1990.
Broad spectrum of in vivo forward mutations, hypermutations, and mutational hotspots in a retroviral shuttle vector after a single replication cycle: deletions and deletions with insertions.
Proc. Natl. Acad. Sci. USA
87:6024-6028[Abstract/Free Full Text].
|
| 32.
|
Pulsinelli, G. A., and H. M. Temin.
1994.
High rate of mismatch extension during reverse transcription in a single round of retrovirus replication.
Proc. Natl. Acad. Sci. USA
91:9490-9494[Abstract/Free Full Text].
|
| 33.
|
Rhode, B. W.,
M. Emerman, and H. M. Temin.
1987.
Instability of large direct repeats in retrovirus vectors.
J. Virol.
61:925-927[Abstract/Free Full Text].
|
| 34.
|
Riggs, J. L.,
R. M. McAllister, and E. H. Lennette.
1974.
Immunofluorescent studies of RD-114 virus replication in cell culture.
J. Gen. Virol.
25:21-29[Abstract/Free Full Text].
|
| 35.
|
Saiki, R. K.,
D. H. Gelfand,
S. Stoffel,
S. J. Scharf,
R. Higuchi,
G. T. Horn,
K. B. Mullis, and H. A. Erlich.
1988.
Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase.
Science
239:487-491[Abstract/Free Full Text].
|
| 36.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
In
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 37.
|
Schatz, O.,
J. Mous, and S. F. J. Le Grice.
1990.
HIV-1 RT-associated ribonuclease H displays both endonuclease and 3' 5' exonuclease activity.
EMBO J.
9:1171-1176[Medline].
|
| 38.
|
Schultz, S. J.,
S. H. Whiting, and J. J. Champoux.
1995.
Cleavage specificities of Moloney murine leukemia virus RNase H implicated in the second strand transfer during reverse transcription.
J. Biol. Chem.
270:24135-24145[Abstract/Free Full Text].
|
| 39.
|
Telesnitsky, A., and S. P. Goff.
1993.
Two defective forms of reverse transcriptase can complement to restore retroviral infectivity.
EMBO J.
12:4433-4438[Medline].
|
| 40.
|
Temin, H. M., and S. Mizutani.
1970.
RNA-dependent DNA polymerase in virions of Rous sarcoma virus.
Nature
226:1211-1213[Medline].
|
| 41.
|
Temin, H. M.
1976.
The DNA provirus hypothesis: the establishment and implications of RNA-directed DNA synthesis.
Science
192:1075-1080[Abstract/Free Full Text].
|
| 42.
|
Temin, H. M.
1993.
Retrovirus variation and reverse transcription: abnormal strand transfers result in retrovirus genetic variation.
Proc. Natl. Acad. Sci. USA
90:6900-6903[Abstract/Free Full Text].
|
| 43.
|
Tikhonenko, A. T., and M. Linial.
1993.
Transforming variants of the avian myc-containing retrovirus FH3 arise prior to phenotypic selection.
J. Virol.
67:3635-3638[Abstract/Free Full Text].
|
| 44.
|
Umar, A.,
J. C. Boyer, and T. A. Kunkel.
1994.
DNA loop repair by human cell extract.
Science
266:814-816[Abstract/Free Full Text].
|
| 45.
|
Vara, J.,
A. Portela,
J. Ortin, and A. Jimenez.
1986.
Expression in mammalian cells of a gene from Streptomyces alboniger conferring puromycin resistance.
Nucleic Acids Res.
14:4617-4624[Abstract/Free Full Text].
|
| 46.
|
Watanabe, S., and H. M. Temin.
1983.
Construction of a helper cell line for avian reticuloendotheliosis virus cloning vectors.
Mol. Cell. Biol.
3:2241[Abstract/Free Full Text].
|
| 47.
|
White, R. L., and M. S. Fox.
1974.
On the molecular basis of high negative interference.
Proc. Natl. Acad. Sci. USA
71:1544-1548[Abstract/Free Full Text].
|
| 48.
|
Wohrl, B. M., and K. Moelling.
1990.
Interaction of HIV-1 ribonuclease H with polypurine tract containing RNA-DNA hybrids.
Biochemistry
29:10141-10147[Medline].
|
| 49.
|
Zhang, J., and H. M. Temin.
1993.
Rate and mechanism of nonhomologous recombination during a single cycle of retroviral replication.
Science
259:234-238[Abstract/Free Full Text].
|
J Virol, June 1998, p. 5198-5206, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
McWilliams, M. J., Julias, J. G., Hughes, S. H.
(2008). Mutations in the Human Immunodeficiency Virus Type 1 Polypurine Tract (PPT) Reduce the Rate of PPT Cleavage and Plus-Strand DNA Synthesis. J. Virol.
82: 5104-5108
[Abstract]
[Full Text]
-
Miles, L. R., Agresta, B. E., Khan, M. B., Tang, S., Levin, J. G., Powell, M. D.
(2005). Effect of Polypurine Tract (PPT) Mutations on Human Immunodeficiency Virus Type 1 Replication: a Virus with a Completely Randomized PPT Retains Low Infectivity. J. Virol.
79: 6859-6867
[Abstract]
[Full Text]
-
Li, T., Zhang, J.
(2002). Intramolecular Recombinations of Moloney Murine Leukemia Virus Occur during Minus-Strand DNA Synthesis. J. Virol.
76: 9614-9623
[Abstract]
[Full Text]
-
Takahashi, K., Okada, N.
(2002). Mosaic Structure and Retropositional Dynamics During Evolution of Subfamilies of Short Interspersed Elements in African Cichlids. Mol Biol Evol
19: 1303-1312
[Abstract]
[Full Text]
-
Hwang, C. K., Svarovskaia, E. S., Pathak, V. K.
(2001). Dynamic copy choice: Steady state between murine leukemia virus polymerase and polymerase-dependent RNase H activity determines frequency of in vivo template switching. Proc. Natl. Acad. Sci. USA
10.1073/pnas.221289898v1
[Abstract]
[Full Text]
-
Mansky, L. M.
(2001). Sorting Out Mutations in Human T-Cell Leukemia Virus Type 1 Proviruses During In Vivo Clonal Expansion. JNCI J Natl Cancer Inst
93: 336-337
[Full Text]
-
Hu, W.-S., Pathak, V. K.
(2000). Design of Retroviral Vectors and Helper Cells for Gene Therapy. Pharmacol. Rev.
52: 493-512
[Abstract]
[Full Text]
-
Svarovskaia, E. S., Delviks, K. A., Hwang, C. K., Pathak, V. K.
(2000). Structural Determinants of Murine Leukemia Virus Reverse Transcriptase That Affect the Frequency of Template Switching. J. Virol.
74: 7171-7178
[Abstract]
[Full Text]
-
Delviks, K. A., Pathak, V. K.
(1999). Effect of Distance between Homologous Sequences and 3' Homology on the Frequency of Retroviral Reverse Transcriptase Template Switching. J. Virol.
73: 7923-7932
[Abstract]
[Full Text]
-
Pfeiffer, J. K., Topping, R. S., Shin, N.-H., Telesnitsky, A.
(1999). Altering the Intracellular Environment Increases the Frequency of Tandem Repeat Deletion during Moloney Murine Leukemia Virus Reverse Transcription. J. Virol.
73: 8441-8447
[Abstract]
[Full Text]
-
Delviks, K. A., Pathak, V. K.
(1999). Development of Murine Leukemia Virus-Based Self-Activating Vectors That Efficiently Delete the Selectable Drug Resistance Gene during Reverse Transcription. J. Virol.
73: 8837-8842
[Abstract]
[Full Text]
-
Robson, N. D., Telesnitsky, A.
(1999). Effects of 3' Untranslated Region Mutations on Plus-Strand Priming during Moloney Murine Leukemia Virus Replication. J. Virol.
73: 948-957
[Abstract]
[Full Text]
-
Hwang, C. K., Svarovskaia, E. S., Pathak, V. K.
(2001). Dynamic copy choice: Steady state between murine leukemia virus polymerase and polymerase-dependent RNase H activity determines frequency of in vivo template switching. Proc. Natl. Acad. Sci. USA
98: 12209-12214
[Abstract]
[Full Text]