Previous Article | Next Article 
J Virol, June 1998, p. 4746-4755, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Mutational and Functional Analysis of the C-Terminal Region of
the C3H Mouse Mammary Tumor Virus Superantigen
Thomas J.
Wrona,1,
Mary
Lozano,1
Awadh A.
Binhazim,2 and
Jaquelin P.
Dudley1,*
Department of Microbiology and Institute for
Cellular and Molecular Biology, The University of Texas at Austin,
Austin, Texas 78712,1 and
The University
of Texas M. D. Anderson Cancer Center, Bastrop, Texas
786022
Received 13 November 1997/Accepted 10 February 1998
 |
ABSTRACT |
The mouse mammary tumor virus (MMTV) encodes within the U3 region
of the long terminal repeat (LTR) a protein known as the superantigen
(Sag). Sag is needed for the efficient transmission of milk-borne virus
from the gut to target tissue in the mammary gland. MMTV-infected B
cells in the gut express Sag as a type II transmembrane protein that is
recognized by the variable region of particular beta chains (V
) of
the T-cell receptor (TCR) on the surface of T cells. Recognition of Sag
by particular TCRs results in T-cell stimulation, release of cytokines,
and amplification of MMTV infection in lymphoid cells that are needed
for infection of adolescent mammary tissue. Because the C-terminal 30 to 40 amino acids of Sag are variable and correlate with recognition of
particular TCR V
chains, we prepared a series of C-terminal Sag
mutations that were introduced into a cloned infectious MMTV provirus.
Virus-producing XC rat cells were used for injection of susceptible
BALB/c mice, and these mice were monitored for functional Sag activity
by the deletion of C3H MMTV Sag-reactive (CD4+
V
14+) T cells. Injected mice also were analyzed for
mutant infection and tumor formation in mammary glands as well as
milk-borne transmission of MMTV to offspring. Most mutations abrogated
Sag function, although one mutation (HPA242) that changed the negative
charge of the extreme C terminus to a positive charge created a weaker
Sag that slowed the kinetics of Sag-mediated T-cell deletion. Despite
the lack of Sag activity, many of the sag mutant viruses
were capable of sporadic infections of the mammary glands of injected
mice but not of offspring mice, indicating that functional Sag
increases the probability of milk-borne MMTV infection. Furthermore,
although most viruses encoding nonfunctional Sags were unable to cause mammary tumors, tumors were induced by such viruses carrying mutations in a negative regulatory element that overlaps the sag gene
within the LTR, suggesting that loss of Sag function may be
compensated, at least partially, by loss of transcriptional suppression
in certain tissues. Together these results confirm the importance of
Sag for efficient milk-borne transmission and indicate that the entire
C-terminal region is needed for complete Sag function.
 |
INTRODUCTION |
Mouse mammary tumor virus
(MMTV) is transmitted through the germ line as integrated
proviral DNA (endogenous viruses) or through maternal milk to
susceptible offspring (exogenous or milk-borne virus) (10).
Milk-borne MMTV infects B cells in gut-associated lymphoid tissue
(29), where superantigen (Sag) is presented at the cell
surface as a type II transmembrane glycoprotein in conjunction with
major histocompatibility complex (MHC) class II protein (25,
32). The Sag-MHC complex interacts with particular variable
regions of the beta chain (V
) of the T-cell receptor (TCR) on the
surface of T cells, causing these cells to release cytokines and to
proliferate (20, 25). The release of cytokines stimulates
neighboring B and T cells to divide, creating additional target cells
for MMTV integration and expanding the pool of cells that previously
have been infected (20, 25). The infected lymphoid cells
then act as a reservoir for infection of the mammary gland when this
tissue begins development during puberty. Recent results have shown
that both T cells and B cells are required for MMTV transmission from
infected milk in the gut to the mammary gland (3, 14, 21).
Other experiments have shown that injection of MMTV-infected
CD4+ or CD8+ T cells as well as infected B
cells will transfer viral infection to susceptible mice
(60).
All known MMTVs encode Sag within the U3 region of the long terminal
repeat (LTR) (5); this region also specifies many of the
viral transcriptional regulatory sequences (6, 23, 36, 37, 42,
47). Expression of the endogenous MMTV Sag proteins results in
the deletion of reactive T cells through the process of negative
selection in the thymus (25), whereas expression of Sag
protein from milk-borne virus is believed to result in stimulation and
proliferation of cognate T cells followed by a gradual deletion of
these cells (40). Thus, the complement of endogenous MMTV
strains determines whether reactive T cells are available for exogenous
MMTV infection (21). Indeed, previous experiments have shown
that expression of the exogenous C3H MMTV sag gene from the
germ line of transgenic animals is sufficient to prevent infection by
milk-borne C3H virus (14).
Sag is a type II transmembrane protein that contains a small N-terminal
intracellular domain (32) and a large extracellular C
terminus that interacts with the V
portion of the TCR
(8). Sequence comparisons of the Sag proteins from several
MMTV strains showed that there was a high degree of
sequence identity between Sag molecules in two regions called
polymorphic regions I (amino acids 164 to 198) and II (from amino acid
288 to the C terminus) (67). C-terminal variability in
polymorphic regions I and II correlated well with observations that
certain Sag molecules reacted with particular TCRs (67);
e.g., the C3H and GR exogenous Sags reacted with T cells bearing V
14
chains (7). Moreover, experiments performed by Yazdanbakhsh
et al. showed that substitution of the polymorphic region II of
endogenous Mtv-1 Sag (V
3 reactive) for the polymorphic
region II of Mtv-7 Sag (V
6 reactive) allowed the
recombinant Sag to react with V
6+ T cells in stable
transfection assays (67). The reciprocal experiment
confirmed that polymorphic Sag region II (30 to 40 amino acids) at the
C terminus is sufficient to specify interactions with certain TCR V
chains (67); however, the C-terminal half of Sag is
insufficient to allow Sag function (34). Alignment of
C-terminal Sag amino acids (Fig. 1)
has been used to construct phylogenetic trees to predict relatedness
among various MMTV strains (5).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
Comparison of C-terminal sequences of MMTV Sag molecules
and their TCR V specificities. Amino acid identities are shown by
dots compared to the C3H MMTV sequence. Sequence information was
obtained from previous reports (1, 2, 17, 24, 26-28, 45, 48, 51,
62, 68, 69). Every effort was made to correct amino acid
sequences from primary references. Gaps have been introduced (shown as
dashes) to maximize amino acid identities. An asterisk indicates the
position of the stop codon.
|
|
Although the C-terminal region of Sag has been shown to specify
interactions with the TCR (67), little is known about the amino acid requirements within this region for Sag function. Therefore, a series of BglII linker substitutions and deletions were
created within the region encoding the C terminus of Sag, and these
substitution mutants were transferred into a cloned, infectious MMTV
provirus (50) for in vivo analysis of C3H Sag function and
effects on MMTV transmission and tumorigenicity. These experiments
showed that virtually all C-terminal amino acid substitutions abolished Sag function and that sag mutant viruses failed to induce
tumors in injected mice. However, mutants that lacked Sag function, but had overlapping mutations in a negative regulatory element (NRE) affecting MMTV transcription (4, 37), retained the ability to induce mammary tumors in mutant-injected animals. All mutants, except one that affected the C-terminal three amino acids and retained
partial Sag function (HPA242), lost the ability to be transmitted
through milk to susceptible offspring. Thus, virtually any mutation
within the C-terminal region alters Sag function.
 |
MATERIALS AND METHODS |
Mice.
BALB/cJ mice were purchased from Jackson Laboratories
(Bar Harbor, Maine). All animals were bred and maintained in our colony at The University of Texas at Austin Animal Resources Center. Animals
were tested at intervals and were free of common bacterial and viral
pathogens, including mouse hepatitis virus. Mice were injected with
2 × 106 XC cells expressing MMTV proviral constructs
into each of five sites, four subcutaneous injections near the mammary
glands proximal to each leg and one intraperitoneal injection
(107 cells in total), as described by Shackleford and
Varmus (50). All injected females were bred continuously to
stimulate lactogenic hormones and MMTV production. Animals were
palpated weekly for the appearance of mammary tumors.
Antibodies and flow cytometry analysis.
Injected mice and
their progeny were bled from the retro-orbital sinus at 1-month
intervals. The peripheral lymphocytes were purified on a Histopaque
cushion (Sigma Chemical Co., St. Louis, Mo.) and then stained with
phycoerythrin-conjugated CD4 and fluorescein-conjugated V
14
antibodies (PharMingen, San Diego, Calif.) as described previously (61). In some cases, when mice were sacrificed for mammary
gland analysis, lymph node cells were obtained and subjected to dual staining with CD4 antibody and a panel of fluorescein-conjugated antibodies specific for V
2, -5, -6, -7, -8, -9, and -14 (all obtained from PharMingen).
Construction and growth of plasmid constructs.
Construction
of the BglII substitution mutants p852, p867, p899, p909,
p924, and p907/924 in the p19-LUC vector (57) was as
described previously (4) except that the 907/924 mutation was CTAGATCTTAGAACATTCAGATCTG
instead of
GAGATCTGTAGAACATTCAGATCTG. The pA
series of deletion constructs were prepared by digesting the wild-type
C3H LTR in pLC1 (43) at the AflII site (
201
relative to the start of MMTV transcription at the U3/R junction) with Bal 31 (New England Biolabs, Beverly, Mass.). Digestion was
terminated at intervals by the addition of EGTA (final concentration of
20 mM), and the Bal 31 nuclease was removed by digestion
with proteinase K, phenol extraction, and ethanol precipitation. The
linear ends of the DNA were filled with Klenow fragment of DNA
polymerase (GIBCO BRL, Gaithersburg, Md.), and the DNA again was phenol
extracted, precipitated with ethanol, and cleaved with ClaI.
The pLC1 vector was cleaved with AflII, the ends were
filled, and the DNA then was digested with ClaI. The large
vector fragment was purified, ligated to the Bal 31-digested
fragment, and used to transform Escherichia coli to
ampicillin resistance. Plasmids from individual transformants were
recovered and sequenced to determine the exact ends of the deletion.
Mutant LTRs were substituted into the 3' LTR of the cloned infectious
provirus of Shackleford and Varmus (50), using mutant LTRs
subcloned into pUC19 (59) as an intermediate; the infectious
provirus contains the 5' LTR and gag-pol region of
Mtv-1 and the envelope region and 3' LTR of C3H MMTV.
Transfections.
Supercoiled wild-type or mutant DNAs (1.8 µg) and 0.2 µg of selectable pSV2neo DNA (54) were
transfected into rat XC cells (31), using Lipofectin (GIBCO
BRL) as recommended by the manufacturer. Cells were selected in
Dulbecco's modified Eagle's medium containing 10% fetal bovine serum
(HyClone Laboratories, Inc., Logan, Utah), streptomycin (50 µg/ml),
penicillin (100 U/ml), and G418 (1 mg/ml; GIBCO BRL) until the
appearance of discrete colonies. Colonies were pooled, and a portion
was extracted for RNA to compare expression levels with those of
wild-type plasmid transfectants. We also measured the amount of virus
produced by Western blotting, by RNase protection experiments, and by
reverse transcriptase assays, but the amount produced was too low to
measure accurately, whereas the RNase protection assays (RPAs)
described here were very quantitative, and the results did not depend
on an enzymatic assay. We have observed that MMTV infection by
inoculation of wild-type-transfected XC cells is faster when the XC
cells are producing more intracellular MMTV RNA as measured by the RPAs
(data not shown), which suggests that virion production is proportional
to intracellular RNA levels.
RNA extractions and RPAs.
RNA extractions were performed
essentially as described by Xu et al. (63) by the
single-step guanidinium method (30) except that an ethanol
precipitation was used instead of an isopropanol precipitation. DNA and
low-molecular-weight RNA were removed from samples by precipitation in
3 M sodium acetate, pH 6.0 (46). RNA was extracted from
mouse milk by the method of Golovkina et al. (16) except
that virus was purified over a 30% sucrose cushion prior to
extraction. RNA levels were determined by absorbance readings at 260 nm. RPAs were performed as described by Yang and Dudley (66)
except that hybridizations were performed at 56°C. The riboprobe
contained the Sau3A fragment (
455 to
116 relative to the
start of MMTV transcription) that includes the sag gene polymorphic region II (50) and the promoter proximal NRE
(4).
DNA extractions and Southern blotting.
High-molecular-weight
DNA was extracted from the HP907/924 tumor and subjected to blotting by
the method of Southern (53) as described previously
(11).
RT-PCRs and cloning of PCR products.
Reverse
transcription-PCRs (RT-PCRs) were performed essentially as described by
Xu et al. (63) except that a random hexamer was used instead
of oligo(dT) for priming cDNA synthesis. RNAs were obtained from the
mammary glands of HPA242-injected mice and progeny of injected mice.
The primers used for PCR of the MMTV LTR U3 region were 5'
GGCATAGCTCTGCTTTGC 3' and 5' AACACTCAGAGCTCAGATCAGAACC 3'.
RT-PCR products were cloned by using the pGEM-T vector (Promega, Madison, Wis.). After selection of independent colonies, plasmid DNA
was extracted, purified by using a JETstar 2.0 Plasmid MIDI Kit 25 (PGC
Scientific, Gaithersburg, Md.), and sequenced by the DNA Sequencing
Facility (Institute for Cellular and Molecular Biology, The University
of Texas at Austin), using fluorescently tagged dideoxynucleotides and
an automated ABI Prism 377 DNA Sequencer (Perkin-Elmer, Foster City,
Calif.).
 |
RESULTS |
In vivo Sag activity of Sag mutant proviral constructs.
Because the C-terminal 30 to 40 amino acids of Sag correlates with
recognition of particular TCR V
chains (Fig. 1) (5) and
because this region directly has been shown by recombinant DNA
switching experiments to confer V
specificity in in vitro transfection experiments (67), we performed deletion and
linker substitution mutagenesis on the C-terminal 35 amino acids of
Sag (Fig. 2A). Although some mutations
truncated Sag due to the formation of a stop codon, other mutations
consisted of a two- to three-amino-acid substitution. These mutations
were inserted into the 3' LTR of the infectious MMTV provirus described
by Shackleford and Varmus (50) and transfected into
rat XC cells, a cell line lacking endogenous MMTVs but permissive
for virus replication (12). Since sag is encoded
within the U3 region of the LTR, transcription of the integrated mutant
virus, followed by proviral replication, will result in the duplication
of the mutation within the 5' LTR (58) (Fig. 2B). Although
this strategy also may produce effects on the transcription of the
integrated provirus, a number of these mutations previously have been
shown to have no effect on basal or glucocorticoid-inducible expression
of the virus (4). This was substantiated by using RPAs and
RNA extracted from pools of XC cell transfectants (Fig.
3). Because of differences with the C3H
LTR riboprobe, RPAs generated readily distinguishable RNase protection
patterns (Fig. 3; compare lanes 1 and 3). Levels of wild-type MMTV
(lane 1) and mutant expression (lanes 3 to 7, 9, 10, and 12) in XC
cells were comparable. sag expression should not be affected
directly by the LTR mutations since the cloned infectious provirus and
C3H MMTV have been shown to express spliced sag mRNA only
from an intragenic envelope promoter (13, 41) and not from
the LTR (64). Also, because Sag is not believed to be a
structural component of MMTV virions, these mutations should not affect
production of virus particles.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
Sequences and positions of C-terminal Sag mutants
expressed from an infectious MMTV provirus. (A) Sequence of the final
40 amino acids of the C3H MMTV Sag (wild type) compared to the
predicted sequence of each mutant. Dashes correspond to identity
between the wild-type and mutant Sag molecules. The numbers for each
mutant refer to the 5' base at the beginning of the introduced
substitution mutation relative to base 1 of the C3H LTR (5),
whereas the deletion mutations (A series) are numbered in negative
numbers relative to the start of transcription; i.e., HPA242 has a
deletion from the AflII site to 242. (B) The 5' half of
the hybrid infectious provirus is composed of the 5' LTR and
gag-pol genes from the endogenous Mtv-1 provirus,
whereas the 3' end is composed of the env and 3' LTR from a
C3H MMTV provirus (50). Mutations are depicted as black bars
within the U3 region of the LTR. Transcription from the 5' LTR produces
a genomic-length transcript that is packaged into virions, used for
translation of the Gag, Gag-Pro, or Gag-Pro-Pol proteins, or spliced to
give mRNAs for other viral proteins. After integration of the mutant
plasmid DNA, genomic transcripts packaged into virions will enter new
cells and be reverse transcribed into proviral DNA so that the unique
regions U5 and U3 (and the U3-associated mutation) are duplicated.
|
|

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 3.
Equivalent transcription of mutant proviruses in stably
transfected XC cells. Total RNA (20 µg) from transfected XC cells was
subjected to an RPA using a riboprobe specific for the C3H LTR.
Protection of the probe by sag mutant RNAs is indicated by
asterisks. Yeast RNA (50 µg) was used as a negative control (lanes 2, 8, 11, and 13). Mtv-1 expression may be due to readthrough
of the 5' LTR in tandemly integrated proviruses or the initiation of
transcription within the U3 region of the Mtv-1 LTR
(19) of the hybrid provirus. RNA from the hybrid provirus
and mutant HP867 gives full-length protection of the riboprobe. The
appearance of full-length protection for HP852 and HP909 appears to be
an artifact of this particular assay. XC rat cells lack endogenous
MMTVs.
|
|
To test the activity of Sag mutant viruses in vivo, we used the
strategy initially described by Shackleford and Varmus (
50)
to show the infectivity and tumorigenicity of their cloned MMTV
provirus. Injection of purified virus was not considered for these
experiments because of the unstable nature of MMTV and the loss
of
infectivity encountered during viral concentration steps
(
50).
Therefore, transfected XC cells were inoculated
subcutaneously
and intraperitoneally into BALB/c weanling mice that
were monitored
for the deletion of C3H MMTV Sag-reactive
(V

14
+) T cells at different intervals after injection.
Although the
deletion of Sag-reactive cells had not been shown
previously by
this method, as expected, mice injected with XC cells
transfected
with the wild-type infectious hybrid provirus (HP/XC)
showed a
37% reduction in the percentage of CD4
+
V

14
+ T cells compared to mice injected with
untransfected XC cells
at 12 weeks and a 52% reduction of cognate T
cells compared to
XC-injected controls at 24 weeks (data not shown).
Therefore,
Sag activity can be determined by injection of
MMTV-expressing
XC cells into adult BALB/c mice.
To maximize our ability to detect mutant Sag activity, mice inoculated
with XC cells expressing
sag mutant MMTVs were analyzed
for
deletion of Sag-reactive T cells (Fig.
4). With the exception
of mutant HPA242,
all mutants were unable to mediate the deletion
of V

14
+
T cells. Furthermore, only three of four mice injected with XC
cells
transfected with the HPA242 mutant deleted cognate T cells,
whereas all
mice of eight injected with transfectants expressing
the wild-type
provirus showed T-cell deletion with similar kinetics
(data not shown).
In addition, the deletion of V

14
+ T cells in
HPA242-injected mice was much less dramatic (6.8%
± 0.6% in infected
mice) than that observed in mice injected with
wild-type provirus
transfectants (4.4% ± 0.8%). Therefore, it
appears that alteration
of almost any amino acid within the C-terminal
35 amino acids is
sufficient to alter Sag function as measured
by deletion of cognate T
cells. Interestingly, the one mutation
tested that appears to retain
some Sag activity (HPA242) completely
changed the charge at the end of
Sag from a negatively charged
glutamic acid to a positively charged
lysine (Fig.
2A).

View larger version (61K):
[in this window]
[in a new window]
|
FIG. 4.
Deletion of V 14+ T cells in mice injected
with XC transfectants or wild-type and sag mutant
constructs. Peripheral blood lymphocytes were obtained from three to
five mice at least 7 months postinjection to maximize the detection of
potential Sag activity. Cells were stained with antibodies to CD4 and
V 14 and analyzed by flow cytometry. Each number shown on the
y axis is a percentage obtained by dividing the number of
double-positive cells (CD4+ V 14+) cells by
the number of CD4+ cells and then multiplying by 100. Standard deviations from the mean are given by error bars. Age-matched
uninfected mice had 10.3% ± 0.4% V 14+ cells of
CD4+ cells. The value given for HPA242 (7.45% ± 1.4%
V 14+ T cells) includes one uninfected animal of four
injected animals; exclusion of this animal gives 6.8% ± 0.6%
V 14+ T cells. Only the wild-type- and mutant
A242-injected animals had statistically different levels of
V 14+ T cells compared to uninfected BALB/c controls.
|
|
Using C3H/HeN transgenic mice expressing the infectious hybrid provirus
with a frameshift mutation in the first one-third
of the
sag
gene (HYB PRO/Cla), Golovkina et al. showed that the
HYB PRO/Cla did
not delete C3H MMTV-cognate T cells, yet the offspring
of these mice
deleted V

14
+ T cells (
15). When virus from
the C3H/HeN offspring was recovered
and sequenced, the region
containing the frameshift had reverted
by recombination with endogenous
Mtv-1 (
15). Although BALB/c
mice do not contain
endogenous
Mtv-1 (
33), we analyzed the first
and
third litters of Sag mutant-injected mice for deletion of
C3H
Sag-reactive T cells to determine if recombination with endogenous
MMTVs would generate functional Sags. Reversion was not observed
in
first- and third-litter offspring of mutant-injected mice (Fig.
5A and
B, respectively), since only the
wild-type- and HPA242-injected
animals showed deletion of
V

14
+ T cells. Again, the Sag encoded by HPA242 was not
as effective
for cognate T-cell deletion as the wild-type C3H Sag,
indicating
that the mutant Sag had not recovered wild-type function by
recombination.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 5.
Deletion of V 14+ T cells in first- and
third-litter progeny of mice injected with XC cell transfectants. (A)
The percentage of V 14+ CD4+ T cells was
determined in first litters of mice injected with transfectants of
wild-type or sag mutant constructs. All animals analyzed
were at least 7 months old. Errors bars indicate standard deviation
from the mean. Offspring of HP852 mutant-injected mice were not
available for analysis. Age-matched uninfected mice had 10.3% ± 0.4%
V 14+ cells of CD4+ cells. Only wild-type-
and HPA242-infected animals had statistically different levels of
V 14+ T cells compared to uninfected BALB/c controls. (B)
The percentage of V 14+ CD4+ cells was
determined in third litters of mice injected with transfectants of
wild-type or sag mutant constructs. All animals analyzed
were at least 7 months old, but offspring of HP852 and HPA263
mutant-injected mice were not available for analysis. Only wild-type-
and HPA242-infected animals had statistically different levels of
V 14+ T cells compared to uninfected BALB/c controls.
|
|
Infection of the mammary gland by Sag mutant MMTVs.
A
considerable amount of evidence documents the need for Sag in the MMTV
infectious cycle (3, 14, 15, 21). However, it is unknown
whether MMTVs lacking functional Sag will infect after injection into
adult mice. Therefore, mammary glands from sag
mutant-injected mice were removed from adult (approximately 1-year-old)
females, and total RNA was extracted. Subsequently, RNA was subjected
to an RPA using a riboprobe that spans the LTR region containing
sag mutations. Because RNase T1 cleaves 3' to unpaired G residues, the riboprobe will be cleaved at regions that have a mismatch between the wild-type and mutant sequences. Mutant
infection of the mammary gland was demonstrable by the appearance of
protected fragments that migrated differently than those protected by
actin and Mtv-6 RNA, e.g., HP852 (asterisks in Fig.
6A, lane 2); such
fragments were characteristic of each mutant and were not observed in
normal BALB/c mammary gland RNA (lane 10). Thus, results from RPAs
showed that most sag mutant viruses were capable of mammary
gland infection, despite their inability to delete cognate T cells.

View larger version (73K):
[in this window]
[in a new window]
|
FIG. 6.
RPAs of sag mutant expression in the mammary
gland. (A) Mammary gland total RNA was extracted from mice injected
with XC transfectants of sag mutant constructs. RPAs were
performed with 10 to 40 µg of total RNA and a riboprobe specific for
the C3H MMTV polymorphic region II. RNA pools were prepared from one to
four injected animals (10 µg/animal). All samples were adjusted to a
total of 50 µg by using yeast RNA. Partial protection of the probe by
sag mutant RNAs is shown by asterisks, whereas the wild-type
RNA gives full-length protection of the probe (lane 1). Other RNA
samples showed small amounts of full-length protection of the riboprobe
compared to uninfected BALB/c mammary gland (lane 10), perhaps
due to the presence of recombinant MMTVs. RPAs from uninfected BALB/c
and MMTV-infected (BALB) (4-month-old) (lane 11) mammary glands
were shown previously (63); they are shown here for
comparative purposes. Lanes 9 and 12 contained only yeast RNA. Actin
riboprobe was included in each hybridization reaction as an internal
control for RNA quality. Partial protection of the C3H riboprobe by
endogenous Mtv-6 RNA also serves as an internal control; the
position of the Mtv-6-specific fragments varies because
lanes were derived from different gels. (B) Total RNA was prepared from
the mammary glands of mice injected with XC transfectants with pHP924.
RNA (20 µg) from individual mice was analyzed (lanes 1 to 5) as
described for panel A. The partial protection of the riboprobe expected
of the HP924 mutation is indicated at the right; the protection pattern
expected of endogenous Mtv-6 is shown at the left. (C) Total
RNA was prepared from the mammary glands of mice injected with XC
transfectants with pHP899. RNA (20 µg) from individual mice was
analyzed (lanes 1 to 4) as described for panel A. The partial
protection of the probe expected of the HP899 mutations is shown at the
right; protected fragments expected of endogenous Mtv-6 RNA
are shown at the left. High-level expression of a recombinant virus can
be observed in lane 4. (D) Total RNA was prepared from the mammary
glands of mice injected with XC transfectants of pHPA242 (lanes 2 to 5)
or three first-litter offspring of these injected mice (lanes 6 to 8).
RNA (20 µg) from individual mice was used in an RPA with C3H
MMTV-specific riboprobe (lanes 2 to 8). An RPA using 10 µg of total
RNA from XC transfectants is shown as a control in lane 1; because the
results of this RPA were analyzed on a separate gel, the
HPA242-specific bands in lane 1 and those in lanes 2 to 8 migrate
differently. Bands shown just below the probe in lanes 2 and 5 are an
artifact. A longer exposure of the gel revealed expression of HPA242 in
the mammary gland of mouse 1 of the first litter (not shown).
|
|
Although analysis of V

14
+ T cells in injected mice
indicated that
sag mutants did not revert to give wild-type
C3H Sag function,
most mutants protected RNA fragments, consistent with
the expression
of endogenous
Mtv-8 and/or
Mtv-9
RNAs. Since expression of
Mtv-8 and
Mtv-9 RNAs is
not detectable in normal BALB/c mammary glands
(
63), these
results suggested that
Mtv-8 or
Mtv-9 recombined
with the
sag mutant viruses to produce novel MMTVs. Such
novel
MMTVs must lack Sags with reactivity for V

14
+
TCRs.
Because mammary glands from several mice injected with the same mutant
were pooled and analyzed (Fig.
6A), it was unclear
whether all of the
injected mice were infected. When mammary glands
from mice injected
with HP924 transfectants were analyzed individually,
RPAs showed that
only one of the five injected mice was infected
by the mutant virus
(Fig.
6B, lane 5). Similarly, only one of
the four mice injected with
HP899 transfectants was infected with
predominantly mutant virus (Fig.
6C, lane 3), and another of the
four mice appeared to be infected with
high levels of a recombinant
virus that protected a fragment
typical of endogenous
Mtv-8 or
Mtv-9 (Fig.
6C,
lane 4). Thus, the ability of MMTV to infect the
mammary gland under
these conditions is enhanced by, but does
not require, Sag activity.
Although this was not a statistically significant difference, only
three of the four mice injected with HPA242 transfectants
showed
deletion of V

14
+ cells, whereas all mice injected with
wild-type transfectants
showed deletion of these cells (Fig.
4).
Because of the observed
variability of HPA242 infection and because
infection by this
mutant caused lower levels of deletion than that
observed with
the wild-type virus, it was possible that HPA242 virus,
but not
other viruses, gained Sag activity by recombination with
endogenous
MMTVs. Because HPA242 encodes a deletion of ~40 bp,
reversion
of this mutation likely would change the RNase protection
pattern
of the expressed virus in the mammary gland relative to that
observed
in the HPA242-transfected cells. When the mammary glands of
mice
injected with HPA242 transfectants were analyzed individually
by
RPA, the protection pattern matched that of the virus expressed
in
the XC cell transfectants (Fig.
6D). Additionally, lack of
revertant
virus in the mammary glands of mice injected with HPA242
transfectants
was confirmed by sequencing of RT-PCR products obtained
using LTR
primers and RNA from mammary glands of injected mice
or progeny of
these mice (data not shown). The data suggest that
HPA242 encodes a
functional Sag, since all mice infected by the
HPA242 virus deleted
V

14
+ T cells, whereas an injected mouse that remained
uninfected showed
no V

14
+ deletion. This conclusion is
supported by our failure to detect
reversion of the HPA242 mutation as
well as by the similar low
level of deletion observed in first- and
third-litter offspring
of HPA242-injected animals (Fig.
5).
Requirement for Sag activity during milk-borne MMTV
transmission.
Because injection of mice with MMTV-infected cells
may have bypassed the need for Sag, the offspring of injected mice were monitored for mammary gland infection. If Sag is needed to establish infection in gut-associated lymphocytes, neonates receiving virus lacking Sag activity will remain uninfected. Thus, mammary glands from
first and third litters of mutant-injected mice were analyzed by RPA
(Fig. 7A and B, respectively). Although
some mutant-injected mice did not have offspring that could be
examined, the available results indicated that MMTV infection occurred
only in progeny of wild-type- and HPA242-injected animals (Fig. 7A,
lanes 1 and 9, respectively; Fig. 7B, lane 1). Also HP867-injected mice
showed mutant virus in the milk, but this virus was not transmitted to offspring (data not shown). Because progeny of wild-type- and HPA242-injected animals were the only offspring of injected animals to
show V
14+ T-cell deletion, these results suggested that
Sag is needed to establish infection in gut-associated lymphoid tissue.
Although it is possible that the mammary glands of mice injected with
virus lacking Sag activity had produced insufficient virus to establish viral infection in their offspring, our previous results with a
sag frameshift virus argue against this explanation
(15).

View larger version (46K):
[in this window]
[in a new window]
|
FIG. 7.
Mammary gland expression of sag mutants in
first and third litters of mice injected with XC transfectants. (A)
Mammary gland total RNA (10 to 40 µg) of first-litter offspring of
injected mice was used for an RPA with a C3H MMTV-specific riboprobe.
RNA from one to four females was pooled (10 µg/animal) and adjusted
to a total of 50 µg by using yeast tRNA. Actin riboprobe was added to
all samples as an internal control. Yeast tRNA was used as a negative
control (lane 10). Pools of two different litters of HP924-injected
mice are shown. (B) Mammary gland total RNA (10 to 40 µg) of
third-litter offspring of injected mice was used for an RPA with a C3H
MMTV-specific riboprobe. Other parameters were the same as those
described for panel A.
|
|
Tumorigenesis in injected animals.
MMTV induces mammary tumors
by insertion of proviral DNA near proto-oncogenes that are silent
transcriptionally in mature mammary glands (35, 38, 39).
Enhancers within the viral LTR apparently activate
proto-oncogene transcription, leading to aberrant growth of mammary
epithelial tissues. Because tumorigenesis is believed to be a multistep
process (38), MMTV integration at other chromosomal sites
increases the likelihood that initial growth stimulation will lead to
the formation of tumor cells. Since integration near any given gene is
a relatively random event, increased levels of retroviral replication
and integration will increase the chance of tumor formation.
Because the mammary glands of injected mice were infected to
different extents, animals were subjected to continuous
breeding
and monitored for the formation of mammary
tumors. Approximately
63% (five of eight) of wild-type virus-injected
animals developed
mammary cancers with an average latency of 9 months
(Table
1).
This is similar to the average
latency of MMTV-induced mammary
tumors in C3H/HeN Mtv
+ mice
(9 months) (
18) or BALB/c mice injected by XC cells
producing
the hybrid infectious MMTV provirus (57% of injected females
had
tumors with an average latency of 7.3 months) (
65).
Although
Shackleford et al. observed a higher frequency of mammary
tumors
induced by injection of hybrid MMTV-producing XC cells (89%
with
an average latency of 6.5 months) (
49), the increased
tumor
frequency may be due to inoculation of XC cells producing higher
levels of MMTV (our unpublished results).
HPA242, the only
sag mutant shown to have Sag activity,
caused tumors in two of four injected mice (50%) with an average
latency
of 12 months (Table
1); however, only three of four injected
mice had detectable MMTV infection. Most of the other mutants
were
unable to cause tumors, despite the ability of these mutants
to infect
the mammary glands following injection. Interestingly,
mammary tumors
were produced by viruses containing mutations in
an LTR region shown to
be important for negative regulation of
MMTV expression in lymphoid
tissues (
37). Despite its lack of
Sag activity, HP924 caused
tumors in one of eight injected females
(13%) with a latency of 11 months (Table
1); this tumor frequency
is higher (one of two, or 50%)
among females shown to be infected
by RPAs. The HP924 mutation is
located in the 3' half of an imperfect
inverted repeat within a
promoter-proximal NRE (
37). Mice injected
with virus
containing mutations in both the 5' and 3' halves of
the inverted
repeat (HP907/924) developed tumors at a frequency
equivalent to that
of viruses encoding functional Sags (67%) despite
a longer latency (12 months) (Table
1). Mammary tumors induced
by mutant viruses
showed expression of the injected virus as detected
by RPAs (Fig.
8, lanes 1 to 7), and integration of the
mutant
provirus was detectable by using a
BglII restriction
enzyme polymorphism
and Southern blotting (data not shown). The tumors
induced by
mutant viruses were type B adenocarcinomas, typical of
mammary
tumors induced by wild-type MMTV (
44). All viruses
lacking Sag
activity, except those containing mutations at the 924 site
in
the proximal MMTV NRE (
4,
37), were unable to cause
mammary
tumors (0 of 22 injected mice).

View larger version (86K):
[in this window]
[in a new window]
|
FIG. 8.
Detection of sag mutants in mammary tumors of
injected mice. Mice that developed tumors were sacrificed, and total
RNA was extracted from the tumors and normal mammary gland. The RNA (20 µg) was subjected to an RPA using the C3H MMTV-specific riboprobe.
One mouse injected with XC cells transfected with pHP924 developed two
tumors (T1 and T2; lanes 2 and 3, respectively). Two tumors from
individual mice injected with XC cells transfected with pHP907/924 were
analyzed (lanes 5 and 7). Normal mammary gland (MG) RNA from each mouse
also is shown (lanes 1, 4, and 6). Actin riboprobe was added to
hybridizations as a control for RNA integrity. Yeast RNA was used as a
negative control (lane 8).
|
|
 |
DISCUSSION |
Abrogation of Sag function by most C-terminal mutations.
All
known MMTVs encode functional Sags, and comparison of the primary
sequences of MMTV Sags shows high amino acid conservation in all but
two polymorphic regions (5, 67). Only the C-terminal polymorphic 30 to 40 amino acids (region II) has been shown to determine the specificity of interaction with the variable portion of
the TCR
chain (67). The viruses used in this study
encoded mutations that spanned the C-terminal 35 amino acids. Since
most mutations led to loss of MMTV Sag activity, including one mutant (HP909) encoding a two-amino-acid substitution, the entire C-terminal region appears to be important for Sag function, including TCR interactions. Nevertheless, we cannot exclude the possibility that the
majority of C-terminal mutations tested prevent Sag presentation, since
no reagents are available for the detection of C3H-specific Sag
protein. Interestingly, the HPA242 mutation, encoding a basic lysine
residue at the extreme C terminus of Sag, was functional, despite the
fact that all other V
14-reactive Sags terminate with acidic residues
(Fig. 1). However, this change impaired the ability of the HPA242 virus
to cause deletion (Fig. 4 and 5).
All mice infected with HPA242 had similar residual populations of
V

14
+ T cells in their immune repertoire at 7 months
postinfection
(Fig.
4 and
5). Either the remaining population was
unreactive
with the HPA242 Sag, or these cells were reactive but their
kinetics
of deletion were very slow. What might distinguish the
reactive
versus the nonreactive V

14
+ cells? Some Sags
are unreactive with normally reactive TCR
chains when they are
paired with particular

chains (
55). If
the HPA242 Sag
stimulates only V

14
+ T cells that expressed particular
variable regions on their
chains, then deletion of
V

14
+ T cells would cease when the reactive cells have
been depleted.
This latter scenario did not occur since deletion of
V

14
+ cells in HPA242-infected mice never appeared to
stop. However,
the rate of deletion was twice as slow in these mice as
in mice
infected with the wild-type virus (data not shown). Therefore,
it is likely that levels of V

14
+ T cells in
HPA242-infected mice eventually will equal that of
the
wild-type-infected mice with time.
Infection of the mammary gland by viruses lacking Sag
activity.
The importance of Sag in the MMTV infectious cycle is
well established. Golovkina et al. demonstrated the requirement of
Sag-reactive T cells for MMTV infection (14), and
subsequently the necessity of Sag-presenting B cells for MMTV
infectivity was shown (3). Selection for functional
Sags during milk-borne infection was observed following isolation of
MMTVs encoding functional Sags from mammary glands of mice
receiving MMTVs encoding a nonfunctional Sag (15). Although
all evidence suggests that there is a strong selection for MMTVs
encoding active Sag proteins, it is not known whether Sag is necessary
for infection of mammary glands by MMTV. This study indicates that Sag
is not required for mammary gland infection if virus-producing cells
are introduced intraperitoneally and subcutaneously into susceptible
mice. Clearly, MMTV infection of mammary glands resulted from injection
of mice with XC cells expressing MMTVs encoding nonfunctional Sag
proteins (Fig. 6). However, there was a direct correlation between
functional Sag activity and the likelihood of mammary gland infection.
All mice injected with wild-type transfectants showed mammary gland
infection, whereas only three of four mice injected with HPA242
transfectants had infected mammary glands. Furthermore, the mammary
glands of mice injected with transfectants expressing nonfunctional
sag genes were infected sporadically (Fig. 6). Therefore,
Sag activity greatly increases the probability that MMTV will infect
its host.
It may be argued that
sag mutant viruses infecting mammary
glands sustained further mutations to restore Sag function and
that
this activity was overlooked by analyzing the V

14
+
population. However, when the percentages of several other T-cell
subsets expressing different V

chains were compared in infected
versus uninfected animals, no significant differences were observed
for
the deletion of the particular T-cell subsets tested (V

2,
-5, -6, -7, -8, -9, and -14), nor did we observe in any of the
subsets
analyzed a compensatory increase that would indicate deletion
of
a T-cell subset not tested (data not shown). Also, all viruses
maintained their characteristic riboprobe protection pattern in
RPAs
with RNA extracted from mammary glands of injected animals
(Fig.
6).
Finally, if the infecting mutant viruses contained compensatory
mutations or if the original mutation encoded a Sag of unknown
specificity, it is likely that these viruses would be infectious
for
susceptible offspring. However, only the offspring of mice
injected
with MMTVs causing deletion of V

14
+ T cells showed
infection of the mammary glands by milk-borne
MMTV (Fig.
7).
The lack of MMTV infection of the first and third litters of mice
injected with Sag mutant-expressing cells suggested that
Sag was
necessary for infection of lymphoid cells in the gut.
Alternatively, the newborns received a very limited amount of
virus from the
sag mutant-injected mothers. The
limited amount
of virus in maternal milk combined with the lack
of functional
Sag activity resulted in failure to transmit MMTV to
offspring
of most mutant-injected mice. This implies that Sag greatly
increases
the probability of MMTV infection, and without functional
Sag,
MMTV infection is sporadic and inefficient. Given the selection
against MMTV-infected individuals due to the development of mammary
tumors, transmission of virus to all members of a population eliminates
the selective disadvantage of MMTV infection. Indeed, the loss
of MHC
class II I-E expression by some mouse strains (
1) suggests
that such a selective pressure (either MMTV or another pathogen
encoding Sag) may have existed in the past.
Similarities in the N- and C-terminal portions of Sag have been used to
deduce phylogenetic relationships among MMTV species
(
5).
Given the sensitivity of the Sag C terminus to amino acid
substitutions, our study indicates that C-terminal comparisons
of MMTV
Sags for phylogenetic studies probably are misleading.
There is
substantial pressure on MMTV Sag to encode a functional
Sag that allows
efficient infection of the mammary gland (reference
15 and this study), and Sag must react with a TCR
displaying
a V

specificity different from that of endogenous MMTV
Sags expressed
in the host (
14,
21). This pressure combined
with very limited
combinations of amino acids that form a functional
Sag would allow
chance mutations in very divergent viruses to appear
highly related.
Therefore, similarities in the carboxyl terminus of
MMTV Sags
may be the result of convergent evolution. Phylogenetic
comparisons
of MMTV strains are more meaningful when the highly
conserved
regions of Sag or the viral structural genes are compared.
Tumor induction by MMTVs with NRE mutations.
Surprisingly,
some MMTV mutants were able to cause tumors despite their lack of Sag
activity. These mutants contained alterations in a region of the LTR
(NRE) that is important for the negative regulation of MMTV
transcription (4, 22). The NRE region is composed of
promoter-proximal and promoter-distal elements that have binding sites
for the nuclear matrix-associated region-binding proteins SATB1 and
Cux/CDP. Both proteins are homeodomain-containing transcription factors
that have been associated with tissue-specific expression of promoters
to which they bind (9, 37, 52, 56). A mutation in the 3'
half of an imperfect inverted repeat in the proximal NRE (called 924)
resulted in high-level expression from the C3H MMTV LTR in lymphoid
tissue (37) and increased LTR-directed reporter gene
expression in transient transfection assays (4). The 924 mutation and a mutation in both halves of the inverted repeat in the
proximal NRE (907/924) were introduced into the wild-type infectious
provirus and transfected into XC cells. Injection of XC cells producing
the 924 and 907/924 viruses each caused mammary tumors (Table 1),
despite the lack of detectable Sag activity encoded by these viruses.
The ability of NRE mutant viruses to cause tumors may be explained in
at least two nonmutually exclusive ways. First, the
increased
expression of such viruses in lymphoid cells may lead
to greater
numbers of infected mammary cells and random mutagenic
events leading
to tumor formation. Second, MMTV expression in
mammary tissue may be
restricted to periods of pregnancy and lactation,
since the NRE binding
activities of SATB1 and Cux/CDP are detectable
in virgin mammary gland
(
36a), but these activities are undetectable
in the
lactating mammary gland (
37). Thus, NRE mutation may
allow
viral integration and expression at all stages of mammary
development,
whereas the presence of SATB1 and Cux in developing
mammary gland may
diminish wild-type MMTV expression in developing
breast tissue. Loss of
transcriptional suppression may result
in increased MMTV integrations
and increased tumorigenesis by
NRE mutants; however, loss of Sag
activity by such mutants partially
may obscure the transcriptional
advantage of NRE mutants over
wild-type MMTV. Thus, we predict that NRE
mutant viruses with
functional Sag will develop tumors very rapidly.
However, not
all NRE mutations have the same effect, since the HP909
virus
(also carrying a mutation in the proximal NRE) does not appear
to
induce mammary tumors (Table
1).
Why would MMTV encode elements, like the NRE, that suppress viral
spread? While transcriptional suppression of MMTV may be
a means
to minimize immune system detection, it also is possible
that loss of
the NRE in the presence of a functional Sag yields
MMTVs that cause
tumors at a very young age (within a few litters).
Since early
tumorigenesis will limit MMTV spread by decreasing
the number of
offspring produced by an infected mouse, early-appearing
mammary tumors
likely will be an unwanted by-product of efficient
MMTV replication.
However, by suppressing MMTV expression until
viral particles are
needed for transmission during lactation,
the presence of the NRE will
decrease mortality compared to MMTV
strains lacking this element and
thereby increase the number of
offspring receiving virus.
 |
ACKNOWLEDGMENTS |
We thank Susan Ross and Tatyana Golovkina for useful discussions
and Lakshmi Rajan for the Southern blot analysis.
This work was supported by grants R01 CA34780 and R01 CA52646 from the
National Institutes of Health. T.J.W. was supported by NIH training
grant T32 CA09583.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Institute for Cellular and Molecular Biology, The
University of Texas at Austin, Austin, TX 78712. Phone: (512) 471-8415. Fax: (512) 471-7088. E-mail:
jdudley{at}uts.cc.utexas.edu.
Present address: Arnold, White & Durkee, Austin, Tex.
 |
REFERENCES |
| 1.
|
Acha-Orbea, H., and H. R. MacDonald.
1995.
Superantigens of mouse mammary tumor virus.
Annu. Rev. Immunol.
13:459-486[Medline].
|
| 2.
|
Ando, Y.,
W. Wajjwalku,
N. Niimi,
K. Hiromatsu,
T. Morishima, and Y. Yoshikai.
1995.
Concomitant infection with exogenous mouse mammary tumor virus encoding I-E-dependent superantigen in I-E-negative mouse strain.
J. Immunol.
154:6219-6226[Abstract].
|
| 3.
|
Beutner, U.,
E. Kraus,
D. Kitamura,
K. Rajewsky, and B. T. Huber.
1994.
B cells are essential for murine mammary tumor virus transmission, but not for presentation of endogenous superantigens.
J. Exp. Med.
179:1457-1466[Abstract/Free Full Text].
|
| 4.
|
Bramblett, D.,
C.-L. L. Hsu,
M. Lozano,
K. Earnest,
C. Fabritius, and J. Dudley.
1995.
A redundant nuclear protein binding site contributes to negative regulation of the mouse mammary tumor virus long terminal repeat.
J. Virol.
69:7868-7876[Abstract].
|
| 5.
|
Brandt-Carlson, C.,
J. S. Butel, and D. Wheeler.
1993.
Phylogenetic and structural analyses of MMTV LTR ORF sequences of exogenous and endogenous origins.
Virology
193:171-185[Medline].
|
| 6.
|
Cavin, C., and E. Buetti.
1995.
Tissue-specific and ubitquitous factors binding next to the glucocorticoid receptor modulate transcription from the mouse mammary tumor virus promoter.
J. Virol.
69:3759-3770[Abstract].
|
| 7.
|
Choi, Y.,
J. W. Kappler, and P. Marrack.
1991.
A superantigen encoded in the open reading frame of the 3' long terminal repeat of the mouse mammary tumour virus.
Nature
350:203-207[Medline].
|
| 8.
|
Choi, Y.,
P. Marrack, and J. W. Kappler.
1992.
Structural analysis of a mouse mammary tumor virus superantigen.
J. Exp. Med.
175:847-852[Abstract/Free Full Text].
|
| 9.
|
Dickinson, L. A.,
C. D. Dickinson, and T. Kohwi-Shigematsu.
1997.
An atypical homeodomain in SATB1 promotes specific recognition of the key structural element in a matrix attachment region.
J. Biol. Chem.
272:11463-11470[Abstract/Free Full Text].
|
| 10.
|
Dudley, J.
1994.
Mouse mammary tumor virus, p. 853-861.
In
R. G. Webster, and A. Granoff (ed.), Encyclopedia of virology. Academic Press, New York, N.Y.
|
| 11.
|
Dudley, J., and R. Risser.
1984.
Amplification and novel locations of endogenous mouse mammary tumor virus genomes in mouse T-cell lymphomas.
J. Virol.
49:92-101[Abstract/Free Full Text].
|
| 12.
|
Dudley, J. P., and H. E. Varmus.
1981.
Purification and translation of murine mammary tumor virus mRNA's.
J. Virol.
39:207-218[Abstract/Free Full Text].
|
| 13.
|
Elliott, J. F.,
B. Pohajdak,
D. J. Talbot,
J. Shaw, and V. Paetkau.
1988.
Phorbol diester-inducible, cyclosporine-suppressible transcription from a novel promoter within the mouse mammary tumor virus env gene.
J. Virol.
62:1373-1380[Abstract/Free Full Text].
|
| 14.
|
Golovkina, T. V.,
A. Chervonsky,
J. P. Dudley, and S. R. Ross.
1992.
Transgenic mouse mammary tumor virus superantigen expression prevents viral infection.
Cell
69:637-645[Medline].
|
| 15.
|
Golovkina, T. V.,
J. P. Dudley,
A. B. Jaffe, and S. R. Ross.
1995.
Mouse mammary tumor viruses with functional superantigen genes are selected during in vivo infection.
Proc. Natl. Acad. Sci. USA
92:4828-4832[Abstract/Free Full Text].
|
| 16.
|
Golovkina, T. V.,
A. B. Jaffe, and S. R. Ross.
1994.
Coexpression of exogenous and endogenous mouse mammary tumor virus RNA in vivo results in viral recombination and broadens the virus host range.
J. Virol.
68:5019-5026[Abstract/Free Full Text].
|
| 17.
|
Golovkina, T. V.,
I. Piazzon,
I. Nepomnaschy,
V. Buggiano,
M. de Olano Vela, and S. R. Ross.
1997.
Generation of a tumorigenic milk-borne mouse mammary tumor virus by recombination between endogenous and exogenous viruses.
J. Virol.
71:3895-3903[Abstract].
|
| 18.
|
Golovkina, T. V.,
J. A. Prescott, and S. R. Ross.
1993.
Mouse mammary tumor virus-induced tumorigenesis in sag transgenic mice: a laboratory model of natural selection.
J. Virol.
67:7690-7694[Abstract/Free Full Text].
|
| 19.
|
Gunzburg, W. H.,
F. Heinemann,
S. Wintersperger,
T. Miethke,
H. Wagner,
V. Erfle, and B. Salmons.
1993.
Endogenous superantigen expression controlled by a novel promoter in the MMTV long terminal repeat.
Nature
364:154-158[Medline].
|
| 20.
|
Held, W. H.,
H. Acha-Orbea,
H. R. MacDonald, and G. A. Waanders.
1994.
Superantigens and retroviral infection: insights from mouse mammary tumor virus.
Immunol. Today
15:184-190[Medline].
|
| 21.
|
Held, W.,
G. A. Waanders,
A. N. Shakhov,
L. Scarpellino,
H. Acha-Orbea, and H. R. MacDonald.
1993.
Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission.
Cell
74:529-540[Medline].
|
| 22.
|
Hsu, C. L.,
C. Fabritius, and J. Dudley.
1988.
Mouse mammary tumor virus proviruses in T-cell lymphomas lack a negative regulatory element in the long terminal repeat.
J. Virol.
62:4644-4652[Abstract/Free Full Text].
|
| 23.
|
Huang, M.,
J. W. Lee, and D. O. Peterson.
1993.
Functional redundancy of octamer elements in the mouse mammary tumor virus promoter.
Nucleic Acids Res.
21:5235-5241[Abstract/Free Full Text].
|
| 24.
|
Ignatowicz, L.,
J. W. Kappler,
P. Marrack, and M. T. Scherer.
1994.
Identification of two V 7-specific viral superantigens.
J. Immunol.
152:65-71[Abstract].
|
| 25.
|
Janeway, C. A.
1991.
Mls: makes a little sense.
Nature
349:459-461[Medline].
|
| 26.
|
Jouvin-Marche, E.,
P. A. Cazenave,
D. Voegtle, and P. N. Marche.
1992.
V 17 T-cell deletion by endogenous mammary tumor virus in wild-type-derived mouse strain.
Proc. Natl. Acad. Sci. USA
89:3232-3235[Abstract/Free Full Text].
|
| 27.
|
Jouvin-Marche, E.,
P. N. Marche,
A. Six,
C. Liebe-Gris,
D. Voegtle, and P. A. Cazenave.
1993.
Identification of an endogenous mammary tumor virus involved in the clonal deletion of V 2 T cells.
Eur. J. Immunol.
23:2758-2764[Medline].
|
| 28.
|
Kang, J. J.,
T. Schwegel, and J. E. Knepper.
1993.
Sequence similarity between the long terminal repeat coding regions of mammary-tumorigenic BALB/cV and renal-tumorigenic C3H-K strains of mouse mammary tumor virus.
Virology
196:303-308[Medline].
|
| 29.
|
Karapetian, O.,
A. N. Shakhov,
J.-P. Kraehenbuhl, and H. Acha-Orbea.
1994.
Retroviral infection of neonatal Peyer's patch lymphocytes: the mouse mammary tumor virus model.
J. Exp. Med.
180:1511-1516[Abstract/Free Full Text].
|
| 30.
|
Kingston, R. E.,
P. Chomczynski, and N. Sacchi.
1991.
Guanidinium methods for total RNA preparation, p. 4.2.1-4.2.9.
In
F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.), Current protocols in molecular biology. John Wiley & Sons, Inc., New York, N.Y.
|
| 31.
|
Klement, V.,
W. P. Rowe,
J. W. Hartley, and W. E. Pugh.
1969.
Mixed culture cytopathogenicity: a new test for growth of murine leukemia viruses in tissue culture.
Proc. Natl. Acad. Sci. USA
63:753-758[Abstract/Free Full Text].
|
| 32.
|
Korman, A. J.,
P. Bourgarel,
T. Meo, and G. E. Rieckhof.
1992.
The mouse mammary tumour virus long terminal repeat encodes a type II transmembrane glycoprotein.
EMBO J.
11:1901-1905[Medline].
|
| 33.
|
Kozak, C.,
G. Peters,
R. Pauley,
V. Morris,
R. Michalides,
J. Dudley,
M. Green,
M. Davisson,
O. Prakash,
A. Vaidya,
J. Hilgers,
A. Verstraeten,
N. Hynes,
H. Diggelmann,
D. Peterson,
J. C. Cohen,
C. Dickson,
N. Sarkar,
R. Nusse,
H. Varmus, and R. Callahan.
1987.
A standardized nomenclature for endogenous mouse mammary tumor viruses.
J. Virol.
61:1651-1654[Abstract/Free Full Text].
|
| 34.
|
Lambert, J. F.,
H. Acha-Orbea,
E. Kolb, and H. Diggelmann.
1993.
The 3' half of the mouse mammary tumor virus orf gene is not sufficient for its superantigen function in transgenic mice.
Mol. Immunol.
30:1399-1404[Medline].
|
| 35.
|
Lee, F. S.,
T. F. Lane,
A. Kuo,
G. Shackleford, and P. Leder.
1995.
Insertional mutagenesis identifies a member of the Wnt gene family as a candidate oncogene in the mammary epithelium of int-2/Fgf-3 mice.
Proc. Natl. Acad. Sci. USA
92:2268-2272[Abstract/Free Full Text].
|
| 36.
|
Lee, J. W.,
P. G. Moffitt,
K. L. Morley, and D. O. Peterson.
1991.
Multipartite structure of a negative regulatory element associated with a steroid hormone-inducible promoter.
J. Biol. Chem.
266:24101-24108[Abstract/Free Full Text].
|
| 36a.
| Liu, J. Unpublished data.
|
| 37.
|
Liu, J.,
D. Bramblett,
Q. Zhu,
M. Lozano,
R. Kobayashi,
S. R. Ross, and J. P. Dudley.
1997.
The matrix attachment region-binding protein SATB1 participates in negative regulation of tissue-specific gene expression.
Mol. Cell. Biol.
17:5275-5287[Abstract].
|
| 38.
|
MacArthur, C. A.,
D. B. Shankar, and G. M. Shackleford.
1995.
Fgf-8, activated by proviral insertion, cooperates with the Wnt-1 transgene in murine mammary tumorigenesis.
J. Virol.
69:2501-2507[Abstract].
|
| 39.
|
Marchetti, A.,
F. Buttitta,
S. Miyazaki,
D. Gallahan,
G. H. Smith, and R. Callahan.
1995.
Int-6, a highly conserved, widely expressed gene, is mutated by mouse mammary tumor virus in mammary preneoplasia.
J. Virol.
69:1932-1938[Abstract].
|
| 40.
|
Marrack, P.,
E. Kushnir, and J. Kappler.
1991.
A maternally inherited superantigen encoded by a mammary tumour virus.
Nature
349:524-526[Medline].
|
| 41.
|
Miller, C. L.,
R. Garner, and V. Paetkau.
1992.
An activation-dependent, T-lymphocyte-specific transcriptional activator in the mouse mammary tumor virus env gene.
Mol. Cell. Biol.
12:3262-3272[Abstract/Free Full Text].
|
| 42.
|
Mink, S.,
E. Hartig,
P. Jennewein,
W. Doppler, and A. C. Cato.
1992.
A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.
Mol. Cell. Biol.
12:4906-4918[Abstract/Free Full Text].
|
| 43.
|
Morley, K. L.,
M. G. Toohey, and D. O. Peterson.
1987.
Transcriptional repression of a hormone-responsive promoter.
Nucleic Acids Res.
15:6973-6989[Abstract/Free Full Text].
|
| 44.
|
Nandi, S., and C. M. McGrath.
1973.
Mammary neoplasia in mice.
Adv. Cancer Res.
17:353-414.
|
| 45.
|
Niimi, N.,
W. Wajjwalku,
Y. Ando,
N. Nakamura,
M. Ueda, and Y. Yoshikai.
1995.
A novel V 2-specific endogenous mouse mammary tumor virus which is capable of producing a milk-borne exogenous virus.
J. Virol.
69:7269-7273[Abstract].
|
| 46.
|
Palmiter, R. D.
1974.
Magnesium precipitation of ribonucleoprotein complexes. Expedient techniques for the isolation of undegraded polysomes and messenger ribonucleic acid.
Biochemistry
13:3606-3615[Medline].
|
| 47.
|
Payvar, F.,
D. DeFranco,
G. L. Firestone,
B. Edgar,
O. Wrange,
S. Okret,
J. A. Gustafsson, and K. R. Yamamoto.
1983.
Sequence-specific binding of glucocorticoid receptor to MTV DNA at sites within and upstream of the transcribed region.
Cell
35:381-392[Medline].
|
| 48.
|
Rosenwasser, O. A.,
S. Fairchild, and K. Tomonari.
1993.
New superantigen specificity created by two amino acid replacements.
Immunogenetics
38:367-369[Medline].
|
| 49.
|
Shackleford, G. M.,
C. A. MacArthur,
H. C. Kwan, and H. E. Varmus.
1993.
Mouse mammary tumor virus infection accelerates mammary carcinogenesis in Wnt-1 transgenic mice by insertional activation of int-2/Fgf-3 and hst/Fgf-4.
Proc. Natl. Acad. Sci. USA
90:740-744[Abstract/Free Full Text].
|
| 50.
|
Shackleford, G. M., and H. E. Varmus.
1988.
Construction of a clonable, infectious, and tumorigenic mouse mammary tumor virus provirus and a derivative genetic vector.
Proc. Natl. Acad. Sci. USA
85:9655-9659[Abstract/Free Full Text].
|
| 51.
|
Sherer, M. T.,
L. Ignatowicz,
A. Pullen,
J. Kappler, and P. Marrack.
1995.
The use of mammary tumor virus (Mtv)-negative and single-Mtv mice to evaluate the effects of endogenous viral superantigens on the T cell repertoire.
J. Exp. Med.
182:1493-1504[Abstract/Free Full Text].
|
| 52.
|
Skalnik, D. G.,
E. C. Strauss, and S. H. Orkin.
1991.
CCAAT displacement protein as a repressor of the myelomonocytic-specific gp91-phox gene promoter.
J. Biol. Chem.
266:16736-16744[Abstract/Free Full Text].
|
| 53.
|
Southern, E. M.
1975.
Detection of specific sequences among DNA fragments separated by gel electrophoresis.
J. Mol. Biol.
98:503-517[Medline].
|
| 54.
|
Southern, P. J., and P. Berg.
1982.
Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter.
J. Mol. Appl. Genet.
1:327-341[Medline].
|
| 55.
|
Vacchio, M. S.,
O. Kanagawa,
K. Tomonari, and R. J. Hodes.
1992.
Influence of T cell receptor V expression on Mlsa superantigen-specific T cell responses.
J. Exp. Med.
175:1405-1408[Abstract/Free Full Text].
|
| 56.
|
Valarche, I.,
J.-P. Tissier-Seta,
M.-R. Hirsch,
S. Martinez,
C. Goridis, and J.-F. Brunet.
1993.
The mouse homeodomain protein Phox2 regulates Ncam promoter activity in concert with Cux/CDP and is a putative determinant of neurotransmitter phenotype.
Development
119:881-896[Abstract].
|
| 57.
|
van Zonneveld, A.-J.,
S. A. Curriden, and D. J. Loskutoff.
1988.
Type 1 plasminogen activator inhibitor gene: functional analysis and glucocorticoid regulation of its promoter.
Proc. Natl. Acad. Sci. USA
85:5525-5529[Abstract/Free Full Text].
|
| 58.
|
Varmus, H., and R. Swanstrom.
1985.
Replication of retroviruses, p. 75-134.
In
R. Weiss, N. Teich, H. Varmus, and J. Coffin (ed.), Molecular biology of tumor viruses: RNA tumor viruses, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, N.Y.
|
| 59.
|
Vieira, J., and J. Messing.
1982.
The pUC plasmids, an M13mp7-derived system for insertion mutagenesis and sequencing with synthetic universal primers.
Gene
19:259-268[Medline].
|
| 60.
|
Waanders, G. A.,
A. N. Shakhov,
W. Held,
O. Karapetian,
H. Acha-Orbea, and H. R. MacDonald.
1993.
Peripheral T cell activation and deletion induced by transfer of lymphocyte subsets expressing endogenous or exogenous mouse mammary tumor virus.
J. Exp. Med.
177:1359-1366[Abstract/Free Full Text].
|
| 61.
|
Wrona, T., and J. P. Dudley.
1996.
Major histocompatibility complex class II I-E-independent transmission of C3H mouse mammary tumor virus.
J. Virol.
70:1246-1249[Abstract].
|
| 62.
|
Xu, L.,
S. Haga,
S. Imai, and N. H. Sarkar.
1994.
Cloning in a plasmid of an MMTV from a wild Chinese mouse: sequencing of the viral LTR.
Virus Res.
33:167-178[Medline].
|
| 63.
|
Xu, L.,
T. J. Wrona, and J. P. Dudley.
1996.
Exogenous mouse mammary tumor virus (MMTV) infection induces endogenous MMTV sag expression.
Virology
215:113-123[Medline].
|
| 64.
|
Xu, L.,
T. J. Wrona, and J. P. Dudley.
1997.
Strain-specific expression of spliced MMTV RNAs containing the superantigen gene.
Virology
236:54-65[Medline].
|
| 65.
|
Yanagawa, S.-I.,
K. Kakimi,
H. Tanaka,
A. Murakami,
Y. Nakagawa,
Y. Kubo,
Y. Yamada,
H. Hiai,
K. Kuribayashi,
T. Masuda, and A. Ishimoto.
1993.
Mouse mammary tumor virus with rearranged long terminal repeats causes murine lymphomas.
J. Virol.
67:112-118[Abstract/Free Full Text].
|
| 66.
|
Yang, J. N., and J. Dudley.
1992.
Endogenous Mtv-8 or a closely linked sequence stimulates rearrangement of the downstream V 9 gene.
J. Immunol.
149:1242-1251[Abstract].
|
| 67.
|
Yazdanbakhsh, K.,
C. G. Park,
G. M. Winslow, and Y. Choi.
1993.
Direct evidence for the role of COOH terminus of mouse mammary tumor virus superantigen in determining T cell receptor V specificity.
J. Exp. Med.
178:737-741[Abstract/Free Full Text].
|
| 68.
|
Yoshimoto, T.,
H. Nagase,
H. Nakano,
A. Matsuzawa, and H. Nariuchi.
1994.
A V 8.2-specific superantigen from exogenous mouse mammary tumor virus carried by FM mice.
Eur. J. Immunol.
24:1612-1619[Medline].
|
| 69.
|
Yoshimoto, T.,
H. Nagase,
H. Nakano,
A. Matsuzawa, and H. Nariuchi.
1996.
Deletion of CD4+ T cells by mouse mammary tumor virus (FM) superantigen with broad specificity of T cell receptor -chain variable region.
Virology
223:387-391[Medline].
|
J Virol, June 1998, p. 4746-4755, Vol. 72, No. 6
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Okeoma, C. M., Shen, M., Ross, S. R.
(2008). A Novel Block to Mouse Mammary Tumor Virus Infection of Lymphocytes in B10.BR Mice. J. Virol.
82: 1314-1322
[Abstract]
[Full Text]
-
Bhadra, S., Lozano, M. M., Dudley, J. P.
(2005). Conversion of Mouse Mammary Tumor Virus to a Lymphomagenic Virus. J. Virol.
79: 12592-12596
[Abstract]
[Full Text]
-
Zhu, Q., Maitra, U., Johnston, D., Lozano, M., Dudley, J. P.
(2004). The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis. Mol. Cell. Biol.
24: 4810-4823
[Abstract]
[Full Text]
-
Sarkar, N. H., Golovkina, T., Uz-Zaman, T.
(2004). RIII/Sa Mice with a High Incidence of Mammary Tumors Express Two Exogenous Strains and One Potential Endogenous Strain of Mouse Mammary Tumor Virus. J. Virol.
78: 1055-1062
[Abstract]
[Full Text]
-
Mustafa, F., Bhadra, S., Johnston, D., Lozano, M., Dudley, J. P.
(2003). The Type B Leukemogenic Virus Truncated Superantigen Is Dispensable for T-Cell Lymphomagenesis. J. Virol.
77: 3866-3870
[Abstract]
[Full Text]
-
Broussard, D. R., Mertz, J. A., Lozano, M., Dudley, J. P.
(2002). Selection for c-myc Integration Sites in Polyclonal T-Cell Lymphomas. J. Virol.
76: 2087-2099
[Abstract]
[Full Text]
-
Zhu, Q., Dudley, J. P.
(2002). CDP Binding to Multiple Sites in the Mouse Mammary Tumor Virus Long Terminal Repeat Suppresses Basal and Glucocorticoid-Induced Transcription. J. Virol.
76: 2168-2179
[Abstract]
[Full Text]
-
Baribaud, F., Wirth, S., Maillard, I., Valsesia, S., Acha-Orbea, H., Diggelmann, H.
(2001). Identification of Key Amino Acids of the Mouse Mammary Tumor Virus Superantigen Involved in the Specific Interaction with T-Cell Receptor V{beta} Domains. J. Virol.
75: 7453-7461
[Abstract]
[Full Text]
-
Mustafa, F., Lozano, M., Dudley, J. P.
(2000). C3H Mouse Mammary Tumor Virus Superantigen Function Requires a Splice Donor Site in the Envelope Gene. J. Virol.
74: 9431-9440
[Abstract]
[Full Text]
-
Rajan, L., Broussard, D., Lozano, M., Lee, C. G., Kozak, C. A., Dudley, J. P.
(2000). The c-myc Locus Is a Common Integration Site in Type B Retrovirus-Induced T-Cell Lymphomas. J. Virol.
74: 2466-2471
[Abstract]
[Full Text]
-
Barnett, A., Mustafa, F., Wrona, T. J., Lozano, M., Dudley, J. P.
(1999). Expression of Mouse Mammary Tumor Virus Superantigen mRNA in the Thymus Correlates with Kinetics of Self-Reactive T-Cell Loss. J. Virol.
73: 6634-6645
[Abstract]
[Full Text]