Previous Article | Next Article 
J Virol, June 1998, p. 5146-5153, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Alphavirus-Specific Cytotoxic T Lymphocytes
Recognize a Cross-Reactive Epitope from the Capsid Protein and Can
Eliminate Virus from Persistently Infected Macrophages
May La
Linn,
L.
Mateo,
J.
Gardner, and
A.
Suhrbier*
Queensland Institute of Medical Research,
Brisbane, Queensland, Australia
Received 1 December 1997/Accepted 24 February 1998
 |
ABSTRACT |
Persistent alphavirus infections in synovial and neural tissues are
believed to be associated with chronic arthritis and encephalitis, respectively, and represent likely targets for CD8+ 
cytotoxic T lymphocytes (CTL). Here we show that the capsid protein is
a dominant target for alphavirus-specific CTL in BALB/c mice and that
capsid-specific CTL from these mice recognize an H-2Kd restricted epitope, QYSGGRFTI. This
epitope lies in the highly conserved region of the capsid protein, and
QYSGGRFTI-specific CTL were cross reactive across a range of Old World
alphaviruses. In vivo the acute primary viraemia of these highly
cytopathic viruses was unaffected by QYSGGRFTI-specific CTL. However,
in vitro these CTL were able to completely clear virus from macrophages persistently and productively infected with the arthrogenic alphavirus Ross River virus.
| |
INTRODUCTION |
Alphaviruses (family
Togaviridae) are a group of arthropod-borne, positive-strand
RNA viruses found throughout the New and Old Worlds. Several
alphaviruses are pathogenic in humans (27), with Old World
alphaviruses, which include Ross River (RR) virus (17),
Chikungunya virus (7, 31), o'nyong-nyong virus (2, 58), Sindbis virus, and Okelbo virus (65), being
principally associated with fever and acute and chronic
arthritis/arthralgia. Infection with New World alphaviruses, which
include the eastern, Venezuelan, and western equine encephalitis
viruses, can result in severe and often fatal acute encephalitis
(12, 68). The encephalitis viruses and Getah virus are also
important pathogens of horses and wildlife (10, 30).
Following a primary alphavirus infection, there is a transient viremia
which lasts for several days (57, 61), with viral clearance
believed to be mediated principally by antibodies (70) and
alpha/beta interferon (IFN-) (25). Development of
murine CD8 cytotoxic T-lymphocyte (CTL) activity correlates with viral clearance from the peripheral blood (5, 54). However, CTL are believed not to be important mediators of protection against acute
viremia in alphavirus or other cytopathic viral infections (29). Neutralizing antibodies may play the dominant role in resolving acute togavirus viremias, but there are several reports which
suggest that they are unable to clear residual persistent togavirus
infections (i) from humans infected with rubella and suffering from
arthritis and late-onset rubella syndrome (9, 66); (ii) from
mouse brains infected with Bebaru virus, Sindbis virus, or Semliki
Forest virus (3, 23, 37); (iii) from birds infected with
Western encephalitis virus (56); and (iv) from macrophages
infected with RR virus in vitro (41). Residual alphavirus
infections persisting in certain tissue sites after the initial viremia
has abated not only are likely to be important for mediating pathologic
changes but also may become targets for CTL (23, 53, 62).
The potential role and mechanisms used by CTL in the clearance of
cytopathic viruses remain largely unresolved.
Murine Semliki Forest virus and Sindbis virus infections have been
extensively studied as models of viral encephalitis. Both viruses are
capable of persisting in vivo (4, 37), and CTL-mediated lysis of persistently infected neural tissues results in
neuropathologic changes in the Semliki Forest virus model
(62). RR virus, the etiological agent of epidemic
polyarthritis (EPA), an acute and chronic disease (17) which
affects up to 7,800 Australians annually (11), has also been
shown to persist in vitro in muscle cells (14), fibroblasts
(28), and macrophages (40). Although, persistence
of RR virus in EPA patients has yet to be demonstrated, persistent
infections are believed to be responsible for the pathogenesis of many
chronic infectious arthritides (9, 34, 48, 52), with many
arthrogenic organisms (including RR virus) (40) capable of
persisting in macrophages (16, 24, 26, 49, 50, 59). Ineffectual clearance of persistent virus by poor or impaired CTL
activity has been associated with the pathologic changes caused by a
number of organisms including caprine arthritis virus (38), measles virus (51, 67), and rubella virus (66).
CTL activity has also been associated with pathogen clearance and
recovery in Lyme arthritis (8) and prevention of persistence
in Theiler's virus infections (13). Interestingly, the
predominance of CD4 lymphocytes in the mononuclear synovial effusions
of chronic EPA patients contrasts with the almost exclusive
CD8+ lymphocyte infiltrate found in skin rashes of EPA
patients who made early and complete recoveries (18, 19).
These observations may suggest that the minority of individuals who
develop chronic disease following RR virus infection (17)
fail to generate RR virus-specific CTL and are unable to clear
persistent virus.
The presence of alphavirus-specific CTL have been reported to depend on
the presence of H-2Dk, with mice bearing other
alleles failing to generate significant CTL responses (45,
46). The targets of CTL activity may also be restricted to
sequences that are conserved between different alphaviruses, since
murine CTL raised against one alphavirus cross-react with other
serologically distinct alphaviruses (47, 54). Clearly, if
CTL are required for clearance of persistent alphavirus infections, an
HLA-restricted or otherwise restricted ability to generate alphavirus-specific CTL may have important implications for human pathogenesis.
The reported role of CTL in the pathogenesis of alphavirus
encephalitis (62) and the potential importance of CTL
in the clearance of persistent arthrogenic alphavirus
infections prompted a search for the target of
alphavirus-specific CTL. By using a new in vitro CTL restimulation
method, alphavirus-specific CTL were demonstrated in mice with both
H-2k and H-2d
backgrounds. The capsid protein emerged as the dominant target of these
CTL, and the target epitope was localized to the conserved region of
this protein. CTL specific for this epitope were cross-reactive and
were generated in mice infected with a panel of different Old World
alphaviruses. Although capsid-specific CTL induced by vaccination did
not affect the acute alphavirus viremia in vivo, these CTL were capable
of completely clearing a persistent productive RR virus infection from
macrophages in vitro.
| |
MATERIALS AND METHODS |
Alphaviruses and viral titer determinations.
Virus stocks
were prepared in tissue culture as described previously (40)
with Vero cells, except for Barmah Forest virus and RR virus (T48),
which were prepared with HeLa cells. Viral titers were determined by
using 10-fold serial dilutions in quadruplicate on Vero cells and were
expressed as log10 50% cell culture infectivity dose
(CCID50) (40). All virus stocks were determined
to be mycoplasma free (39). Semliki Forest virus was kindly
supplied by P. Hertzog (Monash University, Victoria, Australia), Barmah
Forest virus and Getah virus were supplied by B. Kay (Queensland
Institute of Medical Research), Sindbis virus was supplied by R. Hall
(University of Queensland, Queensland, Australia), and Chikungunya
virus was supplied by J. Aaskov (Queensland University of Technology).
Mice and viral infection.
Female 6- to 8-week-old C3H
(H-2k) and BALB/c (H-2d)
mice (Animal Resource Centre, Perth, Australia) were infected by
intraperitoneal injection with 300 CCID50 of each
alphavirus (except Sindbis virus, for which 600 CCID50 was
used) and/or 5 × 107 PFU of each recombinant vaccinia
virus (rVV), both diluted in 500 µl of phosphate-buffered saline.
Alphavirus viremias in all alphavirus-infected animals were confirmed
by CCID50 determination in blood taken by tail bleeds on
day 2 postinfection.
Generation of alphavirus-specific CTL effectors.
Briefly, RR
virus-specific effectors were generated by restimulating splenocytes in
vitro with RR virus-infected, 48-h thioglycolate-induced peritoneal
macrophages (effector-to-stimulator ratio, 
20:1) for 5 days, and the
effectors were used in standard 6-h 51Cr release assays
against the target cells listed below. The medium used throughout was
determined to be endotoxin free (<0.01 ng/ml) by the method of Sweet
and Hume (63) and contained bicarbonate-buffered RPMI 1640 (Gibco), 10% fetal calf serum (PA Biologicals), 2 mM glutamine
(Sigma), 10 mM HEPES (Sigma), 5 × 10
5 M
-mercaptoethanol (Sigma), 100 µg of streptomycin per ml, and 100 IU of penicillin per ml (CSL Australia). The thioglycolate-induced peritoneal macrophages were seeded at 4 × 105/24-well
plate in serum-free RPMI 1640, and the nonadherent cells were removed
after 6 h at 37°C. After a 48-h culture in medium, nonadherent
cells were again removed by two washes and the remaining cells were
infected with RR virus at a multiplicity of infection (MOI) of 2 for
2 h followed by the addition of splenocytes (5 × 106/24-well plate). (Fresh adherent murine splenocytes or
thioglycolate-elicited macrophages, or the same cells cultured for 1 day, were inefficiently infected by RR virus, as determined by an
indirect fluorescent-antibody assay (IFA) 24 h postinfection, and
failed to restimulate CTL. In contrast, after 2 days in culture, 5
to 10% of thioglycolate-elicited macrophages could be infected with RR
virus [data not shown].)
QYSGGRFTI-specific effectors were generated by adding 2 µg of
QYSGGRFTI (Chiron Mimotopes, Melbourne, Australia) per ml
to splenocytes (5 × 105/24-well plate) in 1 ml of
medium. Another 1 ml of medium was added on day 3, and the cells were
used as effectors in standard 6-h 51Cr release assays on
day 5.
A CTL line specific for QYSGGRFTI was developed from QYSGGRFTI-specific
effectors and maintained by weekly restimulation with
QYSGGRFTI-sensitized (2 µg/ml for 1 h at 37°C),
-irradiated
(8,000
rads), and washed P815 cells (effector-to-stimulator ratio, ca.
30:1). A control BALB/c murine cytomegalovirus-specific CTL line
recognizing YPHFMPTNL (
60) (kindly supplied by S. Elliott
[Queensland
Institute of Medical Research]) was maintained in the
same way.
Both T-cell lines were maintained in T-cell medium, which is
the
medium described above supplemented with 1 mM pyruvate (ICN,
Irvine,
Calif.), 1% nonessential amino acid (ICN), and 20 U of
recombinant
interleukin-2 IL-2 (kindly provided by Cetus Corp.,
Emeryville,
Calif.).
Preparation of target cells. (i) RR virus-infected
cells.
L929 (H-2k) and BALB/c 3T3
(H-2d) fibroblasts (CSL) and RAW264.7 cells were
cultured in endotoxin-free medium. Cells were scraped or aspirated from
tissue culture flasks, pipetted to disperse cell clumps, and pelleted
by centrifugation (170 × g for 5 min). The pelleted cells
were infected with RR virus (MOI = 10) for 1 h,
51Cr was added for a further 1 h at 37°C in 100
µl of medium, and the mixture was washed twice in medium. Infection
of macrophages and fibroblast lines with RR virus was strongly
inhibited by endotoxin contamination in the medium and trypsin
preparations (data not shown).
(ii) Peptide-sensitized target cells.
P815 cells and
RAW264.7 cells were sensitized with synthetic QYSGGRFTI peptide (10 µg/ml) (Chiron Mimotopes, Melbourne, Australia) for 1 h at
37°C prior to 51Cr labelling for 1 h and washed
twice. The target cells used for the 20-mer peptide net were
51Cr-labelled P815 target cells incubated in 96-round-well
plates with each 20-mer peptide (50 µg/ml) for 2 h at 37°C in
50 µl followed by the addition of effectors in 150 µl.
(iii) VV-infected target cells.
P815 cells were infected
with rVV (MOI = 10) overnight prior to 51Cr labelling
and washing.
Construction of rVV coding for the nonstructural proteins and
capsid.
rVV were constructed against each cytoplasmic alphavirus
protein, the capsid, and the four nonstructural proteins (NSP). cDNA was prepared from 4 × 106 NB5092 RR virus
(15)-infected Vero cells 8 h postinfection (MOI = 2). RNA was extracted with the total RNA isolation reagent (Advanced
Technologies, London, United Kingdom) as specified by the manufacturer.
The RNA was reverse transcribed at room temperature for 20 min and then
at 40°C for 1 h in a 20-µl reaction mixture containing 1 µg
of RNA, 1 µg of random hexamer primers (Boehringer, Mannheim,
Germany), 1 µl of 10 mM deoxynucleoside triphosphates (Promega,
Madison, Wis.), and the following from the Superscript II RT kit (Gibco
BRL, Gaithersburg, Md.): 4 µl of 5× first-strand buffer, 2 µl of
0.1 M dithiothreitol, and 1 µl of reverse transcriptase. Following
hydrolysis of the RNA with 6 N NaOH, the cDNA was purified by
QIAquick-spin PCR purification (Qiagen, Hilden, Germany) and eluted in
50 µl. PCR was performed in a 20-µl reaction volume containing 1 µl of cDNA and 1 µl of each forward and reverse primer (10 µM)
(listed below). Each PCR mixture contained 0.4 µl (2 U/µl) of
DyNAZyme II DNA polymerase (Finnzymes Oy, Espoo, Finland), 2 µl of
10× PCR buffer II (Finnzymes), and 0.5 µl of deoxynucleoside triphosphates. PCR was performed with a GeneAmp PCR system 9600 with a
5-min denaturation at 95°C followed by 30 cycles of 94°C for
45 s (denaturation) and a 10-min final extension with the following annealing and extension times each protein: capsid, 52°C
for 45 s and 72°C for 60 s; NSP1, 55°C for 45 s and
72°C for 90 s; NSP2, 60°C for 45 s and 72°C for 3 min;
NSP3, 58°C for 45 s and 72°C for 90 s; NSP4, 55°C for
45 s and 72°C for 90 s.
The primers used contained an ATA cap, a
BamHI restriction
site (replaced with a
HindIII site for NSP3), and a
start codon
before 18 to 20 bp of coding sequence for each protein. The
reverse
primers contained 16 to 20 bp of coding sequence followed by a
stop codon, a
SalI site (replaced with an
EcoRI
site for NSP2
and NSP3), and an ATA cap. The primer sequences used were
ATAGGATCCATGAAGGTCACTGTAGATGTTG,
NSP1 (forward);
ATAGTCGACCTATGCTCCGGCGCGGTACGTCA, NSP1 (reverse);
ATAGGATCCATGGGGGTAGTGGAGACACCCAG, NSP2 (forward);
ATAGAATTCCTAGCATCCGGCTGTGTGTAGCC,
NSP2 (reverse);
ATAAAGCTTATGGCACCCTCATACCGTGTGCG, NSP3 (forward);
ATAGAATTCCTACGCCCCCGCTCTGCTTAGTC, NSP3 (reverse);
ATAGGATCCATGTACATCTTCTCGTCTGATAC,
NSP4 (forward);
ATAGTCGACCTATTTAGGACCGCCGTAG, NSP4 (reverse);
ATAGGATCCATGAATTACATACCAACCC, CAP (forward); and
ATAGTCGACCTACCACTCTTCGGTTCCTTC,
CAP (reverse). The PCR
products were resolved on a 1% agarose
gel, excised, and purified with
Wizard PCR Preps (Promega). NSP1,
NSP2, and NSP4 were cloned into
pGEM-T, and capsid and NSP3 were
blunt-end cloned into
EcoRV-cut Bluescript II KS+. Plasmids were
used to transform
SURE competent cells (Stratagene, La Jolla,
Calif.), clones were
subjected to minipreps by alkaline lysis,
and inserts were checked by
restriction digestion and confirmed
by PCR. After sequencing, the
correct clones were cut with
BamHI-
SalI
(for
NSP1, NSP4, and capsid),
BamHI-
EcoRI (for NSP 2),
or
HindIII-
EcoRI
(for NSP3) and cloned into
the VV shuttle vector PBCB06. The rVV
were then constructed as
described previously (
64). Expression
of the recombinant
NSPs by each rVV was demonstrated by Western
blot analysis on
rVV-infected BHK cells with polyclonal anti-NSP1,
anti-NSP2, anti-NSP3,
and anti-NSP4 sera raised against the related
proteins from Sindbis
virus (
32,
33) and kindly supplied by
T. Ahola (Institute of
Biotechnology, University of Helsinki,
Helsinki, Finland). Expression
of the capsid by rVV was similarly
demonstrated with polyclonal anti-RR
virus sera (kindly supplied
by J. Aaskov and was reactive against all
the structural proteins
(data not shown). The rVV coding for ovalbumin
was kindly supplied
by F. Carbone (Monash Medical School, Melbourne,
Australia).
Synthetic peptide immunization.
Peptide immunization was
performed as described previously (60). Briefly, mice
received a single subcutaneous injection of 10 µg of QYSGGRFTI and
0.25 µg of tetanus toxoid formulated as a water-in-oil emulsion with
the adjuvant Montanide ISA 720 (SEPPIC, Paris, France).
Coculture of CTL lines and persistently infected
macrophages.
RAW264.7 cells persistently and productively infected
with RR virus T48 (RAW/RRv-PER) have been described previously
(40, 41) and were maintained in endotoxin-free medium
without mercaptoethanol. This persistent culture, like many other
persistent productive cytopathic infections in vitro (41),
relied on autocrine IFN- to limit viral replication and thereby
prevent overt cytopathic effect of the entire culture. A complete
change of medium of RAW/RRv-PER cells removed the autocrine IFN-
and resulted in 100% of the cells becoming productively infected and
being killed by the virus. A 50% medium change avoided this problem
(data not shown); thus, the medium used to establish the coculture
experiments always contained 50% of the 3- to 5-day tissue culture
supernatants from RAW/RRv-PER cells. This IFN- rich conditioned
medium was UV irradiated (40) to remove viable RR virus. To
set up the coculture RAW/RRv-PER cells were first washed three times to
remove free RR virus and were resuspended in the UV-irradiated
conditioned medium. At the time of the experiment, 5% of these
cells were positive for RR virus by immunofluorescence (see Fig. 8A).
The washed RAW/RRv-PER cells were then placed into six replicate wells in a 96-flat-well plate (105 cells/well in 100 µl of
conditioned medium) with either (i) the QYSGGRFTI-specific CTL line or
(ii) the control CTL line (both at 2 × 105 cells/well
in 100 µl of T-cell medium) or (iii) 100 µl of T-cell medium alone.
Supernatants (100 µl) were collected at the indicated time points and
replaced with 50% UV-irradiated conditioned medium-50% T-cell
medium. The viral titers in these supernatants were determined by a
CCID50 assay with Vero cells.
Indirect immunofluorescence was performed as described previously
(
40) with a rabbit polyclonal anti-RR virus antibody (a
kind
gift from J. Aaskov).
| |
RESULTS |
RR virus-specific CTL are generated in both
H-2d and H-2k
mice.
Previous reports have suggested that the CTL response
to alphaviruses was restricted to H-2k
mice (45, 46). To determine whether the ability to
generate alphavirus-specific CTL was major histocompatibility complex
(MHC) restricted, BALB/c (H-2d) and
C3H/HeJ (H-2k) mice were infected with RR virus
and their splenocytes were restimulated in vitro with autologous RR
virus-infected, thioglycolate-elicited macrophages. These macrophages
were first cultured for 2 days, and then 5 to 10% of them could be
infected with RR virus. Effectors from C3H/HeJ
(H-2k) mice were capable of specifically killing
RR virus-infected H-2k but not
H-2d target cells, and effectors from BALB/c
(H-2d) mice killed RR virus-infected
H-2d but not H-2k targets
(Fig. 1). Thus by using the new
restimulation method, MHC-restricted CTL activity specific for RR virus
was demonstrated in both C3H/HeJ and BALB/c mice.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Lysis of RR virus-infected cells by effectors from RR
virus-infected mice. C3H (H-2k) mice
(n = 4) and BALB/c (H-2d) mice
(n = 4) were infected with RR virus. After 35 days,
splenocytes from each strain of mice were separately pooled and
restimulated in vitro with RR virus-infected, autologous 48-h
thioglycolate-elicited peritoneal macrophages. The resulting effectors
were used against both uninfected and RR virus-infected 3T3 fibroblasts
(H-2d; solid squares) and L929 target cells
(H-2k; open squares). % RR virus specific lysis
refers to the percent lysis obtained from RR virus-infected targets
minus the percent lysis obtained from uninfected targets. E:T ratio,
effector-to-target ratio.
|
|
Significant nonspecific cytotoxic activity was observed when
restimulated splenocytes from mice sacrificed within the first
few
weeks postinfection were used (data not shown). The efficient
lysis of
YAC 1 cells by these effectors (data not shown) indicated
that this
activity was largely due to NK cells, consistent with
previous reports
(
1). Specific MHC-restricted CTL activity
was more clearly
apparent when splenocytes were taken at day 35
postinfection (Fig.
1).
The capsid protein was the dominant target of RR virus-specific
CTL.
To determine the target antigen of RR virus-specific CTL, rVV
coding for each of the cytoplasmic RR antigens (NSP1 through NSP4 and
capsid) were constructed. Separate groups of mice were immunized with
each rVV plus a control rVV coding for ovalbumin (rVV.ovalbumin). After
6 weeks, all the mice were infected with RR virus and their viremias
were monitored daily by tail bleeds. There was no significant
difference in the level or longevity of RR virus viremias between (i)
mice immunized with any of the rVV constructs expressing RR virus
antigens and (ii) control animals, which had received no previous rVV
or the control rVV.ovalbumin (data not shown).
Splenocytes from all animals, which were immunized with each rVV and
then RR virus, were restimulated in vitro with RR virus-infected
macrophages and used as effectors against autologous target cells
infected with the immunizing rVV. Figure
2 clearly illustrates
that the capsid
protein, but not the NSPs, represented a major
target for RR
virus-specific CTL.
View larger version (18K):
[in this window]
[in a new window]
|
FIG. 2.
The capsid protein is the dominant target for
RR-specific CTL. BALB/c mice (n = 2) were infected
separately with rVV coding for NSP1, NSP2, NSP3, NSP4, capsid, and
ovalbumin (CONTROL). Six weeks later, all the mice were infected with
RR virus, and 14 days later splenocytes from each pair of mice were
pooled and restimulated in vitro as for Fig. 1. The resulting effectors
were used against uninfected P815 cells and P815 cells infected with
the same rVV with which the mice were first infected. Thus, the capsid
lysis values were obtained with rVV.capsid-infected target cells and
effectors from mice which were infected first with rVV.capsid and then
RR virus. This protocol was designed to boost in vivo any RR
virus-specific CTL generated by the rVVs, prior to further RR
virus-specific restimulation in vitro (see Fig. 4B). [Effectors
generated from animals infected with RRV alone failed to show
convincing lysis of any of the rVVs (data not shown).] % Specific
lysis refers to percent lysis of rVV-infected P815 cells minus percent
lysis of uninfected P815 cells (lysis values for the latter did not
exceed 5%). E:T ratio, effector-to-target ratio.
|
|
Definition of the capsid protein epitope recognized by RR
virus-specific CTL.
To further define the target of the
capsid-specific CTL demonstrated in Fig. 2, CTL raised in the same way
were used against target cells sensitized with an overlapping peptide
set representing the sequence of capsid protein of RR virus. A single
peptide emerged as the dominant target of the CTL (Fig.
3). This 20-mer peptide contained a
9-mer, QYSGGRFTI, which conformed to
the MHC motif of H-2Kd (anchor residues
underlined). No other sequences within this peptide conformed to the
H-2Kd, H-2Dd, or
H-2Ld binding motifs (55).
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Localization of the capsid epitope with an overlapping
peptide set. Capsid-specific effectors generated as described for Fig.
2 were used against an overlapping peptide set of the capsid protein
(20-mers overlapping by 10). Initially an effector-to-target ratio of
30:1 in duplicate was used, and all peptides giving a lysis value above
2.5% were retested the next day at an effector-to-target ratio of
100:1. The underlined sequence represents a potential epitope that
would conform to the H-2Kd binding motif.
|
|
To confirm that QYSGGRFTI represented the epitope recognized by RR
virus-specific CTL, splenocytes from RR virus-infected
mice were
restimulated in vitro with synthetic QYSGGRFTI peptide
and the effectors were used against (i)
QYSGGRFTI-sensitized target
cells, (ii) target cells
infected with RR virus, and (iii) rVV
virus coding for the capsid
protein (rVV.capsid). Splenocyte effectors
from RR virus-infected mice
showed high levels of specific activity
against QYSGGRFTIsensitized and
rVV.capsid-infected target cells
(Fig.
4A). This activity was enhanced when mice
were first infected
with rVV.capsid and 4 weeks later with RR virus
(Fig.
4B), illustrating
that RR virus infection boosted a
QYSGGRFTI-specific response
induced by rVV.capsid. A CTL line generated
by weekly restimulations
with peptide-sensitized irradiated P815
cells showed very high
killing of peptide, RR virus, and capsid target
cells (Fig.
4C).
This line was >95% CD8
+
CD4
CD3
+ by fluorescence-activated cell
sorting (data not shown).
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 4.
Confirmation of QYSGGRFTI as the target of RR
virus-specific CTL. Splenocytes were restimulated in vitro with 2 µg
of QYSGGRFTI per ml and were used as effectors against
QYSGGRFTI-sensitized (solid triangles), RR virus-infected (solid
circles), rVV.capsid-infected (solid squares), and control (open
circles and open squares) target cells. Effector cells were
restimulated splenocytes from mice infected with RR virus 14 days
previously (A), restimulated splenocytes from mice infected with
rVV.capsid and 4 weeks later with RR virus and sacrificed 14 days
thereafter (B), or a CTL line generated by weekly restimulations of the
cells in panel A with peptide-sensitized irradiated P815 cells (C). E:T
ratio, effector-to-target ratio.
|
|
Lysis of RAW264 cells infected with RR virus was always lower than that
of peptide-sensitized or rVV.capsid-infected targets
(Fig.
4A and B)
but became highly significant when the CTL line
was used as an effector
(Fig.
4C). These lower lysis values for
RR virus-infected RAW264 can be
explained in part by the fact
that only
60% of RAW264 cells can be
infected with RR virus (as
determined by IFA) whereas
100% of P815
cells were infected by
the VV (data not shown) and a similar percentage
of cells would
be sensitized with peptide. In addition, the lower lysis
levels
for peptide-sensitized RAW264 than for peptide-sensitized P815
(Fig.
5) suggest that the macrophage line
may also be generally
less susceptible to CTL lysis.
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
QYSGGRFTI represents a cross-reactive epitope recognized
by CTL from mice infected with different alphaviruses. Mice (BALB/c,
n = 3) were infected with each alphavirus (SF, Semliki
Forest virus; CHIK, Chikungunya virus; GET, Getah virus; SIN, Sindbis
virus; BF, Barmah Forest virus). After 14 days, splenocytes were
restimulated with peptide as for Fig. 4 and used against
QYSGGRFTI-sensitized (solid squares and solid triangles), RR
virus-infected (solid circles), and control (open squares and open
circles) target cells. E:T ratio, effector-to-target ratio.
|
|
These experiments confirmed that QYSGGRFTI was an epitope from the
capsid protein recognized by RR virus-specific CTL.
QYSGGRFTI represented a cross-reactive CTL epitope.
Previous
reports have demonstrated that CTL from alphaviruses cross-react
(47, 54). To determine whether QYSGGRFTI
represented a cross-reactive alphavirus CTL epitope, BALB/c mice were
infected with a panel of alphaviruses. Splenocytes harvested from these animals were restimulated in vitro with QYSGGRFTI peptide and were used
as effectors against peptide-sensitized and RR virus-infected target
cells. (Peptide restimulation generated a much lower level of NK
activity in vitro; thus, splenocytes from animals infected for 12 to 14 days, rather than 35 days, could be used for these experiments [data
not shown]). For all the alphaviruses tested, except Barmah Forest
virus, infected animals produced CTL specific for QYSGGRFTI. In
addition, QYSGGRFTI-specific CTL from animals infected with the
different alphaviruses were capable of killing RR virus-infected cells,
illustrating that they were cross-reactive (Fig. 5). The Barmah Forest
virus capsid protein contains two substitutions in this epitope region
(Table 1), which is likely to explain the
lack of recognition of QYSGGRFTI.
These experiments demonstrated that CTL specific for QYSGGRFTI were
generated in BALB/c mice infected with a number of different
alphaviruses, illustrating that this epitope was broadly cross-reactive
across serologically distinct alphaviruses.
CTL specific for QYSGGRFTI or capsid did not affect RR virus acute
viremia.
CTL are believed not to mediate protection against an
acute alphavirus infection (3, 29). To test this contention
directly, mice (n = 5) were immunized with (i)
rVV.capsid or (ii) a peptide formulation comprising synthetic QYSGGRFTI
peptide and tetanus toxoid emulsified in Montanide ISA 720, a
water-in-oil formulation which has been shown previously to induce
protective CTL (60). Both peptide- and rVV.capsid-immunized
animals produced significant levels of QYSGGRFTI-specific CTL (data not
shown), but when they were challenged with RR virus, no significant
change in the course or magnitude of the viremia could be demonstrated
(Fig. 6). (rVV.capsid-immunized animals
developed only very weak antibody responses against capsid [data not
shown]). These experiments suggest that capsid-specific CD8 CTL did
not mediate significant protective activity against an acute alphavirus
viremia in mice.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 6.
CTL specific for QYSGGRFTI or capsid do not affect
acute alphavirus viremia. Mice (BALB/c, n = 6) were
immunized with rVV.capsid (rVV.CAPSID) or rVV.ovalbumin
(rVV.CONTROL) or a synthetic peptide vaccine formulation containing
QYSGGRFTI and tetanus toxoid emulsified in Montanide ISA 720 (QYSGGRFTI/TT/M720) or the same formulation without peptide (CONTROL).
Three weeks later, the animals were challenged with RR virus. Viremia
was monitored by titer determination in blood samples taken by daily
tail bleeding.
|
|
QYSGGRFTI-specific CTL could clear RR virus from macrophage
cultures.
We have previously shown that RR virus can establish a
persistent productive infection in the macrophage line RAW264.7
and have postulated that these cultures (RAW/RRv-PER)
represent an in vitro model of the behavior of RR virus in the
arthritic joints of patients with chronic EPA (40, 41).
These persistent cultures are similar to many persistent cytopathic
viral infections in vitro (20). The cultures contained a
small fluctuating percentage of cells continuously undergoing
cytopathic infection, and the production of autocrine IFN-
protected the majority of cells from CPE (reference
20 and data not shown). To determine whether QYSGGRFTI-specific CTL could clear virus from RAW/RRv-PER cultures, the
QYSGGRFTI specific CTL line (Fig. 4C) was cocultured with RAW/RRv-PER
cells and the amount of virus produced in the supernatant was monitored
over time. A control CTL line and medium controls were set up in
parallel. At 15 days after the coculture was established, no more
infectious virus could be detected from any of the six replicate wells
containing QYSGGRFTI-specific CTL, whereas RR virus titers from medium
control cultures and RAW/RRv-PER-control CTL-line cocultures were
unaffected (Fig. 7).
View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
CTL specific for QYSGGRFTI can clear RR virus from
persistently and productively infected macrophages. The CTL line
specific for QYSGGRFTI (Fig. 4C) [CTL(QYSGGRFTI)] and a control cell
line specific for a murine cytomegalovirus epitope [CTL (CONTROL)]
and medium alone (MEDIUM) were separately cocultured with washed RAW264
macrophages persistently and productively infected with RR virus
(RAW/RRv-PER). Supernatants from these cocultures were taken at the
indicated time points and assayed for RR virus titers. *, No virus
was detected in supernatants taken from all six replicates of CTL
QYSGGRFTI plus RAW/RRv-PER on these days.
|
|
To further illustrate the removal of virus-infected cells from the
persistently infected RAW264 cultures by the
QYSGGRFTI-specific
CTL, IFA was performed on the
persistently infected cultures before
and 30 days after addition of the
CTL. About 5% of the RAW264
cells were IFA positive in the
persistently infected cultures;
however, 30 days after addition of the
QYSGGRFTI-specific CTL,
no IFA-positive cells could be found (Fig.
8).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 8.
Immunofluorescent antibody staining of persistently and
productively infected macrophages (RAW/RRv-PER) before (A) and 30 days
after (B) coculture with QYSGGRFTI-specific CTL. Approximately 250 RAW264 cells are present in each field. Bar, 100 µm.
|
|
This experiment illustrated that alphavirus-specific CTL were extremely
efficient at clearing the highly cytopathic alphavirus
RRV from these
persistent and productively infected macrophages.
| |
DISCUSSION |
This report identifies the capsid protein as a dominant target of
alphavirus-specific CTL, describes the first characterization of an
alphavirus-specific CD8 CTL epitope, and shows that an
alphavirus-specific CTL can clear a cytopathic infection from a
persistent and productively infected macrophage culture. The
alphavirus-specific CTL epitope identified here, QYSGGRFTI,
was H-2Kd restricted and localizes to the
conserved region of the capsid protein (6), a region
believed to be involved in binding to the surface glycoprotein E2
(35). The epitope sequence QYSGGRFTI was also conserved
across RR, Sindbis, Semliki Forest, Getah, and Chikungunya viruses
(Table 1), and this conservation correlated with the observed
cross-reactivity of CTL from mice infected with these viruses. The
conservation and cross-reactivity did not extend to Barmah Forest
virus, nor would it be expected to extend to the encephalitis viruses,
since all these viruses have one or more nonconservative substitutions
in the epitope region (Table 1). However, all the aligned capsid
sequences listed may nevertheless represent
H-2Kd-restricted CTL epitopes for each
respective alphavirus, since the anchor residues required for
H-2Kd binding (Y or F at position 2, and I, L,
or V at position 9) (55) are conserved in all the sequences.
Based on recent sequence analysis, alphaviruses have been partitioned
into two major evolutionary groups, which reflect their geographic
localization to the Old and New Worlds. The human clinical syndromes
caused by alphaviruses associate with these groupings, with Old World
viruses being principally associated with fever and polyarthritis and
New World viruses causing mainly encephalitis (27). The
cross-reactivity described in this paper is thus restricted to the Old
World arthrogenic alphaviruses.
The capsid protein was identified as a dominant target for class
I-restricted alphavirus-specific CTL. The capsid is also a dominant
target of rubella virus-specific CTL (42). The rubella virus, a Rubivirus, shares membership of
Togaviridae with alphaviruses based on similarities in their
genomic organization and replication strategies. CTL specific for the
alphavirus NSPs could not be demonstrated in this study but may exist
at low precursor frequency and/or in other mouse strains
(21). The very low level and restricted period of NSP
synthesis in alphavirus-infected cells (43, 69) may,
however, preclude these proteins from becoming significant targets of
CTL activity. In comparison, the capsid protein is synthesized in large
amounts throughout the infection period, with nucleocapsids even being
detectable by electron microscopy (36). In contrast, NSPs
are the dominant target of CTL in flavivirus infections (44)
but flavivirus NSPs are synthesized in readily detectable amounts
throughout the much longer infectious cycle of these notably less
cytopathic arboviruses (69). Whether the dominant target of
alphavirus-specific CTL in humans is the same as that seen in BALB/c
mice remains to be established. If the target of anti-alphavirus CTL
activity was confined to the capsid protein in humans, this might
restrict the ability of certain individuals to generate CTL, since the
capsid is a small (32-kDa) protein. The RNA binding half of this
protein may also contain fewer CTL epitopes, since this poorly
conserved region contains a high percentage of prolines and basic amino
acids (6) and fewer large hydrophobic residues, which are
often required as MHC anchor residues (55).
The rise and fall of a primary alphavirus viremia appears to be largely
unaffected in perforin and FasL knockout mice (29), suggesting that CTL lytic mediators do not play a significant role in
controlling these cytopathic viruses. The inability of rVV.capsid- and
peptide vaccine-induced alphavirus-specific CTL to significantly affect
the levels of virus in the blood during the primary infection adds to
this data, indicating that neither CTL lytic mediators nor CTL-derived
cytokines (5, 22) play a significant protective role at this
stage of an alphavirus infection. However, both the explosive nature of
the primary viremia and the insensitivity of measuring CTL activity
through blood viremia monitoring may contribute to this apparent lack
of CTL efficacy against RR virus. The cell in vitro which gives rise to
the RR viremia is not known, although many cell types might contribute and the infection is likely to spread to many tissues in the body (14, 19, 28, 40, 61, 62). Only a very substantial CTL number
might be able to kill the large number of cells (which would probably
be infected during the primary viremia) within the short period before
virus production begins within each cell. Even if the CTL activity was
able to kill or prevent virus production by 90% of these infected
cells, the blood viremia would only change by 1 log unit, an
insignificant change given the mouse-to-mouse variation (Fig. 6).
In contrast to the observations about CTL activity during the primary
viremia, the clear demonstration that QYSGGRFTI-specific CTL were
capable of completely clearing RR virus from persistently and
productively infected macrophage cultures suggests that CTL can be
extremely effective against RR virus infections. The mechanisms used by
the RR virus-specific CTL to clear the persistent infections from the
macrophage cultures have not been characterized but may involve both
direct lysis and secretion of antiviral cytokines, principally IFN-
(22). Alphavirus infections are well known to be highly
sensitive to the antiviral activity of IFNs (25). The
testable implication of this work is that the small percentage of
individuals who develop chronic arthritis following an alphavirus infection (17, 27, 31, 65) have a persisting synovial infection because they fail to generate significant anti-alphavirus CTL
activity. These results suggest that CTL may generally be extremely
effective at controlling cytopathic viruses in restricted tissue
microenvironments where high concentrations of CTL-derived antiviral
cytokines might accumulate (5, 22) and/or high effector-to-target ratios might be achieved.
| |
ACKNOWLEDGMENTS |
M.L.L. and L.M. contributed equally to this work.
This work was supported financially by the following Australian
organizations: The National Health and Medical Research Council, the
Australian Centre for International and Tropical Health and Nutrition,
and the Queensland Health Arbovirus Research Fund.
We thank K. W. Sproat and B. E. H. Coupar (CSIRO,
Australian Animal Health Laboratory, Geelong, Victoria, Australia) for
help with construction of the recombinant vaccinia viruses and N. Kienzle, S. Burrows, and S. Elliott (Queensland Institute of Medical
Research) for helpful technical and scientific discussions.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Queensland
Institute of Medical Research, Post Office Royal Brisbane Hospital,
Qld. 4029, Australia. Phone: 61-7-33620415. Fax: 61-7-33620106. E-mail: andreasS{at}qimr.edu.au.
| |
REFERENCES |
| 1.
|
Aaskov, J. G.,
D. A. Dalglish,
J. J. Harper,
J. F. Douglas,
M. D. Donaldson, and P. J. Hertzog.
1987.
Natural killer cells in viral arthritis.
Clin. Exp. Immunol.
68:23-32[Medline].
|
| 2.
|
Adebajo, A. O.
1996.
Rheumatic manifestations of tropical diseases.
Curr. Opin. Rheumatol.
8:85-89[Medline].
|
| 3.
|
Amor, S.,
M. F. Scallan,
M. M. Morris,
H. Dyson, and J. K. Fazakerley.
1996.
Role of immune responses in protection and pathogenesis during Semliki Forest virus encephalitis.
J. Gen. Virol.
77:281-291[Abstract/Free Full Text].
|
| 4.
|
Atkinson, T.,
A. D. Barrett,
A. Mackenzie, and N. J. Dimmock.
1986.
Persistence of virulent Semliki Forest virus in mouse brain following co-inoculation with defective interfering particles.
J. Gen. Virol.
67:1189-1194[Abstract/Free Full Text].
|
| 5.
|
Blackman, M. J., and A. G. Morris.
1984.
Gamma interferon production and cytotoxicity of spleen cells from mice infected with Semliki Forest virus.
J. Gen. Virol.
65:955-961[Abstract/Free Full Text].
|
| 6.
|
Boege, U.,
W. Wengler,
G. Wengler, and B. Wittmann-Liebold.
1981.
Primary structure of the core proteins of the alphaviruses Semliki Forest virus and Sindbis virus.
Virology
113:293-303[Medline].
|
| 7.
|
Brighton, S. W.
1984.
Chloroquine phosphate treatment of chronic Chikungunya arthritis. An open pilot study.
S. Afr. Med. J.
66:217-218[Medline].
|
| 8.
|
Busch, D. H.,
C. Jassoy,
U. Brinckmann,
H. Girschick, and H. I. Huppertz.
1996.
Detection of Borrelia burgdorferi-specific CD8+ cytotoxic T cells in patients with Lyme arthritis.
J. Immunol.
157:3534-3541[Abstract].
|
| 9.
|
Chantler, J. K.,
A. J. Tingle, and R. E. Petty.
1985.
Persistent rubella virus infection associated with chronic arthritis in children.
N. Engl. J. Med.
313:1117-1123[Abstract].
|
| 10.
|
Clark, G. G.,
F. J. Dein,
C. L. Crabbs,
J. W. Carpenter, and D. M. Watts.
1987.
Antibody response of sandhill and whooping cranes to an eastern equine encephalitis virus vaccine.
J. Wildl. Dis.
23:539-544[Abstract].
|
| 11.
|
Curran, M.,
B. Harvey,
S. Crerar,
G. Oliver,
R. D'Sousza,
H. Myint,
C. Rann, and R. Andrews.
1996.
Australia's notifiable diseases status, 1996.
Commun. Dis. Intell.
21:281-307.
|
| 12.
|
Deresiewicz, R. L.,
S. J. Thaler,
L. Hsu, and A. A. Zamani.
1997.
Clinical and neuroradiographic manifestations of eastern equine encephalitis.
N. Engl. J. Med.
336:1867-1874[Abstract/Free Full Text].
|
| 13.
|
Dethlefs, S.,
M. Brahic, and E. L. Larsson-Sciard.
1997.
An early, abundant cytotoxic T-lymphocyte response against Theiler's virus is critical for preventing viral persistence.
J. Virol.
71:8875-8878[Abstract].
|
| 14.
|
Eaton, B. T., and A. J. Hapel.
1976.
Persistent noncytolytic togavirus infection of primary mouse muscle cells.
Virology
72:266-271[Medline].
|
| 15.
|
Faragher, S. G.,
A. D. Meek,
C. M. Rice, and L. Dalgarno.
1988.
Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.
Virology
163:509-526[Medline].
|
| 16.
|
Fish, K. N.,
W. Britt, and J. A. Nelson.
1996.
A novel mechanism for persistence of human cytomegalovirus in macrophages.
J. Virol.
70:1855-1862[Abstract].
|
| 17.
|
Fraser, J. R.
1986.
Epidemic polyarthritis and Ross River virus disease.
Clin. Rheum. Dis.
12:369-388[Medline].
|
| 18.
|
Fraser, J. R., and G. J. Becker.
1984.
Mononuclear cell types in chronic synovial effusions of Ross River virus disease.
Aust. N. Z. J. Med.
14:505-506[Medline].
|
| 19.
|
Fraser, J. R.,
V. M. Ratnamohan,
J. P. Dowling,
G. J. Becker, and G. A. Varigos.
1983.
The exanthem of Ross River virus infection: histology, location of virus antigen and nature of inflammatory infiltrate.
J. Clin. Pathol.
36:1256-1263[Abstract/Free Full Text].
|
| 20.
|
Friedman, R. M., and J. M. Ramseur.
1979.
Mechanisms of persistent infections by cytopathic viruses in tissue culture.
Arch. Virol.
60:83-103[Medline].
|
| 21.
|
Gorrell, M. D.,
J. A. Lemm,
C. M. Rice, and D. E. Griffin.
1997.
Immunization with nonstructural proteins promotes functional recovery of alphavirus-infected neurons.
J. Virol.
71:3415-3419[Abstract].
|
| 22.
|
Guidotti, L. G., and F. V. Chisari.
1996.
To kill or to cure: options in host defense against viral infection.
Curr. Opin. Immunol.
8:478-483[Medline].
|
| 23.
|
Hapel, A. J.
1975.
The protective role of thymus-derived lymphocytes in arbovirus-induced meningoencephalitis.
Scand. J. Immunol.
4:267-278[Medline].
|
| 24.
|
Hober, D.,
L. Andreoletti,
L. Shen,
M. C. Copin,
A. Desmidt, and P. Wattre.
1996.
Coxsackievirus B3-induced chronic myocarditis in mouse: use of whole blood culture to study the activation of TNF alpha-producing cells.
Microbiol. Immunol.
40:837-845[Medline].
|
| 25.
|
Hwang, S. Y.,
P. J. Hertzog,
K. A. Holland,
S. H. Sumarsono,
M. J. Tymms,
J. A. Hamilton,
G. Whitty,
I. Bertoncello, and I. Kola.
1995.
A null mutation in the gene encoding a type I interferon receptor component eliminates antiproliferative and antiviral responses to interferons alpha and beta and alters macrophage responses.
Proc. Natl. Acad. Sci. USA
92:11284-11288[Abstract/Free Full Text].
|
| 26.
|
Itescu, S.
1996.
Rheumatic aspects of acquired immunodeficiency syndrome.
Curr. Opin. Rheumatol.
8:346-353[Medline].
|
| 27.
|
Johnston, R. E., and C. J. Peters.
1996.
Alphaviruses, p. 843.
In
B. N. Fields, D. M. Knipe, P. M. Howley, et al. (ed.), Fields virology Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 28.
|
Journeaux, S. F.,
W. G. Brown, and J. G. Aaskov.
1987.
Prolonged infection of human synovial cells with Ross River virus.
J. Gen. Virol.
68:3165-3169[Abstract/Free Full Text].
|
| 29.
|
Kagi, D., and H. Hengartner.
1996.
Different roles for cytotoxic T cells in the control of infections with cytopathic versus noncytopathic viruses.
Curr. Opin. Immunol.
8:472-477[Medline].
|
| 30.
|
Kamada, M.,
Y. Ando,
Y. Fukunaga,
T. Kumanomido,
H. Imagawa,
R. Wada, and Y. Akiyama.
1980.
Equine Getah virus infection: isolation of the virus from racehorses during an enzootic in Japan.
Am. J. Trop. Med. Hyg.
29:984-988.
|
| 31.
|
Kennedy, A. C.,
J. Fleming, and L. Solomon.
1980.
Chikungunya viral arthropathy: a clinical description.
J. Rheumatol.
7:231-236[Medline].
|
| 32.
|
Kujala, P.,
M. Rikkonen,
T. Ahola,
M. Kelve,
M. Saarma, and L. Kaariainen.
1997.
Monoclonal antibodies specific for Semliki Forest virus replicase protein nsP2.
J. Gen. Virol.
78:343-351[Abstract].
|
| 33.
|
Laakkonen, P.,
M. Hyvonen,
J. Peranen, and L. Kaariainen.
1994.
Expression of Semliki Forest virus nsP1-specific methyltransferase in insect cells and in Escherichia coli.
J. Virol.
68:7418-7425[Abstract/Free Full Text].
|
| 34.
|
Lahesmaa, R.,
M. C. Shanafelt,
L. Steinman, and G. Peltz.
1994.
Immunopathogenesis of human inflammatory arthritis: lessons from Lyme and reactive arthritis.
J. Infect. Dis.
170:978-985[Medline].
|
| 35.
|
Lee, S.,
K. E. Owen,
H. K. Choi,
H. Lee,
G. Lu,
G. Wengler,
D. T. Brown,
M. G. Rossmann, and R. J. Kuhn.
1996.
Identification of a protein binding site on the surface of the alphavirus nucleocapsid and its implication in virus assembly.
Structure
4:531-541[Medline].
|
| 36.
|
Lehane, M. J., and C. J. Leake.
1982.
A kinetic and ultrastructural comparison of alphavirus infection of cultured mosquito and vertebrate cells.
J. Trop. Med. Hyg.
85:229-238[Medline].
|
| 37.
|
Levine, B.,
J. M. Hardwick, and D. E. Griffin.
1994.
Persistence of alphaviruses in vertebrate hosts.
Trends Microbiol.
2:25-28[Medline].
|
| 38.
|
Lichtensteiger, C. A.,
W. P. Cheevers, and W. C. Davis.
1993.
CD8+ cytotoxic T lymphocytes against antigenic variants of caprine arthritis-encephalitis virus.
J. Gen. Virol.
74:2111-2116[Abstract/Free Full Text].
|
| 39.
|
Linn, M. L.,
A. J. D. Bellett,
P. G. Parsons, and A. Suhrbier.
1995.
Complete removal of mycoplasma from viral preparations using solvent extraction.
J. Virol. Methods
52:51-54[Medline].
|
| 40.
|
Linn, M. L.,
J. Aaskov, and A. Suhrbier.
1996.
Antibody dependent enhancement and persistence in macrophages of an arbovirus associated with arthritis.
J. Gen. Virol.
77:407-412[Abstract/Free Full Text].
|
| 41.
|
Linn, M. L., and A. Suhrbier.
1997.
Persistence of Ross River virus in macrophages.
Arbovirus Res. Aust.
7:153-159.
|
| 42.
|
Lovett, A. E.,
C. S. Hahn,
C. M. Rice,
T. K. Frey, and J. S. Wolinsky.
1993.
Rubella virus-specific cytotoxic T-lymphocyte responses: identification of the capsid as a target of major histocompatibility complex class I-restricted lysis and definition of two epitopes.
J. Virol.
67:5849-5858[Abstract/Free Full Text].
|
| 43.
|
Martin, J. H.,
R. C. Weir, and L. Dalgarno.
1979.
Replication of standard and defective Ross River virus in BHK cells: patterns of viral RNA and polypeptide synthesis.
Arch. Virol.
61:87-103[Medline].
|
| 44.
|
Mathew, A.,
I. Kurane,
A. L. Rothman,
L. L. Zeng,
M. A. Brinton, and F. A. Ennis.
1996.
Dominant recognition by human CD8+ cytotoxic T lymphocytes of dengue virus nonstructural proteins NS3 and NS1.2a.
J. Clin. Invest.
98:1684-1691[Medline].
|
| 44a.
| Mateo, L. Unpublished information.
|
| 45.
|
Muellbacher, A., and R. V. Blanden.
1978.
Murine cytotoxic T-cell response to alphavirus is associated mainly with H-2Dk.
Immunogenetics
7:551-561.
|
| 46.
|
Muellbacher, A., and R. V. Blanden.
1979.
H-2-linked control of cytotoxic T-cell responsiveness to alphavirus infection. Presence of H-2Dk during differentiation and stimulation converts stem cells of low responder genotype to T cells of responder phenotype.
J. Exp. Med.
49:786-790.
|
| 47.
|
Muellbacher, A.,
I. D. Marshall, and R. V. Blanden.
1979.
Cross-reactive cytotoxic T cells to alphavirus infection.
Scand. J. Immunol.
10:291-296[Medline].
|
| 48.
|
Musiani, M.,
M. Zerbini,
G. Gentilomi,
M. Plazzi,
G. Gallinella, and S. Venturoli.
1995.
Parvovirus B19 clearance from peripheral blood after acute infection.
J. Infect. Dis.
172:1360-1363[Medline].
|
| 49.
|
Nanagara, R.,
F. Li,
A. Beutler,
A. Hudson, and H. R. Schumacher, Jr.
1995.
Alteration of Chlamydia trachomatis biologic behavior in synovial membranes. Suppression of surface antigen production in reactive arthritis and Reiter's syndrome.
Arthritis Rheum.
38:1410-1417[Medline].
|
| 50.
|
Narayan, O.,
M. C. Zink,
M. Gorrell,
M. McEntee,
D. Sharma, and R. Adams.
1992.
Lentivirus induced arthritis in animals.
J. Rheumatol. Suppl.
32:25-32[Medline].
|
| 51.
|
Niewiesk, S.,
U. Brinckmann,
B. Bankamp,
S. Sirak,
U. G. Liebert, and V. ter Meulen.
1993.
Susceptibility to measles virus-induced encephalitis in mice correlates with impaired antigen presentation to cytotoxic T lymphocytes.
J. Virol.
67:75-81[Abstract/Free Full Text].
|
| 52.
|
Nocton, J. J.,
F. Dressler,
B. J. Rutledge,
P. N. Rys,
D. H. Persing, and A. C. Steere.
1994.
Detection of Borrelia burgdorferi DNA by polymerase chain reaction in synovial fluid from patients with Lyme arthritis.
N. Engl. J. Med.
330:229-234[Abstract/Free Full Text].
|
| 53.
|
Oldstone, M. B.
1997.
How viruses escape from cytotoxic T lymphocytes: molecular parameters and players.
Virology
234:179-185[Medline].
|
| 54.
|
Peck, R.,
A. Brown, and C. J. Wust.
1979.
In vitro heterologous cytotoxicity by T effector cells from mice immunized with Sindbis virus.
J. Immunol.
123:1763-1766[Abstract/Free Full Text].
|
| 55.
|
Rammensee, H. G.,
T. Friede, and S. Stevanoviic.
1995.
MHC ligands and peptide motifs: first listing.
Immunogenetics
41:178-228[Medline].
|
| 56.
|
Reeves, W. C.,
G. A. Hutson,
R. E. Bellamy, and R. P. Scrivani.
1958.
Chronic latent infections of birds with western equine encephalomyelitis virus.
Proc. Soc. Exp. Biol. Med.
97:733-736.
|
| 57.
|
Rosen, L.,
D. J. Gubler, and P. H. Bennett.
1981.
Epidemic polyarthritis (Ross River) virus infection in the Cook Islands.
Am. J. Trop. Med. Hyg.
30:1294-1302.
|
| 58.
|
Rwaguma, E. B.,
J. J. Lutwama,
S. D. Sempala,
N. Kiwanuka,
J. Kamugisha,
S. Okware,
G. Bagambisa,
R. Lanciotti,
J. T. Roehrig, and D. J. Gubler.
1997.
Emergence of epidemic O'nyong-nyong fever in southwestern Uganda, after an absence of 35 years.
Emerg. Infect. Dis.
3:77. (Letter.)
|
| 59.
|
Sarmiento, R. E.,
R. Tirado, and B. Gomez.
1997.
Reinfection-induced increase of rubella persistently infected cells in a macrophage-like cell line.
Virus Res.
50:15-22[Medline].
|
| 60.
|
Scalzo, A. A.,
S. L. Elliott,
J. Cox,
J. Gardner,
D. J. Moss, and A. Suhrbier.
1995.
Induction of protective cytotoxic T cells to murine cytomegalovirus by using a nonapeptide and a human-compatable adjuvant (Montanide ISA 720).
J. Virol.
69:1306-1309[Abstract].
|
| 61.
|
Seay, A. R.,
D. E. Griffin, and R. T. Johnson.
1981.
Experimental viral polymyositis: age dependency and immune responses to Ross River virus infection in mice.
Neurology
31:656-660[Abstract/Free Full Text].
|
| 62.
|
Subak-Sharpe, I.,
H. Dyson, and J. Fazakerley.
1993.
In vivo depletion of CD8+ T cells prevents lesions of demyelination in Semliki Forest virus infection.
J. Virol.
67:7629-7633[Abstract/Free Full Text].
|
| 63.
|
Sweet, M. J., and D. A. Hume.
1995.
RAW264 macrophages stably transfected with an HIV-1 LTR reporter gene provide a sensitive bioassay for analysis of signalling pathways in macrophages stimulated with lipopolysaccharide, TNF-alpha or taxol.
J. Inflamm.
45:126-135[Medline].
|
| 64.
|
Thomson, S.,
R. Khanna,
J. Gardner,
S. R. Burrows,
B. Coupar,
D. J. Moss, and A. Suhrbier.
1995.
Minimal epitopes expressed in a recombinant polyepitope protein are processed and presented to CD8+ cytotoxic T cells: implications for vaccine design.
Proc. Natl. Acad. Sci. USA
92:5845-5849[Abstract/Free Full Text].
|
| 65.
|
Vene, S.,
C. Franzen, and B. Niklasson.
1994.
Development of specific antibody patterns and clinical symptoms following Ockelbo virus infection.
Arch. Virol.
134:61-71[Medline].
|
| 66.
|
Verder, H.,
E. Dickmeiss,
S. Haahr,
E. Kappelgaard,
J. Leerboy,
A. Moller-Larsen,
H. Nielsen,
P. Platz, and C. Koch.
1986.
Late-onset rubella syndrome: coexistence of immune complex disease and defective cytotoxic effector cell function.
Clin. Exp. Immunol.
63:367-375[Medline].
|
| 67.
|
Wakefield, A. J.,
R. Sim,
A. N. Akbar,
R. E. Pounder, and A. P. Dhillon.
1997.
In situ immune responses in Crohn's disease: a comparison with acute and persistent measles virus infection.
J. Med. Virol.
51:90-100[Medline].
|
| 68.
|
Weaver, S. C.,
R. Salas,
R. Rico-Hesse,
G. V. Ludwig,
M. S. Oberste,
J. Boshell, and R. B. Tesh.
1996.
Re-emergence of epidemic Venezuelan equine encephalomyelitis in South America. VEE Study Group.
Lancet
348:436-440[Medline].
|
| 69.
|
Westaway, E. G.
1973.
Proteins specified by group B togaviruses in mammalian cells during productive infections.
Virology
51:454-465[Medline].
|
| 70.
|
Yu, S., and J. G. Aaskov.
1994.
Development of a candidate vaccine against Ross River virus infection.
Vaccine
12:1118-1124[Medline].
|
J Virol, June 1998, p. 5146-5153, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Powers, A. M., Logue, C. H.
(2007). Changing patterns of chikungunya virus: re-emergence of a zoonotic arbovirus. J. Gen. Virol.
88: 2363-2377
[Full Text]
-
Krymskaya, L., Sharma, M. C., Martinez, J., Haq, W., Huang, E. C., Limaye, A. P., Diamond, D. J., Lacey, S. F.
(2005). Cross-Reactivity of T Lymphocytes Recognizing a Human Cytotoxic T-Lymphocyte Epitope within BK and JC Virus VP1 Polypeptides. J. Virol.
79: 11170-11178
[Abstract]
[Full Text]
-
Woodberry, T., Gardner, J., Elliott, S. L., Leyrer, S., Purdie, D. M., Chaplin, P., Suhrbier, A.
(2003). Prime Boost Vaccination Strategies: CD8 T Cell Numbers, Protection, and Th1 Bias. J. Immunol.
170: 2599-2604
[Abstract]
[Full Text]
-
Harley, D., Sleigh, A., Ritchie, S.
(2001). Ross River Virus Transmission, Infection, and Disease: a Cross-Disciplinary Review. Clin. Microbiol. Rev.
14: 909-932
[Abstract]
[Full Text]
-
Woodberry, T., Gardner, J., Mateo, L., Eisen, D., Medveczky, J., Ramshaw, I. A., Thomson, S. A., Ffrench, R. A., Elliott, S. L., Firat, H., Lemonnier, F. A., Suhrbier, A.
(1999). Immunogenicity of a Human Immunodeficiency Virus (HIV) Polytope Vaccine Containing Multiple HLA A2 HIV CD8+ Cytotoxic T-Cell Epitopes. J. Virol.
73: 5320-5325
[Abstract]
[Full Text]
Top
Abstract
Introduction
