Previous Article | Next Article 
J Virol, June 1998, p. 4980-4988, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Identification of Kaposin (Open Reading Frame K12)
as a Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus)
Transforming Gene
Sumitra
Muralidhar,1
Anne M.
Pumfery,1
Morad
Hassani,1
M. Reza
Sadaie,1
Norio
Azumi,2
Masamichi
Kishishita,1
John N.
Brady,3
Jay
Doniger,1
Peter
Medveczky,4 and
Leonard J.
Rosenthal1,*
Department of Microbiology and
Immunology1 and
Department of
Pathology,2 Georgetown University Medical
Center, Washington, D.C. 20007;
Laboratory of Molecular
Virology, National Cancer Institute, Bethesda, Maryland
208923; and
Department of Medical
Microbiology and Immunology, University of South Florida, Tampa,
Florida 336124
Received 17 December 1997/Accepted 2 March 1998
 |
ABSTRACT |
The recently identified human herpesvirus 8 (HHV-8, or Kaposi's
sarcoma-associated herpesvirus) has been implicated in the etiology of
both Kaposi's sarcoma (KS) and primary effusion (body cavity-based)
lymphoma (PEL) (Y. Chang et al., Science 266:1865-1869, 1994; P. S. Moore et al., J. Virol. 70:549-558, 1996). An important feature of the association of HHV-8 with these malignancies is the
expression of an abundant, latency-associated 0.7-kb transcript, T0.7
(W. Zhong et al., Proc. Natl. Acad. Sci. USA 93:6641-6646, 1996). T0.7
is found in all stages in nearly all KS tumors of different
epidemiologic origin, including AIDS-associated, African endemic, and
classical KS (K. A. Staskus et al., J. Virol. 71:715-719, 1997), as well as in a body cavity-based lymphoma-derived cell line,
BCBL-1, that is latently infected with HHV-8 (R. Renne et al., Nat.
Med. 2:342-346, 1996). T0.7 encodes a unique HHV-8 open reading frame,
K12, also known as kaposin. In this study, we report that the kaposin
gene induced tumorigenic transformation. Constructs with kaposin
expressed either from its endogenous promoter or from a heterologous
promoter induced focal transformation upon transfection into Rat-3
cells. All transformed Rat-3 cell lines containing kaposin sequences
produced high-grade, highly vascular, undifferentiated sarcomas upon
subcutaneous injection of athymic nu/nu mice.
Tumor-derived cell lines expressed kaposin mRNA, suggesting a role in
the maintenance of the transformed phenotype. Furthermore, kaposin
protein was detected in transformed and tumor-derived cells by
immunofluorescence and localized to the cytoplasm. More importantly,
expression of kaposin protein was also detected in the PEL cell lines
BCBL-1 and KS-1. These findings demonstrate the oncogenic potential of
kaposin and suggest its possible role in the development of KS and
other HHV-8-associated malignancies.
 |
INTRODUCTION |
Kaposi's sarcoma (KS) is a vascular
tumor most commonly occurring in patients with AIDS (5). KS
lesions are histologically complex and contain proliferating
spindle-shaped cells considered to be of endothelial origin,
infiltrating mononuclear cells, plasma cells, and abundant neovascular
spaces (74). A new member of the herpesvirus family, human
herpesvirus 8 (HHV-8), also known as KS-associated herpesvirus, has
been identified in KS tumors from both human immunodeficiency virus
(HIV)-positive (2, 14, 64) and HIV-negative (6, 49,
60) patients. HHV-8 sequences have also been identified in
several rare lymphomas such as multicentric Castleman's disease and
primary effusion lymphoma (PEL), also known as body cavity-based
large-cell lymphoma (10, 11, 13). The seroprevalence of
HHV-8 in the general population exhibits variations with geographic
distribution. Very low rates of prevalence have been reported for
populations in Britain and North America, whereas high rates prevail in
Africa and southern Europe (25, 36, 62). However, antibody
kinetic studies have shown that a strong correlation exists between
conversion to seropositivity and the risk for development of KS
(25, 34). Thus, HHV-8 has been proposed as the etiologic
agent for KS and other HHV-8-associated malignancies (25, 47,
50).
The nucleotide sequence of the HHV-8 long unique region (LUR) has been
determined from viral sequences isolated from the PEL cell line BC-1
(56). Of 81 open reading frames (ORFs), 66 have homology to
those in herpesvirus saimiri (HVS) and 15 (K1 to K15) are unique to
HHV-8. Moreover, cellular homologs related to known oncogenes have also
been identified in HHV-8; these include the genes encoding Bcl-2,
cyclin D, interleukin-6 (IL-6), G-protein-coupled receptor (GPCR), and
ribonucleotide reductase (1a, 12, 15, 17, 48, 52, 59). Some
of these homologs have been shown to enhance cell proliferation. The
HHV-8-encoded v-IL-6 supported the growth of an IL-6-dependent murine
cell line, B9 (52), while the expression of v-cyclin D
resulted in the induction of the S-phase in serum-starved quiescent NIH
3T3 cells (66). Expression of the v-GPCR in rat kidney
fibroblasts (NRK-49F cells) enhanced cell proliferation (3).
More recently, it has been reported that signaling by v-GPCR, which is
associated with a switch to an angiogenic phenotype, leads to
transformation and tumorigenesis in NIH 3T3 cells (4). Among
the HHV-8 unique K ORFs, only K9 has been shown to induce tumorigenic
transformation of NIH 3T3 cells (24). However, because K9
expression was detected in PEL cells but not KS tumors, Gao et al.
concluded that K9 may play a role only in B-cell malignancies
(24).
Analysis of HHV-8 gene expression in KS tumor spindle cells and the PEL
cell line BCBL-1 showed a highly restricted pattern of latent HHV-8 RNA
expression (74), i.e., two abundant polyadenylated transcripts of 1.1 and 0.7 kb (T1.1 and T0.7). T1.1 encoded only short
ORFs and was primarily localized in the nucleus (74). Recently, Sun et al. (65) demonstrated that the T1.1
polyadenylated nuclear RNA did not associate with polyribosomes and
therefore was not translationally active. On the other hand, T0.7
contained three small ORFs, one of which, ORF K12, also known as
kaposin (56), encoded a highly hydrophobic 60-amino-acid
(aa) peptide. The hydrophobicity of kaposin is similar to that of the
45-aa E5 oncoprotein of bovine papillomavirus type 1 (BPV-1)
(7, 61). T0.7 expression was observed in KS tissue of all
stages from earliest identifiable to advanced tumors (63).
Moreover, in advanced KS tumors, approximately 85% of spindle cells
expressed T0.7 RNA.
Due to the fact that T0.7 is an abundant, latency-associated transcript
retained in KS and PEL cell line BCBL-1, its transforming ability was
tested and compared to that of HHV-8 fragments containing several other
unique ORFs, including K4, K5, K6 (pBS/17), and K8 (pBS/199). Each of
three constructs encoding kaposin, including (i) pBS/23, a 4.4-kbp
HHV-8 genomic fragment containing the T0.7 sequence cloned in the pBS
vector, (ii) pBK/T0.7, the T0.7 sequence cloned in the mammalian
expression vector pBK-CMV, and (iii) pBK/kap, the 225-bp kaposin gene
cloned into pBK-CMV, induced morphologic transformation of Rat-3 cells.
Constructs pBS/17 and pBS/199 containing the other unique HHV-8 ORFs,
K4, K5, K6, and K8, were nontransforming. Focally transformed cell
lines established from Rat-3 cells transfected with pBS/23, pBK/T0.7,
and pBK/kap all produced high-grade, highly vascular, undifferentiated
sarcomas by 1 to 2 weeks after injection into athymic nu/nu
mice. Analysis of the tumor-derived cell lines demonstrated the
expression of kaposin mRNA. Furthermore, kaposin protein was detected
and localized to the cytoplasm of both the transformed and
tumor-derived cells by an indirect immunofluorescence assay (IFA) using
a polyclonal rabbit antikaposin antibody raised against a hydrophilic
kaposin peptide, kap-2 (aa 42 to 55). More importantly, in this study
kaposin protein was also detected in the HHV-8-containing PEL cell
lines BCBL-1 (53) and KS-1 (57). The transforming
ability of kaposin, its retention and expression in transformed and
tumor-derived cells, and its detection in PEL cell lines demonstrate
that kaposin is an HHV-8 transforming gene and suggest that kaposin
could play a role in the etiology of KS and PEL as well as other
HHV-8-associated malignancies.
 |
MATERIALS AND METHODS |
DNA and plasmids.
HHV-8 DNA was isolated from the PEL cell
line BC-1 (47). Three clones containing unique HHV-8 ORFs
were constructed by cloning 4- to 6-kbp, partially digested
Sau3A fragments into the BamHI site of
pBluescript (pBS; Stratagene). One of these, clone pBS/23, contained
nucleotides 116121 to 120497 of the HHV-8 LUR (56) which
include the sequence of the T0.7 transcript and the kaposin ORF. The
sequence of kaposin in the plasmids used in these studies (56) differed from the sequence of kaposin reported by Zhong et al. (74) by a single nucleotide substitution at codon 38, resulting in a serine-to-glycine substitution.
Plasmid pBK/kap was derived by cloning a 225-bp PCR-amplified kaposin
sequence into the EcoRI site of the mammalian expression vector pBK-CMV (Stratagene). The 5' and 3' kaposin PCR primers were
TCCTCACTCCAATCCCAATGC and CTTTGGGAGGGCACGCTAGCT,
respectively. The PCR-amplified fragment was first cloned into
pCR2.1 (Invitrogen). The purified EcoRI kaposin fragment
from pCR2.1/kap was then cloned into pBK-CMV. Plasmid pBK/T0.7 was
constructed in an analogous manner by using a PCR-amplified product
containing the T0.7 sequence spanning nucleotides 117431 to 118127 of
HHV-8.
pET30b/kap was constructed by cloning the
EcoRI fragment of
pBK/kap into the
EcoRI site of the bacterial expression
vector
pET30b (Novagen). Orientation was confirmed by sequence
analysis.
pET30b/kap encodes a 120-aa S-Tag/kaposin fusion protein,
with
the S-Tag sequence at its N terminus and the kaposin sequence
at
its C terminus.
Cells and transfection.
Rat-3 cells were grown in
Dulbecco's modified Eagle's medium (DMEM; Cell Gro/Mediatec)
supplemented with 2 mM glutamine, 100 U of penicillin-streptomycin per
ml, and 10% bovine calf serum. Tumor-derived cell lines were
established and grown in the same medium supplemented with 100 µg of
gentamicin per ml. PEL-derived BCBL-1 cells were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum, 2 mM glutamine, and
100 U of penicillin-streptomycin per ml. PEL-derived KS-1 cells were
provided as fixed cells on slides by D. Ablashi (Advanced
Biotechnologies, Inc.).
For the focal transformation assay, 5 × 10
4 Rat-3
cells were transfected in 35-mm-diameter petri dishes, in duplicate,
with
10 µg of plasmid DNA each by the calcium phosphate method
(
16).
The cells were subcultured into 100-mm-diameter dishes
48 h posttransfection.
Morphologically transformed foci were
identified and counted 3
to 4 weeks posttransfection. Independent
focally transformed cell
lines were established by ring isolation.
Geneticin (G418)-resistant
cell lines were established by selection at
a concentration of
400 µg/ml. Selected cells were maintained at a
concentration of
200 µg/ml.
R3/kap-1 and R3/kap-2 are Rat-3 cell lines derived from independent
pBK/kap-transformed foci. R3/T0.7-1, -2, and -3 and R3/23-1
are
similarly derived cell lines from pBK/T0.7- and pBS/23-transformed
foci, respectively. R3/BK-G1 and R3/kap-G1 are G418 selected cell
lines
obtained by transfection with vectors pBK-CMV and pBK/kap,
respectively. R3/kap-TL1 and R3/kap-TL2 are tumor-derived cell
lines
established from tumors induced by R3/kap-1 and R3/kap-2,
respectively.
Similarly, R3/T0.7-TL1, -TL2, and -TL3 and R3/23-TL1
are tumor-derived
cell lines established from tumors induced by
R3/T0.7-1, -2, and -3 and
R3/23-1, respectively.
PCR analysis.
Genomic DNA was isolated from focally
transformed cell lines and control Rat-3 cells by using a genomic DNA
isolation kit (Promega). The presence of kaposin sequences was
determined by PCR analysis of 200 ng of genomic DNA by using the 5' and
3' primers for kaposin described above. This resulted in amplification
of a 225-bp PCR product. Negative controls included samples with either
Rat-3 genomic DNA, no DNA, or mock-extracted DNA.
Tumorigenicity assay.
The tumorigenic potential of
kaposin-transformed cell lines was tested in athymic Ncr
nu/nu mice as previously described (18, 67).
Cells (5 × 106/100 µl) were injected subcutaneously
behind the neck. The mice were monitored every 3 days for the
appearance of tumors. Tumor-bearing mice were sacrificed, and tumors
were removed for histologic and molecular analyses as well as for
establishment of tumor-derived cell lines.
Northern blot analysis.
Cells were lysed in RNAzol B
solution, and total cellular RNA was isolated as specified by the
manufacturer (Tel-Test, Inc.). Poly(A) RNA was isolated by using an
mRNA isolation kit (Pharmacia). Total RNA (15 µg) or poly(A) RNA (5 µg) was separated by electrophoresis through a 1%
formaldehyde-agarose gel and blotted overnight to a Zetabind nylon
membrane (Micron Separations, Inc.). The membrane was baked at 50°C
for 30 min, and the RNA was cross-linked to the membrane by using a UV
Stratalinker (Stratagene). The membrane was prehybridized at 42°C for
3 h in 5× Denhardt's solution-5× SSPE (1× SSPE is 0.18 M
NaCl, 10 mM NaH2PO4, and 1 mM EDTA [pH 7.7])-50% formamide, 150 µg of salmon sperm DNA per ml, and 0.1% sodium dodecyl sulfate (SDS). Hybridization was carried out overnight at 42°C in the prehybridization solution containing 10% dextran sulfate and 107 cpm of 32P-labeled T0.7 DNA
probe, which was labeled by using a random-primer labeling kit
(Amersham). Following hybridization, the membrane was washed twice for
15 min each time with 2× SSC (1× SSC is 0.15 M NaCl plus 0.015 M
sodium citrate)-0.1% SDS at room temperature, once for 15 min with
0.1× SSC-0.1% SDS at room temperature, and twice for 30 min each
time with 0.1× SSC-0.1% SDS at 60°C. Hybridized 32P
label was detected by phosphorimager analysis using ImageQuant software.
Antibodies.
Anti-kap-1 and anti-kap-2 polyclonal antibodies
were generated by inoculation of rabbits with synthetic kaposin
peptides, synthesized as eight-chained lysine branched molecules. The
kap-1 peptide, DVLLNGWRWRLGAI (aa 15 to 29), and the kap-2 peptide, PSGQRGPVAFRTRV (aa 42 to 55), were chosen because of their hydrophilic nature. Both antibodies were generated by Chemicon International Inc.
Western blot and immunoprecipitation analyses.
Escherichia
coli BL21(DE3)(pLysS) cells were transformed with pET30b or
pET30b/kap. Cultures were induced at 37°C by addition of 1 mM
isopropyl-
-D-thiogalactopyranoside (IPTG) as specified by the manufacturer protocols (Novagen). Cell pellets were solubilized by SDS-gel loading buffer (50 mM Tris HCl [pH 6.8], 100 mM
dithiothreitol, 2% SDS, 10% glycerol, 0.1% bromophenol blue).
Proteins were separated by SDS-polyacrylamide gel electrophoresis
(PAGE) (4 to 20% gel) and transferred to polyvinylidene difluoride
(Immobilon-P; Millipore) membranes. The S-Tag/kaposin fusion protein
was detected by Western blot analysis using (i) the anti-kap-2 antibody
(1:500 dilution in TNET [10 mM Tris {pH 7.5}, 50 mM NaCl, 2.5 mM
EDTA, 0.1% Tween 20]) as previously described (51) or (ii)
the S-protein/alkaline phosphatase conjugate (1:5,000 in TBST [20 mM
Tris {pH 7.6}, 137 mM NaCl, 0.1% Tween 20]) detected with
Western-Light reagents as specified by the manufacturer (Tropix).
For immunoprecipitation, the kaposin protein was purified in
E. coli as described elsewhere (
29a), incubated with 5 µl of
anti-kap-2 antibody, and processed by standard
immunoprecipitation
techniques (
51). Immunoprecipitated
kaposin protein was detected
by Western blot analysis as described
above.
Immunofluorescence.
Adherent cells were grown on coverslips
as confluent monolayers, fixed in 4% paraformaldehyde for 10 min at
room temperature, washed with phosphate-buffered saline (PBS) three
times for 5 min each, and incubated with a 1:100 dilution of a rabbit
polyclonal anti-kap-2 antibody or preimmune serum at 37°C for 2 h in a humidified chamber. Suspension cells (106 cells/ml)
were spotted on polylysine-coated wells on a slide and placed at 4°C
for 45 min. The medium was carefully removed, and the cells were air
dried at room temperature for 10 min. Cells were then fixed in cold
acetone at room temperature for 15 min and incubated with a 1:5
dilution of either the anti-kap-1 or anti-kap-2 antibody or with
preimmune serum as described above. In both cases, following incubation
with primary antibody, cells were washed with PBS as described above
and incubated with fluorescein isothiocyanate-conjugated goat
anti-rabbit immunoglobulin G at room temperature for 1 h in the
dark. Following three washes with PBS, the cells were mounted with 50%
glycerol in PBS containing 5% 4,6-diamidino-2-phenylindole (DAPI) to
counterstain the nuclei. Immunofluorescence was detected in a Zeiss
Axiophot fluorescence microscope.
 |
RESULTS |
Kaposin induced tumorigenic transformation of Rat-3 cells.
Four- to 6-kbp fragments of HHV-8 genomic DNA, partially digested with
Sau3A, were cloned into the BamHI site of pBS
vector. Constructs which contained unique HHV-8 ORFs, i.e., pBS/17
(ORFs K4, K5, and K6), pBS/23 (ORF K12, i.e., kaposin), and pBS/199 (ORF K8) (Fig. 1), were transfected into
Rat-3 cells to test for focus-forming ability. Background levels of
foci were observed for clones pBS/17 and pBS/199 as well as for mock-
and pBS-transfected cells (Table 1,
experiment 1). In contrast, clone pBS/23 exhibited numerous
morphologically altered, highly refractile foci not seen in mock- or
pBS-transfected cells, indicating the transforming activity of this
clone.

View larger version (22K):
[in this window]
[in a new window]
|
FIG. 1.
Map of HHV-8 LUR showing the locations of the conserved
and unique ORFs, including sequences tested for transforming ability,
and a schematic diagram of the ~140-kb LUR sequence flanked by
terminal repeats (TR). HHV-8 fragments tested in the focus-forming
assay (17, 23, and 199) are shown as solid bars below the map. The
locations of T0.7 and kaposin (K12) sequences within fragment 23 are
indicated. The solid arrows indicate HHV-8 ORFs conserved in HVS, and
the open arrows indicate the unique HHV-8 ORFs. Repeat regions are
shown as small filled rectangles above the ORFs (frnk, vnct, waka/jwka,
zppa, moi, and mdsk). KS330 and KS631 are the fragments of HHV-8 that
were identified first. CBP, complement binding protein; ss DBP,
single-stranded DNA binding protein; gB, glycoprotein B; DNA pol, DNA
polymerase; DHFR, dihydrofolate reductase; TS, thymidylate synthetase;
MIP, macrophage inflammatory protein; nut-1, nuclear transcript 1; Teg,
tegument protein; TK, thymidine kinase; gH, glycoprotein H; MCP, major
capsid protein; gM, glycoprotein M; UDG, uracil DNA glucosidase; gL,
glycoprotein L; R-trans, transactivator; gX, glycoprotein X; vIRF,
viral interferon regulatory factor; RRS, ribonucleotide
reductase, small; RRL, ribonucleotide reductase, large;
CycD, cyclin D homolog; Adh, immunoglobulin family adhesion protein;
GCR, G-protein-coupled receptor. The map was adapted from Fig. 1 of
reference 56 with the permission of the publisher.
|
|
To determine if the transforming activity of pBS/23 was due to kaposin
(ORF K12), both the T0.7 sequence and the kaposin gene
were subcloned
into the mammalian expression vector pBK-CMV and
assessed for their
transforming ability. Plasmid pBK/mtrII, containing
the human
cytomegalovirus (HCMV) transforming gene mtrII (UL111a)
(
68), was used as a positive control. Like clone pBS/23,
both
pBK/T0.7 and pBK/kap induced similar levels of morphologically
altered foci (Table
1, experiment 2, and Fig.
2A). Background
levels of foci were seen
in mock- and vector-transfected cells.
Similar levels of transforming
activity observed with pBS/23,
pBK/T0.7, and pBK/kap indicate
that the transforming activity
resides in kaposin.

View larger version (39K):
[in this window]
[in a new window]
|
FIG. 2.
Kaposin-transformed Rat-3 cells induced high-grade
undifferentiated sarcomas in athymic nu/nu mice. (A) Typical
focus induced in pBK/kap-transfected Rat-3 cells. The focus of
refractile randomly oriented multilayered transformed cells is shown
against a background of parental Rat-3 cells (magnification, ×60). (B)
Tumor development in an athymic nu/nu mouse at 2 weeks
postinoculation with kaposin-transformed Rat-3 cells. (C)
Representative section of a tumor induced by kaposin-transformed Rat-3
cells, fixed with formalin and stained with hematoxylin and eosin.
Magnification, ×200.
|
|
Independent transformed foci were isolated and expanded into focal cell
lines. Genomic DNA isolated from the cell lines was
analyzed for the
presence of kaposin sequences by PCR amplification.
Kaposin-positive,
transformed Rat-3 cell lines R3/23-1 (pBS/23
transfected), R3/T0.7-1,
R3/T0.7-2, and R3/T0.7-3 (pBK/T0.7 transfected),
and R3/kap-1 and
R3/kap-2 (pBK/kap transfected) were tested for
tumorigenicity by
injection into athymic Ncr
nu/nu mice (Table
2, experiment
1). All cell lines containing kaposin sequences,
whether derived from
transfection by pBS/23, pBK/T0.7, or pBK/kap
(Fig.
2B and C), induced
highly vascular, high-grade, undifferentiated
sarcomas within 1 to 2 weeks of injection, whereas Rat-3 cells
did not.
In addition to the focal cell lines tested above, Rat-3 cells
transfected with pBK-CMV or pBK/kap were selected for resistance
to
G418 and tested for tumorigenicity (Table
2, experiment 2).
The R3/kap-G1
(pBK/kap-transfected) cell line exhibited a transformed
morphology
similar to focally derived R3/kap-1 and -2 cells and
were tumorigenic.
In contrast, the R3/BK-G1 (pBK-CMV vector-transfected)
cell line
maintained a morphology similar to parental Rat-3 cells
and was not
tumorigenic. Thus, both G418-selected as well as focally
derived
pBK/kap-transfected Rat-3 cells exhibited morphologic
and tumorigenic
transformation.
Kaposin mRNA is expressed in tumor-derived cell lines.
Total
RNA was extracted from tumor-derived cell lines R3/kap-TL1 and
R3/kap-TL2, and kaposin mRNA was detected by a Northern blot analysis
using 32P-labeled kaposin DNA probe (Fig.
3). Two kaposin-specific RNA species were
detected at 0.8 and 1.1 kb in the RNA from the two tumor-derived lines,
whereas no kaposin signal was observed in the RNA from control Rat-3
cells. The two RNA bands observed result from splicing of the message
at the simian virus 40 3'-splice acceptor site downstream of the
kaposin insertion site in the pBK/kap construct. Their sizes are
consistent with expected sizes of polyadenylated spliced and unspliced
messages, respectively, transcribed from pBK/kap. Kaposin-specific
messages were also observed in poly(A)+ mRNA isolated from
the above-specified two cell lines as well as from R3/T0.7-TL1, -TL2,
and -TL3 tumor-derived cell lines (data not shown). Demonstration of
the retention and expression of the kaposin gene in the tumor-derived
cell lines correlates with the observation of expression of the T0.7
kaposin message in all stages of KS tumors in vivo (63).

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 3.
Expression of kaposin mRNA in tumor-derived cell lines.
Total RNA was extracted from Rat-3, R3/kap-TL1, and R3/kap-TL2 cells.
The RNA was separated on a 1% formaldehyde-agarose gel, blotted onto a
Zetabind nylon membrane, and probed under stringent conditions with
32P-labeled kaposin DNA. The 1.1-kb unspliced and 0.8-kb
spliced messages for kaposin are shown. Positions of 28S (4.7-kb) and
18S (1.9-kb) rRNA markers are indicated on the left.
|
|
Antibodies to hydrophilic kaposin peptides recognize bacterially
expressed kaposin.
Polyclonal rabbit antisera were generated
against two hydrophilic kaposin peptides, aa 15 to 29 (kap-1) and aa 42 to 55 (kap-2) (Fig. 4). The efficacy of
anti-kap-2 antibody was determined by its reactivity to a 120-aa
S-Tag/kaposin fusion protein produced in E. coli. A protein
band with an apparent molecular mass of 17 kDa was detected in the
extract of IPTG-induced cells carrying plasmid pET30b/kap by Western
blot analysis using the S-protein/alkaline phosphatase conjugate, which
binds to the S-Tag (Fig. 5A). No corresponding band was detected in uninduced cells or in cells carrying
the vector pET30b. The membrane was then stripped and analyzed by
Western blotting using the anti-kap-2 antibody (Fig. 5B). The identical
17-kDa band was observed in the extract of induced cells with
pET30b/kap but not in the other samples. Moreover, the 17-kDa band was
also detected with the anti-kap-1 antibody in a Western blot but not
with preimmune serum (data not shown). Furthermore, kaposin purified
from the S-Tag/kaposin fusion protein was immunoprecipitated by
anti-kap-2 antibody but not by preimmune serum (29a). Taken
together, these observations demonstrated that antikaposin antibody
recognized both the linear and native conformations of kaposin protein.

View larger version (10K):
[in this window]
[in a new window]
|
FIG. 4.
Kyte-Doolittle hydrophobicity plot of kaposin showing
the predominant hydrophobic domains and locations of the hydrophilic
kaposin peptides used to generate the antikaposin antibodies. kap-1 and
kap-2 are hydrophilic peptide sequences used to generate anti-kap-1 and
anti-kap-2 antibodies, respectively.
|
|

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 5.
Anti-kap-2 antibody detected bacterially expressed
kaposin fusion protein. E. coli BL21(DE3)(pLysS),
transformed by either pET30b-kap or pET30b, was induced for 90 min with
1 mM IPTG (I) or uninduced (U). Proteins were extracted in SDS-gel dye
buffer, separated by SDS-PAGE, and electroblotted onto Immobilon-P
membranes. (A) Western blot showing the 17 kDa S-Tag/kaposin fusion
protein in the pET30b-kap (lane I), using the S-Tag/alkaline
phosphatase conjugate (Novagen). (B) Western blot showing the
S-Tag/kaposin fusion protein seen in panel A detected with anti-kap-2
antibody. Sizes on the left are indicated in kilodaltons.
|
|
Kaposin protein localized to the cytoplasm in transformed and
tumor-derived cells.
Kaposin protein was detected in transformed
Rat-3 cells and tumor-derived cells by an IFA using the anti-kap-2
antibody. Positive anti-kap-2 antibody staining was observed in the
tumor-derived cell line R3/kap-TL1 and predominantly localized to a
restricted region of the cytoplasm (Fig.
6, panel 1A). Nuclei in the same field of
cells were visualized by counterstaining with DAPI (panel 1B). No
antibody staining of R3/kap-TL1 cells was observed with preimmune serum
(panel 2A), while the presence of cells was demonstrated by DAPI
counterstaining of nuclei (panel 2B). Moreover, no staining was
observed with anti-kap-2 antibody in the stable Rat-3 cell line
transfected with the vector pBK-CMV (panel 3A). Again, DAPI counterstaining revealed the presence of cells in the field (panel 3B).
Positive staining was also observed with the kaposin-transformed cell
line R3/kap-1, which produced tumors in athymic nu/nu mice (data not shown). These results demonstrate that kaposin protein is
expressed in transformed and tumor-derived cells.

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 6.
Detection and localization of kaposin protein in
transformed Rat-3 cells, tumor-derived cells, and the PEL cell line
BCBL-1. IFA shows cytoplasmic staining of kaposin protein in
tumor-derived cell line R3/kap-TL1, using anti-kap-2 antibody (1:50)
(panel 1A). Also shown are R3/kap-TL1 cells stained with preimmune
serum (1:50) (panel 2A) and vector-transfected cell line R3/BK-G1
stained with anti-kap-2 antibody (1:50) (panel 3A). BCBL-1 cells
stained with anti-kap-2 antibody (1:5) and preimmune serum (1:5) are
shown in panels 4A and 5A, respectively. Intense staining with
anti-kap-2 antibody in a restricted region of the cytoplasm of
R3/kap-TL1 and BCBL-1 cells are indicated by arrows in panels 1A and
4A, respectively. DAPI staining of nuclei of the above-specified fields
are shown in panels 1B, 2B, 3B, 4B, and 5B, respectively.
Magnifications: panels 1 to 3 (A and B), ×1,800; panels 4 and 5 (A and
B), ×3,000.
|
|
Kaposin protein is expressed in the PEL cell lines BCBL-1 and
KS-1.
Kaposin protein was also detected by IFA in BCBL-1 cells.
Positive anti-kap-2 antibody staining was observed with predominant staining localized to a restricted region of the cytoplasm (Fig. 6,
panel 4A). Nuclei in the same field of cells was visualized by
counterstaining with DAPI (panel 4B). Similar results were observed
with anti-kap-1 antiserum (data not shown). Minimal background staining
was observed with preimmune serum (panel 5A), and the presence of cells
in the field was demonstrated by counterstaining the nuclei with DAPI
(panel 5B). Kaposin protein was also detected by IFA in another
HHV-8-containing PEL cell line, KS-1 (data not shown). With either
anti-kap-2 or anti-kap-1 antibody, over 90% of BCBL-1 and KS-1 cells
were stained. These findings demonstrate that kaposin protein is
expressed in cell lines derived from HHV-8-associated lymphoid tumors
like PEL and that this expression occurs in latently infected cells.
 |
DISCUSSION |
The data in this study demonstrated that the unique HHV-8 kaposin
gene, ORF K12, morphologically transformed Rat-3 cells which were
tumorigenic when inoculated into athymic nu/nu mice. The tumors developed with a very short latency period (1 to 2 weeks) and
were highly vascular, high-grade, undifferentiated fibrosarcomas. Neoplastic transformation occurred whether kaposin was expressed from
its endogenous promoter or from the heterologous CMV immediate-early promoter. Of significance, kaposin mRNA and protein were detected in
both the focally transformed and tumor-derived cells (Fig. 6),
suggesting that kaposin expression is required for both induction of
transformation and maintenance of the tumorigenic phenotype. Retention
and expression of viral oncoproteins is a hallmark of transformation by
DNA tumor viruses including simian virus 40, polyomavirus, adenovirus,
CMV, and HHV-6 (26, 33, 39, 51, 55, 68, 73). Although the
abundant, latency-associated transcript T0.7 has been observed in all
stages of KS tumors of different epidemiologic origin as well as in PEL
(63, 74), expression of kaposin protein from this transcript
has not been reported. This study has demonstrated, for the first time,
the expression of kaposin protein in the PEL cell lines BCBL-1 and
KS-1. As with the Rat-3-transformed and tumor-derived cells, kaposin
protein localized predominantly to a restricted region of the cytoplasm of BCBL-1 and KS-1 cells. The ability of kaposin to induce tumorigenic transformation in rodents and its expression in PEL-derived cells suggests that kaposin may play a role in the development of KS and PEL.
The level of transforming activity of kaposin in the rodent cell
focus-forming assay was 1 to 2 orders of magnitude lower than that
reported for cellular or retroviral oncogenes in similar assay systems.
However, the level is comparable to and representative of that reported
for other herpesvirus transforming genes like HCMV mtrII (UL111a)
(30, 31), HSV-2 mtrIII (UL39) (23, 32, 54), and
HHV-6 ORF-1 (67). A similar low level of transforming activity has also been reported for the human papillomavirus type 16 oncogene E7 (69, 72).
Comparison of the genome of HHV-8 to those of HVS and Epstein-Barr
virus (EBV) has revealed the presence of extensive conserved collinear
regions as well as unique sequences (56). The transforming genes of HVS and EBV are unique to each of these herpesviruses. HVS is
a T-cell-specific oncogenic virus capable of inducing
lymphoproliferative disorders in natural or experimental hosts and
transforming lymphoid cells in vitro (43, 44). Two HVS
proteins have been associated with transforming activities
(42). The saimiri transformation-associated protein is a
membrane-associated phosphoprotein with a highly acidic amino terminus,
central collagen-like repeats, and a hydrophobic carboxy terminus that
has been shown to induce oncogenic transformation via interaction with
cellular ras, resulting in activation of the Ras signaling
pathway (35). Another protein, tyrosine kinase-interacting protein, binds to p56lck tyrosine kinase and
significantly increases its kinase activity. It has been postulated
that this activated kinase feeds into the Ras and protein kinase C
signaling pathways (40). EBV, on the other hand, encodes a
latent membrane protein, LMP2a, which binds stably to a Src family
kinase in B cells and down-regulates Src kinase activity and thus
maintains latency of the virus (9). However, none of the
transforming genes of either HVS or EBV have been conserved in HHV-8.
The kaposin transforming gene identified in this study is one of the
unique HHV-8 ORFs.
The HHV-8 genome also contains ORFs that are functional homologs of
cellular proto-oncogenes such as those encoding cyclin D (12, 15,
27, 38), GPCR (3), bcl-2 (17,
59), and IL-6 (48, 52). Of these, the v-IL-6, v-cyclin
D, and v-GPCR genes have been shown to enhance cell proliferation
(3, 52, 66). More recently, the v-GPCR gene has been
reported to induce tumorigenic transformation in rodent cells and
activate angiogenesis (4). However, v-GPCR mRNA is expressed
as a lytic transcript upon tetradecanoyl phorbol acetate induction in
the PEL cell line BC-1 (58). Furthermore, it has been
reported that in HHV-8-containing cell lines such as BCBL-1 and BCP-1,
only a minor population of cells are in the lytic state (4).
In addition, using in situ hybridization with the T1.1 probe and
colocalization with the major capsid protein RNA, Staskus et al.
(63) have determined that only about 10% of HHV-8-infected
cells in KS lesions are in the lytic state. The K9 ORF (vIRF), unique
to HHV-8, has also been identified as an oncogene which inhibited the
interferon signaling pathway (24). Because K9 expression was
detected in an HHV-8-infected B-cell line but not in KS tissue, Gao et
al. (24) proposed its putative role in B-cell malignancies.
In contrast to both v-GPCR and K9, kaposin is expressed as an abundant,
latency-associated transcript in both KS and PEL (63, 74).
In this study, fragments containing other ORFs unique to HHV-8 were
tested for their transforming ability. Transformation was not observed
with constructs of two HHV-8 fragments, pBS/17 containing unique HHV-8
ORFs K4, K5, and K6 and pBS/199 with K8. Although this observation
indicated the specificity of transformation seen with pBS/23 containing
kaposin, no definitive conclusions can be made about the oncogenic
potential of the K4, K5, K6, and K8 ORFs because their expression in
transfected cells was not analyzed. In conclusion, the kaposin
transforming gene identified in this study is a unique HHV-8 ORF that
is encoded by the abundant, latency-associated transcript expressed in
both KS and PEL.
In vitro evidence suggests that autocrine and paracrine growth effects
of cytokines, growth factors, and their receptors play an important
role in the pathogenesis of KS, both AIDS associated, and non-AIDS
associated. AIDS-associated KS-derived cells have been shown to respond
to and express high levels of an endothelial cell growth factor,
IL-1
, basic fibroblast growth factor (bFGF), and IL-6 (21,
46). In addition, the HIV type 1 Tat protein has been implicated
in the pathogenesis of AIDS-associated KS, either directly by
activation of HHV-8 replication (29) or indirectly by
activation of cytokines (22). The Tat protein has also been shown to act in synergy with bFGF in inducing KS-like lesions in mice
(20). The importance of similar autocrine and paracrine growth effects in non-AIDS-associated KS has also been documented. Various growth factors and cytokines including bFGF, IL-6,
platelet-derived growth factor B (PDGF-B), vascular endothelial
growth factor, and oncostatin M can serve as modulators of KS
cell proliferation in vitro (21, 37, 41, 45, 70). KS-derived
cells have also been shown to express a functional FGF receptor, flg
(37), and PDGF-A-type and PDGF-B-type receptors
(71). Constitutive expression and activation of growth
factors or their specific receptors could therefore serve as a
mechanism by which viral oncogenes and oncoproteins create an autocrine
growth loop that leads to self-sustained aberrant growth.
Similarities in size and hydrophobicity between kaposin and the BPV-1
E5 protein suggest that they might have common mechanisms for
transformation (Fig. 4) (61). BPV-1 E5 is a small 44-aa protein with a strongly hydrophobic N terminus that has been localized to Golgi apparatus and endoplasmic reticulum (ER) membranes of transformed cells (8). In the present study, kaposin, a
small 60-aa protein with N- and C-terminal hydrophobic domains, was also localized to the cytoplasm of transformed and tumor-derived cells
by using an antibody raised against a hydrophilic kaposin peptide.
Interestingly, kaposin protein was detected predominantly in a
restricted area of the cytoplasm, suggestive of the Golgi apparatus and
ER membranes. In support of these findings, AU1 epitope-tagged kaposin
also localized to the Golgi apparatus and ER membranes in a transient
transfection assay (1). E5 has been shown to bind to the
16-kDa component of the vacuolar H+-ATPase which is
important in processing growth factor receptors (28).
Moreover, the interaction of E5 with the type
PDGF receptor (PDGFR)
transmembrane domain which results in constitutive PDGFR activation is
required for transformation (19). Therefore, it is possible
that kaposin also transforms cells by activation of growth factor
receptors such as PDGFR which are processed in the Golgi complex. In
summary, the data presented here demonstrate that the HHV-8 kaposin
gene (ORF K12) induced tumorigenic transformation and that the kaposin
protein is expressed in PEL-derived cell lines. Thus, it may play a
role in the development of KS, PEL, and other HHV-8-associated
malignancies.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grant CA 60577 from the National Institutes of Health and in part by a contract from
the National Foundation for Cancer Research (Bethesda, Md.). Assistance
with the tumorigenicity studies was provided by the Lombardi Cancer
Research Center Animal Care Facility supported by Public Health Service
grant P30 CA51008-09.
We thank Chemicon International Inc. for generating antibodies against
kap-1 and kap-2 peptides and D. Ablashi of Advanced Biotechnologies
Inc. for providing fixed KS-1 cells.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Georgetown University Medical Center, 3900 Reservoir Rd., NW, Washington, D.C. 20007. Phone: (202) 687-1140. Fax:
(202) 687-1264. E-mail: rosenthl{at}gunet.georgetown.edu.
 |
REFERENCES |
| 1.
| Adduci, A., et al. Unpublished data.
|
| 1a.
|
Ali, M. A.,
D. McWeeney,
A. Milosavljevic,
J. Jurka, and R. J. Jariwalla.
1991.
Enhanced malignant transformation induced by expression of a distinct protein domain of ribonucleotide reductase large subunit from herpes simplex virus type 2.
Proc. Natl. Acad. Sci. USA
88:8257-8261[Abstract/Free Full Text].
|
| 2.
|
Ambroziak, J. A.,
D. J. Blackbourn,
B. G. Herndier,
R. G. Glogau,
J. H. Gullett,
A. R. McDonald,
E. T. Lennette, and J. A. Levy.
1995.
Herpes-like sequences in HIV-infected and uninfected Kaposi's sarcoma patients.
Science
268:582-583[Free Full Text].
|
| 3.
|
Arvanitakis, L.,
E. Geras-Raaka,
A. Varma,
M. C. Gershengorn, and E. Cesarman.
1997.
Human herpesvirus KSHV encodes a constitutively active G-protein-coupled receptor linked to cell proliferation.
Nature
385:347-350[Medline].
|
| 4.
|
Bais, C.,
B. Santomasso,
O. Coso,
L. Arvanitakis,
E. G. Raaka,
J. S. Gutkind,
A. S. Asch,
E. Cesarman,
M. C. Gerhengorn, and E. A. Mesri.
1998.
G-protein-coupled receptor of Kaposi's sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator.
Nature
391:86-89[Medline].
|
| 5.
|
Beral, V.
1991.
Epidemiology of Kaposi's sarcoma.
Cancer Surv.
10:5-22[Medline].
|
| 6.
|
Boshoff, C.,
D. Whitby,
T. Hatziioannou,
C. Fisher,
J. van der Walt,
A. Hatzakis,
R. Weiss, and T. Schulz.
1995.
Kaposi's-sarcoma-associated herpesvirus in HIV-negative Kaposi's sarcoma.
Lancet
345:1043-1044[Medline].
|
| 7.
|
Burkhardt, A.,
D. DiMaio, and R. Schlegel.
1987.
Genetic and biochemical definition of the bovine papillomavirus E5 transforming protein.
EMBO J.
6:2381-2385[Medline].
|
| 8.
|
Burkhardt, A.,
M. Willingham,
C. Gay,
K.-T. Jeang, and R. Schlegel.
1989.
The E5 oncoprotein of bovine papillomavirus is oriented asymmetrically in Golgi and plasma membranes.
Virology
170:334-339[Medline].
|
| 9.
|
Burkhardt, A. L.,
J. B. Bolen,
E. Kieff, and R. Longnecker.
1992.
An Epstein-Barr virus transformation-associated membrane protein interacts with src family tyrosine kinases.
J. Virol.
66:5161-5167[Abstract/Free Full Text].
|
| 10.
|
Cesarman, E.,
Y. Chang,
P. S. Moore,
J. W. Said, and D. M. Knowles.
1995.
Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas.
N. Engl. J. Med.
332:1186-1191[Abstract/Free Full Text].
|
| 11.
|
Cesarman, E.,
P. S. Moore,
P. H. Rao,
G. Inghirami,
D. M. Knowles, and Y. Chang.
1995.
In vitro establishment and characterization of two acquired immunodeficiency syndrome-related lymphoma cell lines (BC-1 and BC-2) containing Kaposi's sarcoma-associated herpesvirus-like (KSHV) DNA sequences.
Blood
86:2708-2714[Abstract/Free Full Text].
|
| 12.
|
Cesarman, E.,
R. G. Nador,
F. Bai,
R. A. Bohenzky,
J. J. Russo,
P. S. Moore,
Y. Chang, and D. M. Knowles.
1996.
Kaposi's sarcoma-associated herpesvirus contains G protein-coupled receptor and cyclin D homologs which are expressed in Kaposi's sarcoma and malignant lymphoma.
J. Virol.
70:8218-8223[Abstract].
|
| 13.
|
Chadburn, A.,
E. Cesarman,
J. Jagirdar,
M. Subar,
R. N. Mir, and D. M. Knowles.
1993.
CD30 (Ki-1) positive anaplastic large cell lymphomas in individuals infected with the human immunodeficiency virus.
Cancer
72:3078-3090[Medline].
|
| 14.
|
Chang, Y.,
E. Cesarman,
M. S. Pessin,
F. Lee,
J. Culpepper,
D. M. Knowles, and P. S. Moore.
1994.
Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma.
Science
265:1865-1869.
|
| 15.
|
Chang, Y.,
P. S. Moore,
S. J. Talbot,
C. H. Boshoff,
T. Zarkowska,
D. Godden-Kent,
H. Paterson,
R. A. Weiss, and S. Mittnacht.
1996.
Cyclin encoded by KS herpesvirus.
Nature
382:410[Medline].
|
| 16.
|
Chen, C., and H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:2745-2752[Abstract/Free Full Text].
|
| 17.
|
Cheng, E. H.,
J. Nicholas,
D. S. Bellows,
G. S. Hayward,
H. G. Guo,
M. S. Reitz, and J. M. Hardwick.
1997.
A Bcl-2 homolog encoded by Kaposi sarcoma-associated virus, human herpesvirus 8, inhibits apoptosis but does not heterodimerize with Bax or Bak.
Proc. Natl. Acad. Sci. USA
94:690-694[Abstract/Free Full Text].
|
| 18.
|
Clanton, D. J.,
R. J. Jariwalla,
C. Kress, and L. J. Rosenthal.
1983.
Neoplastic transformation by a cloned human cytomegalovirus DNA fragment uniquely homologous to one of the transforming regions of herpes simplex virus type 2.
Proc. Natl. Acad. Sci. USA
80:3826-3830[Abstract/Free Full Text].
|
| 19.
|
Cohen, B. D.,
D. J. Goldstein,
L. Rutledge,
W. C. Vass,
D. R. Lowy,
R. Schlegel, and J. T. Schiller.
1993.
Transformation-specific interaction of the bovine papillomavirus E5 oncoprotein with the platelet-derived growth factor receptor transmembrane domain and the epidermal growth factor receptor cytoplasmic domain.
J. Virol.
67:5303-5311[Abstract/Free Full Text].
|
| 20.
|
Ensoli, B.,
R. Gendelman,
P. Markham,
V. Fiorelli,
S. Colombini,
M. Raffeld,
A. Cafaro,
H. K. Chang,
J. N. Brady, and R. C. Gallo.
1994.
Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma.
Nature
371:674-680[Medline].
|
| 21.
|
Ensoli, B.,
S. Nakamura,
S. Z. Salahuddin,
P. Biberfeld,
L. Larsson,
B. Beaver,
F. Wong-Staal, and R. C. Gallo.
1989.
AIDS-Kaposi's sarcoma-derived cells express cytokines with autocrine and paracrine growth effects.
Science
243:223-226[Abstract/Free Full Text].
|
| 22.
|
Fiorelli, V.,
R. Gendelman,
F. Samaniego,
P. D. Markham, and B. Ensoli.
1995.
Cytokines from activated T cells induce normal endothelial cells to acquire the phenotypic and functional features of AIDS-Kaposi's sarcoma spindle cells.
J. Clin. Invest.
95:1723-1734.
|
| 23.
|
Galloway, D. A.,
J. A. Nelson, and J. K. McDougall.
1984.
Small fragments of herpesvirus DNA with transforming activity contain insertion sequence-like structures.
Proc. Natl. Acad. Sci. USA
81:4736-4740[Abstract/Free Full Text].
|
| 24.
|
Gao, S. J.,
C. Boshoff,
S. Jayachandra,
R. A. Weiss,
Y. Chang, and P. Moore.
1997.
KSHV ORF K9 is an oncogene which inhibits the interferon signaling pathway.
Oncogene
15:1979-1985[Medline].
|
| 25.
|
Gao, S. J.,
L. Kingsley,
M. Li,
W. Zheng,
C. Parravicini,
J. Ziegler,
R. Newton,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
Y. Chang, and P. S. Moore.
1996.
KSHV antibodies among Americans, Italians and Ugandans with and without Kaposi's sarcoma.
Nat. Med.
2:925-928[Medline].
|
| 26.
|
Garcea, R. L.,
D. A. Talmage,
A. Harmatz,
R. Freund, and T. L. Benjamin.
1989.
Separation of host range from transformation functions of the hr-t gene of polyomavirus.
Virology
168:312-319[Medline].
|
| 27.
|
Godden-Kent, D.,
S. J. Talbot,
C. Boshoff,
Y. Chang,
P. Moore,
R. A. Weiss, and S. Mittnacht.
1997.
The cyclin encoded by Kaposi's sarcoma-associated herpesvirus stimulates cdk6 to phosphorylate the retinoblastoma protein and histone H1.
J. Virol.
71:4193-4198[Abstract].
|
| 28.
|
Goldstein, D. J.,
M. E. Finbow,
T. Andresson,
P. McLean,
K. Smith,
V. Bubb, and R. Schlegel.
1991.
Bovine papillomavirus E5 oncoprotein binds to the 16k component of vacuolar H(+)-ATPases.
Nature
352:347-349[Medline].
|
| 29.
|
Harrington, W., Jr.,
L. Sieczkowski,
C. Sosa,
S. Chan-a-Sue,
J. P. Cai,
L. Cabral, and C. Wood.
1997.
Activation of HHV-8 by HIV-1 tat.
Lancet
349:774-775[Medline].
|
| 29a.
| Hassani, M., et al. Unpublished data.
|
| 30.
|
Inamdar, A.,
J. Thompson,
F. Kashanchi,
J. Doniger,
J. N. Brady, and L. J. Rosenthal.
1992.
Identification of two promoters within human cytomegalovirus morphologic transforming region II.
Intervirology
34:146-153[Medline].
|
| 31.
|
Jahan, N.,
A. Razzaque,
J. Brady, and L. J. Rosenthal.
1989.
The human cytomegalovirus mtrII colinear region in strain Tanaka is transformation defective.
J. Virol.
63:2866-2869[Abstract/Free Full Text].
|
| 32.
|
Jariwalla, R. J.,
L. Aurelian, and P. O. Ts'o.
1980.
Tumorigenic transformation induced by a specific fragment of DNA from herpes simplex virus type 2.
Proc. Natl. Acad. Sci. USA
77:2279-2283[Abstract/Free Full Text].
|
| 33.
|
Kashanchi, F.,
J. C. Araujo,
J. Doniger,
S. Muralidhar,
S. Khleif,
E. Mendleson,
J. Thompson,
N. Azumi,
J. N. Brady,
M. Luppi,
G. Torelli, and L. J. Rosenthal.
1997.
Human herpesvirus type 6 (HHV-6) ORF-1 transactivating gene exhibits malignant transforming activity and its protein binds to p53.
Oncogene
14:359-367[Medline].
|
| 34.
|
Kedes, D. H.,
E. Operskalski,
M. Busch,
R. Kohn,
J. Flood, and D. Ganem.
1996.
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma-associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.
Nat. Med.
2:918-924[Medline].
|
| 35.
|
Lee, H.,
J. J. Trimble,
D. W. Yoon,
D. Regier,
R. C. Desrosiers, and J. U. Jung.
1997.
Genetic variation of herpesvirus saimiri subgroup A transforming protein and its association with cellular Src.
J. Virol.
71:3817-3825[Abstract].
|
| 36.
|
Lennette, E. T.,
D. J. Blackbourn, and J. A. Levy.
1996.
Antibodies to human herpesvirus type 8 in the general population and in Kaposi's sarcoma patients.
Lancet
348:858-861[Medline].
|
| 37.
|
Li, J. J.,
Y. Q. Huang,
D. Moscatelli,
A. Nicolaides,
W. C. Zhang, and A. E. Friedman-Kien.
1993.
Expression of fibroblast growth factors and their receptors in acquired immunodeficiency syndrome-associated Kaposi sarcoma tissue and derived cells.
Cancer
72:2253-2259[Medline].
|
| 38.
|
Li, M.,
H. Lee,
D. W. Yoon,
J. C. Albrecht,
B. Fleckenstein,
F. Neipel, and J. U. Jung.
1997.
Kaposi's sarcoma-associated herpesvirus encodes a functional cyclin.
J. Virol.
71:1984-1991[Abstract].
|
| 39.
|
Linzer, D. I., and A. J. Levine.
1979.
Characterization of a 54k dalton cellular SV40 tumor antigen present in SV40-transformed cells and uninfected embryonal carcinoma cells.
Cell
17:43-52[Medline].
|
| 40.
|
Lund, T.,
M. M. Medveczky, and P. G. Medveczky.
1997.
Herpesvirus saimiri Tip-484 membrane protein markedly increases p56lck activity in T cells.
J. Virol.
71:378-382[Abstract].
|
| 41.
|
Masood, R.,
J. Cai,
T. Zheng,
D. L. Smith,
Y. Naidu, and P. S. Gill.
1997.
Vascular endothelial growth factor/vascular permeability factor is an autocrine growth factor for AIDS-Kaposi sarcoma.
Proc. Natl. Acad. Sci. USA
94:979-984[Abstract/Free Full Text].
|
| 42.
|
Medveczky, M. M.,
P. Geck,
J. L. Sullivan,
D. Serbousek,
J. Y. Djeu, and P. G. Medveczky.
1993.
IL-2 independent growth and cytotoxicity of herpesvirus saimiri-infected human CD8 cells and involvement of two open reading frame sequences of the virus.
Virology
196:402-412[Medline].
|
| 43.
|
Medveczky, M. M.,
E. Szomolanyi,
R. Hesselton,
D. De Grand,
P. Geck, and P. G. Medveczky.
1989.
Herpesvirus saimiri strains from three DNA subgroups have different oncogenic potentials in New Zealand White rabbits.
J. Virol.
63:3601-3611[Abstract/Free Full Text].
|
| 44.
|
Medveczky, P. G.
1995.
Oncogenic transformation of T cells by herpesvirus saimiri, p. 239-252.
In
G. Barbanti-Brodano, M. Bendinelli, and H. Friedman (ed.), DNA tumor viruses: oncogenic mechanisms. Plenum Press, New York, N.Y.
|
| 45.
|
Miles, S. A.,
O. Martinez-Maza,
A. Rezai,
L. Magpantay,
T. Kishimoto,
S. Nakamura,
S. F. Radka, and P. S. Linsley.
1992.
Oncostatin M as a potent mitogen for AIDS-Kaposi's sarcoma-derived cells.
Science
255:1432-1434[Abstract/Free Full Text].
|
| 46.
|
Miles, S. A.,
A. R. Rezai,
J. F. Salazar-Gonzalez,
M. Vander Meyden,
R. H. Stevens,
D. M. Logan,
R. T. Mitsuyasu,
T. Taga,
T. Hirano,
T. Kishimoto, and O. Martinez-Maza.
1990.
AIDS Kaposi sarcoma-derived cells produce and respond to interleukin 6.
Proc. Natl. Acad. Sci. USA
87:4068-4072[Abstract/Free Full Text].
|
| 47.
|
Miller, G.,
M. O. Rigsby,
L. Heston,
E. Grogan,
R. Sun,
C. Metroka,
J. A. Levy,
S. J. Gao,
Y. Chang, and P. S. Moore.
1996.
Antibodies to butyrate-inducible antigens of Kaposi's sarcoma-associated herpesvirus in patients with HIV-1 infection.
N. Engl. J. Med.
334:1292-1297[Abstract/Free Full Text].
|
| 48.
|
Moore, P. S.,
C. Boshoff,
R. A. Weiss, and Y. Chang.
1996.
Molecular mimicry of human cytokine and cytokine response pathway genes by KSHV.
Science
274:1739-1744[Abstract/Free Full Text].
|
| 49.
|
Moore, P. S., and Y. Chang.
1995.
Detection of herpesvirus-like DNA sequences in Kaposi's sarcoma in patients with and without HIV infection.
N. Engl. J. Med.
332:1181-1185[Abstract/Free Full Text].
|
| 50.
|
Moore, P. S.,
S. J. Gao,
G. Dominguez,
E. Cesarman,
O. Lungu,
D. M. Knowles,
R. Garber,
P. E. Pellett,
D. J. McGeoch, and Y. Chang.
1996.
Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma.
J. Virol.
70:549-558[Abstract].
|
| 51.
|
Muralidhar, S.,
J. Doniger,
E. Mendelson,
J. C. Araujo,
F. Kashanchi,
N. Azumi,
J. N. Brady, and L. J. Rosenthal.
1996.
Human cytomegalovirus mtrII oncoprotein binds to p53 and down-regulates p53-activated transcription.
J. Virol.
70:8691-8700[Abstract].
|
| 52.
|
Nicholas, J.,
V. R. Ruvolo,
W. H. Burns,
G. Sandford,
X. Wan,
D. Ciufo,
S. B. Hendrickson,
H. G. Guo,
G. S. Hayward, and M. S. Reitz.
1997.
Kaposi's sarcoma-associated human herpesvirus-8 encodes homologues of macrophage inflammatory protein-1 and interleukin-6.
Nat. Med.
3:287-292[Medline].
|
| 53.
|
Renne, R.,
W. Zhong,
B. Herndier,
M. McGrath,
N. Abbey,
D. Kedes, and D. Ganem.
1996.
Lytic growth of Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in culture.
Nat. Med.
2:342-346[Medline].
|
| 54.
|
Reyes, G. R.,
R. LaFemina,
S. D. Hayward, and G. S. Hayward.
1980.
Morphological transformation by DNA fragments of human herpesviruses: evidence for two distinct transforming regions in herpes simplex virus types 1 and 2 and lack of correlation with biochemical transfer of the thymidine kinase gene.
Cold Spring Harbor Symp. Quant. Biol.
44:629-641.
|
| 55.
|
Rosenthal, L. J., and S. Choudhury.
1993.
Potential oncogenicity of human cytomegalovirus, p. 412-436.
In
Y. Becker, G. Darai, and E. S. Huang (ed.), Molecular aspects of human cytomegalovirus diseases. Springer-Verlag, New York, N.Y.
|
| 56.
|
Russo, J. J.,
R. A. Bohenzky,
M. C. Chien,
J. Chen,
M. Yan,
D. Maddalena,
J. P. Parry,
D. Peruzzi,
I. S. Edelman,
Y. Chang, and P. S. Moore.
1996.
Nucleotide sequence of the Kaposi sarcoma-associated herpesvirus (HHV8).
Proc. Natl. Acad. Sci. USA
93:14862-14867[Abstract/Free Full Text].
|
| 57.
|
Said, J. W.,
K. Chien,
S. Takeuchi,
T. Tasaka,
H. Asou,
S. K. Cho,
S. de Vos,
E. Cesarman,
D. M. Knowles, and H. P. Koeffler.
1996.
Kaposi's sarcoma-associated herpesvirus (KSHV or HHV8) in primary effusion lymphoma: ultrastructural demonstration of herpesvirus in lymphoma cells.
Blood
87:4937-4943[Abstract/Free Full Text].
|
| 58.
|
Sarid, R.,
O. Flore,
R. A. Bohenzky,
Y. Chang, and P. S. Moore.
1998.
Transcription mapping of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) genome in a body cavity-based lymphoma cell line (BC-1).
J. Virol.
72:1005-1012[Abstract/Free Full Text].
|
| 59.
|
Sarid, R.,
T. Sato,
R. A. Bohenzky,
J. J. Russo, and Y. Chang.
1997.
Kaposi's sarcoma-associated herpesvirus encodes a functional bcl-2 homologue.
Nat. Med.
3:293-298[Medline].
|
| 60.
|
Schalling, M.,
M. Ekman,
E. E. Kaaya,
A. Linde, and P. Biberfeld.
1995.
A role for a new herpes virus (KSHV) in different forms of Kaposi's sarcoma.
Nat. Med.
1:707-708[Medline].
|
| 61.
|
Schlegel, R.,
M. Wade-Glass,
M. S. Rabson, and Y.-C. Yang.
1986.
The E5 transforming gene of bovine papillomavirus encodes a small hydrophobic polypeptide.
Science
233:464-467[Abstract/Free Full Text].
|
| 62.
|
Simpson, G. R.,
T. F. Schulz,
D. Whitby,
P. M. Cook,
C. Boshoff,
L. Rainbow,
M. R. Howard,
S. J. Gao,
R. A. Bohenzky,
P. Simmonds,
C. Lee,
A. de Ruiter,
A. Hatzakis,
R. S. Tedder,
I. V. Weller,
R. A. Weiss, and P. S. Moore.
1996.
Prevalence of Kaposi's sarcoma associated herpesvirus infection measured by antibodies to recombinant capsid protein and latent immunofluorescence antigen.
Lancet
348:1133-1138[Medline].
|
| 63.
|
Staskus, K. A.,
W. Zhong,
K. Gebhard,
B. Herndier,
H. Wang,
R. Renne,
J. Beneke,
J. Pudney,
D. J. Anderson,
D. Ganem, and A. T. Haase.
1997.
Kaposi's sarcoma-associated herpesvirus gene expression in endothelial (spindle) tumor cells.
J. Virol.
71:715-719[Abstract].
|
| 64.
|
Su, I. J.,
Y. S. Hsu,
Y. C. Chang, and I. W. Wang.
1995.
Herpesvirus-like DNA sequence in Kaposi's sarcoma from AIDS and non-AIDS patients in Taiwan.
Lancet
345:722-723[Medline].
|
| 65.
|
Sun, R.,
S. F. Lin,
L. Gradoville, and G. Miller.
1996.
Polyadenylylated nuclear RNA encoded by Kaposi sarcoma-associated herpesvirus.
Proc. Natl. Acad. Sci. USA
93:11883-11888[Abstract/Free Full Text].
|
| 66.
|
Swanton, C.,
D. J. Mann,
B. Fleckenstein,
F. Neipel,
G. Peters, and N. Jones.
1997.
Herpes viral cyclin/Cdk6 complexes evade inhibition by CDK inhibitor proteins.
Nature
390:184-187[Medline].
|
| 67.
|
Thompson, J.,
S. Choudhury,
F. Kashanchi,
J. Doniger,
Z. Berneman,
N. Frenkel, and L. J. Rosenthal.
1994.
A transforming fragment within the direct repeat region of human herpesvirus type 6 that transactivates HIV-1.
Oncogene
9:1167-1175[Medline].
|
| 68.
|
Thompson, J.,
J. Doniger, and L. J. Rosenthal.
1994.
A 79 amino acid oncogene is responsible for human cytomegalovirus mtrII induced malignant transformation.
Arch. Virol.
136:161-172[Medline].
|
| 69.
|
Vousden, K. H.,
J. Doniger,
J. A. DiPaolo, and D. R. Lowy.
1988.
The E7 open reading frame of human papillomavirus type 16 encodes a transforming gene.
Oncogene Res.
3:167-175[Medline].
|
| 70.
|
Weindel, K.,
D. Marme, and H. A. Weich.
1992.
AIDS-associated Kaposi's sarcoma cells in culture express vascular endothelial growth factor.
Biochem. Biophys. Res. Commun.
183:1167-1174[Medline].
|
| 71.
|
Werner, S.,
P. H. Hofschneider,
C. H. Heldin,
A. Ostman, and W. K. Roth.
1990.
Cultured Kaposi's sarcoma-derived cells express functional PDGF A-type and B-type receptors.
Exp. Cell Res.
187:98-103[Medline].
|
| 72.
|
Yasumoto, S.,
A. L. Burkhardt,
J. Doniger, and J. A. DiPaolo.
1986.
Human papillomavirus type 16 DNA-induced malignant transformation of NIH 3T3 cells.
J. Virol.
57:572-577[Abstract/Free Full Text].
|
| 73.
|
Yew, P. R., and A. J. Berk.
1992.
Inhibition of p53 transactivation required for transformation by adenovirus early 1B protein.
Nature
357:82-85[Medline].
|
| 74.
|
Zhong, W.,
H. Wang,
B. Herndier, and D. Ganem.
1996.
Restricted expression of Kaposi sarcoma-associated herpesvirus (human herpesvirus 8) genes in Kaposi sarcoma.
Proc. Natl. Acad. Sci. USA
93:6641-6646[Abstract/Free Full Text].
|
J Virol, June 1998, p. 4980-4988, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Flach, B., Steer, B., Thakur, N. N., Haas, J., Adler, H.
(2009). The M10 Locus of Murine Gammaherpesvirus 68 Contributes to both the Lytic and the Latent Phases of Infection. J. Virol.
83: 8163-8172
[Abstract]
[Full Text]
-
Gould, F., Harrison, S. M., Hewitt, E. W., Whitehouse, A.
(2009). Kaposi's Sarcoma-Associated Herpesvirus RTA Promotes Degradation of the Hey1 Repressor Protein through the Ubiquitin Proteasome Pathway. J. Virol.
83: 6727-6738
[Abstract]
[Full Text]
-
Chen, W., Huang, Q., Zuppan, C. W., Rowsell, E. H., Cao, J. D., Weiss, L. M., Wang, J.
(2009). Complete Absence of KSHV/HHV-8 in Posttransplant Lymphoproliferative Disorders: An Immunohistochemical and Molecular Study of 52 Cases. Am J Clin Pathol
131: 632-639
[Abstract]
[Full Text]
-
Shin, Y. C., Joo, C.-H., Gack, M. U., Lee, H.-R., Jung, J. U.
(2008). Kaposi's Sarcoma-Associated Herpesvirus Viral IFN Regulatory Factor 3 Stabilizes Hypoxia-Inducible Factor-1{alpha} to Induce Vascular Endothelial Growth Factor Expression. Cancer Res.
68: 1751-1759
[Abstract]
[Full Text]
-
Sander, G., Konrad, A., Thurau, M., Wies, E., Leubert, R., Kremmer, E., Dinkel, H., Schulz, T., Neipel, F., Sturzl, M.
(2008). Intracellular Localization Map of Human Herpesvirus 8 Proteins. J. Virol.
82: 1908-1922
[Abstract]
[Full Text]
-
Wies, E., Mori, Y., Hahn, A., Kremmer, E., Sturzl, M., Fleckenstein, B., Neipel, F.
(2008). The viral interferon-regulatory factor-3 is required for the survival of KSHV-infected primary effusion lymphoma cells. Blood
111: 320-327
[Abstract]
[Full Text]
-
Gandy, S. Z., Linnstaedt, S. D., Muralidhar, S., Cashman, K. A., Rosenthal, L. J., Casey, J. L.
(2007). RNA Editing of the Human Herpesvirus 8 Kaposin Transcript Eliminates Its Transforming Activity and Is Induced during Lytic Replication. J. Virol.
81: 13544-13551
[Abstract]
[Full Text]
-
Lubyova, B., Kellum, M. J., Frisancho, J. A., Pitha, P. M.
(2007). Stimulation of c-Myc Transcriptional Activity by vIRF-3 of Kaposi Sarcoma-associated Herpesvirus. J. Biol. Chem.
282: 31944-31953
[Abstract]
[Full Text]
-
Rezaee, S. A. R., Cunningham, C., Davison, A. J., Blackbourn, D. J.
(2006). Kaposi's sarcoma-associated herpesvirus immune modulation: an overview. J. Gen. Virol.
87: 1781-1804
[Abstract]
[Full Text]
-
Pearce, M., Matsumura, S., Wilson, A. C.
(2005). Transcripts Encoding K12, v-FLIP, v-Cyclin, and the MicroRNA Cluster of Kaposi's Sarcoma-Associated Herpesvirus Originate from a Common Promoter. J. Virol.
79: 14457-14464
[Abstract]
[Full Text]
-
Matsumura, S., Fujita, Y., Gomez, E., Tanese, N., Wilson, A. C.
(2005). Activation of the Kaposi's Sarcoma-Associated Herpesvirus Major Latency Locus by the Lytic Switch Protein RTA (ORF50). J. Virol.
79: 8493-8505
[Abstract]
[Full Text]
-
Stedman, W., Deng, Z., Lu, F., Lieberman, P. M.
(2004). ORC, MCM, and Histone Hyperacetylation at the Kaposi's Sarcoma-Associated Herpesvirus Latent Replication Origin. J. Virol.
78: 12566-12575
[Abstract]
[Full Text]
-
Chang, P.-J., Miller, G.
(2004). Autoregulation of DNA Binding and Protein Stability of Kaposi's Sarcoma-Associated Herpesvirus ORF50 Protein. J. Virol.
78: 10657-10673
[Abstract]
[Full Text]
-
Milligan, S., Robinson, M., O'Donnell, E., Blackbourn, D. J.
(2004). Inflammatory Cytokines Inhibit Kaposi's Sarcoma-Associated Herpesvirus Lytic Gene Transcription in In Vitro-Infected Endothelial Cells. J. Virol.
78: 2591-2596
[Abstract]
[Full Text]
-
An, J., Sun, Y., Rettig, M. B.
(2004). Transcriptional coactivation of c-Jun by the KSHV-encoded LANA. Blood
103: 222-228
[Abstract]
[Full Text]
-
Lu, F., Zhou, J., Wiedmer, A., Madden, K., Yuan, Y., Lieberman, P. M.
(2003). Chromatin Remodeling of the Kaposi's Sarcoma-Associated Herpesvirus ORF50 Promoter Correlates with Reactivation from Latency. J. Virol.
77: 11425-11435
[Abstract]
[Full Text]
-
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract]
[Full Text]
-
Watanabe, T., Sugaya, M., Atkins, A. M., Aquilino, E. A., Yang, A., Borris, D. L., Brady, J., Blauvelt, A.
(2003). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Prolongs the Life Span of Primary Human Umbilical Vein Endothelial Cells. J. Virol.
77: 6188-6196
[Abstract]
[Full Text]
-
Li, H., Komatsu, T., Dezube, B. J., Kaye, K. M.
(2002). The Kaposi's Sarcoma-Associated Herpesvirus K12 Transcript from a Primary Effusion Lymphoma Contains Complex Repeat Elements, Is Spliced, and Initiates from a Novel Promoter. J. Virol.
76: 11880-11888
[Abstract]
[Full Text]
-
Sarid, R., Klepfish, A., Schattner, A.
(2002). Virology, Pathogenetic Mechanisms, and Associated Diseases of Kaposi Sarcoma-Associated Herpesvirus (Human Herpesvirus 8). Mayo Clin Proc.
77: 941-949
[Abstract]
-
Moses, A. V., Jarvis, M. A., Raggo, C., Bell, Y. C., Ruhl, R., Luukkonen, B. G. M., Griffith, D. J., Wait, C. L., Druker, B. J., Heinrich, M. C., Nelson, J. A., Fruh, K.
(2002). Kaposi's Sarcoma-Associated Herpesvirus-Induced Upregulation of the c-kit Proto-Oncogene, as Identified by Gene Expression Profiling, Is Essential for the Transformation of Endothelial Cells. J. Virol.
76: 8383-8399
[Abstract]
[Full Text]
-
Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E.
(2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev.
15: 439-464
[Abstract]
[Full Text]
-
Otieno, M. W., Banura, C., Katongole-Mbidde, E., Johnson, J. L., Ghannoum, M., Dowlati, A., Renne, R., Arts, E., Whalen, C., Lederman, M. M., Remick, S. C.
(2002). Therapeutic Challenges of AIDS-Related Non-Hodgkin's Lymphoma in the United States and East Africa. JNCI J Natl Cancer Inst
94: 718-732
[Abstract]
[Full Text]
-
Fakhari, F. D., Dittmer, D. P.
(2002). Charting Latency Transcripts in Kaposi's Sarcoma-Associated Herpesvirus by Whole-Genome Real-Time Quantitative PCR. J. Virol.
76: 6213-6223
[Abstract]
[Full Text]
-
Tang, S., Zheng, Z.-M.
(2002). Kaposi's Sarcoma-associated Herpesvirus K8 Exon 3 Contains Three 5'-Splice Sites and Harbors a K8.1 Transcription Start Site. J. Biol. Chem.
277: 14547-14556
[Abstract]
[Full Text]
-
Curreli, F., Cerimele, F., Muralidhar, S., Rosenthal, L. J., Cesarman, E., Friedman-Kien, A. E., Flore, O.
(2002). Transcriptional Downregulation of ORF50/Rta by Methotrexate Inhibits the Switch of Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 from Latency to Lytic Replication. J. Virol.
76: 5208-5219
[Abstract]
[Full Text]
-
Chang, P.-J., Shedd, D., Gradoville, L., Cho, M.-S., Chen, L.-W., Chang, J., Miller, G.
(2002). Open Reading Frame 50 Protein of Kaposi's Sarcoma-Associated Herpesvirus Directly Activates the Viral PAN and K12 Genes by Binding to Related Response Elements. J. Virol.
76: 3168-3178
[Abstract]
[Full Text]
-
Paulose-Murphy, M., Ha, N.-K., Xiang, C., Chen, Y., Gillim, L., Yarchoan, R., Meltzer, P., Bittner, M., Trent, J., Zeichner, S.
(2001). Transcription Program of Human Herpesvirus 8 (Kaposi's Sarcoma-Associated Herpesvirus). J. Virol.
75: 4843-4853
[Abstract]
[Full Text]
-
Jeong, J., Papin, J., Dittmer, D.
(2001). Differential Regulation of the Overlapping Kaposi's Sarcoma-Associated Herpesvirus vGCR (orf74) and LANA (orf73) Promoters. J. Virol.
75: 1798-1807
[Abstract]
[Full Text]
-
Laman, H., Coverley, D., Krude, T., Laskey, R., Jones, N.
(2001). Viral Cyclin-Cyclin-Dependent Kinase 6 Complexes Initiate Nuclear DNA Replication. Mol. Cell. Biol.
21: 624-635
[Abstract]
[Full Text]
-
Cattelan, A. M., Calabro, M. L., Gasperini, P., Aversa, S. M. L., Zanchetta, M., Meneghetti, F., De Rossi, A., Chieco-Bianchi, L.
(2000). Acquired Immunodeficiency Syndrome-Related Kaposi's Sarcoma Regression After Highly Active Antiretroviral Therapy: Biologic Correlates of Clinical Outcome. J Natl Cancer Inst Monogr
2000: 44-49
[Abstract]
[Full Text]
-
Gradoville, L., Gerlach, J., Grogan, E., Shedd, D., Nikiforow, S., Metroka, C., Miller, G.
(2000). Kaposi's Sarcoma-Associated Herpesvirus Open Reading Frame 50/Rta Protein Activates the Entire Viral Lytic Cycle in the HH-B2 Primary Effusion Lymphoma Cell Line. J. Virol.
74: 6207-6212
[Abstract]
[Full Text]
-
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C.
(2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol.
74: 3388-3398
[Abstract]
[Full Text]
-
Damania, B., Choi, J.-K., Jung, J. U.
(2000). Signaling Activities of Gammaherpesvirus Membrane Proteins. J. Virol.
74: 1593-1601
[Full Text]
-
Dittmer, D., Stoddart, C., Renne, R., Linquist-Stepps, V., Moreno, M.E., Bare, C., McCune, J.M., Ganem, D.
(1999). Experimental Transmission of Kaposi's Sarcoma-Associated Herpesvirus (Kshv/Hhv-8) to Scid-Hu Thy/Liv Mice. JEM
190: 1857-1868
[Abstract]
[Full Text]
-
Hayward, G. S.
(1999). Human Herpesvirus 8 Latent-State Gene Expression and Apoptosis in Kaposi's Sarcoma Lesions. JNCI J Natl Cancer Inst
91: 1705-1707
[Full Text]
-
Reitz, M. S. Jr., Nerurkar, L. S., Gallo, R. C.
(1999). Perspective on Kaposi's Sarcoma: Facts, Concepts, and Conjectures. JNCI J Natl Cancer Inst
91: 1453-1458
[Full Text]
-
Moses, A. V., Fish, K. N., Ruhl, R., Smith, P. P., Strussenberg, J. G., Zhu, L., Chandran, B., Nelson, J. A.
(1999). Long-Term Infection and Transformation of Dermal Microvascular Endothelial Cells by Human Herpesvirus 8. J. Virol.
73: 6892-6902
[Abstract]
[Full Text]
-
Glenn, M., Rainbow, L., Auradé, F., Davison, A., Schulz, T. F.
(1999). Identification of a Spliced Gene from Kaposi's Sarcoma-Associated Herpesvirus Encoding a Protein with Similarities to Latent Membrane Proteins 1 and 2A of Epstein-Barr Virus. J. Virol.
73: 6953-6963
[Abstract]
[Full Text]
-
Zhu, F. X., Cusano, T., Yuan, Y.
(1999). Identification of the Immediate-Early Transcripts of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
73: 5556-5567
[Abstract]
[Full Text]
-
Sadler, R., Wu, L., Forghani, B., Renne, R., Zhong, W., Herndier, B., Ganem, D.
(1999). A Complex Translational Program Generates Multiple Novel Proteins from the Latently Expressed Kaposin (K12) Locus of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
73: 5722-5730
[Abstract]
[Full Text]
-
Kirshner, J. R., Staskus, K., Haase, A., Lagunoff, M., Ganem, D.
(1999). Expression of the Open Reading Frame 74 (G-Protein-Coupled Receptor) Gene of Kaposi's Sarcoma (KS)-Associated Herpesvirus: Implications for KS Pathogenesis. J. Virol.
73: 6006-6014
[Abstract]
[Full Text]
-
Osman, M., Kubo, T., Gill, J., Neipel, F., Becker, M., Smith, G., Weiss, R., Gazzard, B., Boshoff, C., Gotch, F.
(1999). Identification of Human Herpesvirus 8-Specific Cytotoxic T-Cell Responses. J. Virol.
73: 6136-6140
[Abstract]
[Full Text]
-
Searles, R. P., Bergquam, E. P., Axthelm, M. K., Wong, S. W.
(1999). Sequence and Genomic Analysis of a Rhesus Macaque Rhadinovirus with Similarity to Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol.
73: 3040-3053
[Abstract]
[Full Text]
-
Lin, S.-F., Robinson, D. R., Miller, G., Kung, H.-J.
(1999). Kaposi's Sarcoma-Associated Herpesvirus Encodes a bZIP Protein with Homology to BZLF1 of Epstein-Barr Virus. J. Virol.
73: 1909-1917
[Abstract]
[Full Text]
-
Virgin, H. W. IV, Presti, R. M., Li, X.-Y., Liu, C., Speck, S. H.
(1999). Three Distinct Regions of the Murine Gammaherpesvirus 68 Genome Are Transcriptionally Active in Latently Infected Mice. J. Virol.
73: 2321-2332
[Abstract]
[Full Text]
-
Kliche, S., Kremmer, E., Hammerschmidt, W., Koszinowski, U., Haas, J.
(1998). Persistent Infection of Epstein-Barr Virus-Positive B Lymphocytes by Human Herpesvirus 8. J. Virol.
72: 8143-8149
[Abstract]
[Full Text]