Previous Article | Next Article 
J Virol, May 1998, p. 4413-4420, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Bovine Leukemia Virus-Induced Lymphocytosis and
Increased Cell Survival Mainly Involve the CD11b+
B-Lymphocyte Subset in Sheep
Nathalie
Chevallier,
Madeleine
Berthelemy,
Danielle
Le
Rhun,
Véronique
Lainé,
Daniel
Levy, and
Isabelle
Schwartz-Cornil*
URA INRA-DGER d'Immunopathologie Cellulaire
et Moléculaire, Ecole Nationale Vétérinaire
d'Alfort, 94704 Maisons-Alfort Cedex, France
Received 7 November 1997/Accepted 30 January 1998
 |
ABSTRACT |
In this study, we show that bovine leukemia virus (BLV)-induced
persistent lymphocytosis (PL) results from the in vivo expansion of the
CD11b+ B-lymphocyte population. This subset shares
phenotypic characteristics with murine and human B-1 cells. BLV
interactions with the sheep B-1-like subset were explored. We found
that B-1- and B-2-like cells are initially infected to similar extents.
However, in long-term-infected sheep, the viral load is higher in
B-1-like cells and only B-1- and not B-2-like cells show increased ex
vivo survival compared to that in uninfected sheep. Ex vivo viral
expression was found in both B-1- and B-2-like cells, indicating that
both cell types support viral replication. Finally, cycloheximide and a
protein kinase C inhibitor (H7) that blocks the ex vivo activation of viral expression did not affect the increased survival in B-1-like cells, suggesting that resistance to apoptosis is acquired in vivo.
Collectively, these results indicate a peculiar susceptibility of sheep
B-1-like cells to BLV transforming effects and further support the
involvement of increased survival in BLV pathogenesis.
 |
TEXT |
Bovine leukemia virus (BLV), an
oncogenic complex retrovirus, is homologous to human T-cell leukemia
viruses (HTLV-1 and -2) and simian T-cell leukemia virus. Thirty
percent of naturally infected cattle present nonmalignant polyclonal
B-cell population expansion in the blood (persistent lymphocytosis
[PL]), and 1 to 5% of cows develop lymphocytic leukemia and/or
generalized B-cell lymphoma in the 5 to 10 years following infection
(for reviews, see references 3 and
30). Since the risk of developing leukemia or
lymphoma is greater in cattle with PL than in BLV-seropositive cattle
with normal hematological parameters, PL is considered a preneoplastic
condition (3). BLV inoculation in sheep is a convenient
experimental model for studying the physiopathology of BLV infection
because BLV-infected sheep present B-cell lymphoma lesions and B-cell
leukemia after a shorter latency period and far more frequently than do
cattle (17). We and other authors have reported that some
infected sheep also develop nonmalignant B-cell lymphocytosis (7,
20, 28, 31).
In cattle, B-cell lymphocytosis results from an increased number of
circulating CD5+ B lymphocytes (6, 18, 19)
associated with a lower but significant increase of the
CD5
B-cell population (19), whereas lymphomas
appear to arise exclusively from the CD5+ B-cell population
(6). The provirus has been detected in both CD5+
and CD5
B lymphocytes from long-term-infected animals,
with a higher load in CD5+ B cells (19, 29). In
contrast, in sheep, involvement of CD5+ B cells at both the
PL and the lymphoma stages has not been consistently observed (1,
16, 20).
In mice, the B-lymphocyte population is classically divided into
CD5+ B-1a, CD5
B-1b, and "conventional"
CD5
B-2 lymphocytes. B-1 cells differ from B-2 cells in
many properties (for a review, see reference 9). (i)
They display high levels of surface immunoglobulin M (IgM) and low
levels of IgD, B220 (CD45RA), and CD11b/CD18, a
2
integrin normally associated with the myelomonocytic lineage. The CD5
marker allows two subpopulations to be distinguished: a
CD5+ CD11b+ IgMhigh
IgDlow predominant subset named B-1a and a
CD5
CD11b+ IgMhigh
IgDlow minor "sister" population named B-1b that
appears to be otherwise identical to the B-1a subset. (ii) They are
larger than conventional B-2 lymphocytes. (iii) They comprise a high
number of natural polyspecific-antibody-producing cells and their
primary immune repertoire is made around the neonatal period. (iv) They
present a capacity for self-renewal. (v) Finally, adoptive transfer of B-1 and B-2 cells strongly supports the hypothesis that they belong to
separate lineages, although some reports emphasize that the CD5+ phenotype can be acquired by "conventional" B2
lymphocytes after stimulation through B-cell activation signals
(4). Human homologs of murine B-1 cells, CD5+
and/or CD11b+ B cells, have also been described in detail
(9, 13). Importantly, murine and human B-1 lymphocytes
contribute to several pathological disorders, such as autoimmune
diseases (9, 21), B-cell malignancies in mice
(9), B-cell lymphocytosis associated with human
immunodeficiency virus infection (15), and B-cell chronic
lymphocytic leukemia in humans (10).
Our group (31) and Dequiedt et al. (7) recently
reported that BLV protects sheep peripheral blood mononuclear cells
(PBMCs) from spontaneous ex vivo apoptosis. Both reports also indicated that BLV promotes the survival of infected B lymphocytes. These findings suggested that BLV-induced increased survival in B cells is
involved in the development of lymphocytosis.
In this study, we first show that BLV infection in sheep induces PL
that results from the accumulation of B cells carrying the CD11b/CD18
integrin with variable coexpression of the CD5 molecule, whereas the
CD11b
B-cell population does not significantly expand. We
then further describe the interactions of BLV with the sheep
CD11b+ B (B-1-like)-cell population. Altogether our data
indicate that although both sheep B-1- and B-2-like cells become
infected and can express BLV, only B-1 cells show a susceptibility to
BLV-associated lymphocytosis and increased survival. Our result also
further support the involvement of increased cell survival in the
development of lymphocytosis.
B-cell lymphocytosis in BLV-infected sheep mainly results from the
expansion of the CD11b+ B (B-1-like)-lymphocyte
subset.
As CD5 and CD11b have been detected on B lymphocytes from
lymphocytotic cows (18), we analyzed the expression of these
markers on blood B cells from sheep infected for 4 to 6 years with BLV. When the experiments were performed, two-thirds of the infected sheep
had high levels of PL on the basis of their increased B-cell/T-cell ratio and their absolute B-cell numbers (Table
1).
B cells were first analyzed with an anti-CD5 monoclonal antibody (MAb)
and an anti-sheep pan-B-cell MAb recognizing CD21 (9a) (Table 2). Three subpopulations of B
cells presenting a lack of CD5 expression or low or high levels of CD5
expression could be identified (Fig. 1A).
In most instances, the distinction between the CD5-negative cells and
cells expressing low levels of CD5 was unclear, leading to imprecise
estimates (Fig. 1A). An expansion of the CD5+ B-cell
population was detected in sheep with a high level of PL
(P < 0.05), but its extent variably contributed to the
overall proliferation of the total B cells (Table 1). Finally, the
relative representations of the CD5+ B cells greatly varied
over time for a given sheep. Overall, it can be concluded that, by
contrast with the case in cattle, CD5 is not a reliable marker of PL in
sheep.

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 1.
Expansion of the CD5+ and CD11b+
B-cell subsets in BLV-infected sheep. (A) The CD5 and CD21 markers were
detected on PBMCs from a control sheep and a BLV-infected sheep with PL
by incubating the cells with MAbs CC17 and DU2-104 followed by
FITC-conjugated F(ab')2 goat anti-mouse IgG1 (Caltag
Laboratories, San Francisco, Calif.) and a phycoerythrin-conjugated
F(ab')2 goat anti-mouse IgM antibody (Jackson
ImmunoResearch Laboratories, West Grove, Pa.). The percentages of cells
in the different subsets are indicated. (B) Double labeling for CD11b
(MAb CC125) and CD21 (MAb DU2-104) detection on PBMCs from the same
sheep as for panel A. The percentages of cells in the different subsets
are indicated.
|
|
The dual labeling of sheep B cells with an anti-CD21 MAb and an
anti-CD11b MAb (Table 2) revealed two clearly distinct B-cell subpopulations: one negative and one positive for CD11b expression (Fig. 1B). The sheep with low and high levels of PL presented 2.4-fold
(P < 0.05) and 14-fold (P < 0.005)
increases in CD11b+ B-cell numbers, respectively, over
values for uninfected sheep (Table 1). Interestingly, the absolute
number of CD11b
B cells was slightly (2.7-fold) but not
significantly increased (P < 0.5) at the highly
lymphocytotic stage (Table 1). A regression curve relating the number
of total B cells to the number of CD11b+ B cells has a
slope equal to 0.9 (r2 = 0.98 [data not
shown]). This shows that the increased number of B cells is
essentially the result of the expansion of the CD11b+
B-cell subpopulation. Finally, the relative representations of the
CD11b+ B cells were quite stable over time for a given
sheep.
Triple-fluorescence analyses for the CD21, CD5, and CD11b markers
revealed that 30 to 89% of the CD11b+ B lymphocytes from
animals with PL coexpressed the CD5 molecule (mean ± standard
deviation, 53% ± 27% [Table 1]). In addition, similar to findings
for murine B-1 cells relative to B-2 cells, the CD11b+ B
lymphocytes from both control and BLV-infected sheep presented higher
levels of surface IgM and yielded larger forward- and side-angle scatters than CD11b
B lymphocytes (data not shown).
Overall, these data clearly show that in the BLV-infected sheep in this
study, lymphocytosis results mainly from the expansion of the
CD11b+ B-cell population, which presents some of the
phenotypic characteristics of murine B-1 cells. The CD11b+
B cells in sheep are referred to below as B-1-like cells.
BLV viral loads are similar in B-1- and B-2-like cell subsets from
newly infected sheep, and the virus accumulates in B-1-like cells from
long-term-infected sheep.
The expansion of the B-1-like cell
subset could be the result of a specific propensity of this subset to
become infected by replicating BLVs. In order to determine whether this
is the case, we looked at the viral loads in B-1- and B-2-like cell
subsets from newly infected sheep before the onset of lymphocytosis.
Previous reports had indicated that the initial viral replication,
around 3 to 4 weeks after infection, was important (12). We
thus collected PBMCs from 4-week-infected young sheep, doubly labeled
them for CD21 and CD11b detection, and sorted the CD11b+
and CD11b
B cells using flow cytometry. The contamination
with cells originating from the theoretically excluded B-cell subset
was below 4%. The sorted populations (5 × 104 cells)
were lysed and subjected to two independent PCRs, one for BLV detection
(forward primer [position 4761], 5'CGCTCTCCTGGCTACTGACC3'; reverse primer [position 5184], 5'ACCGATCTGCCCCCACATAAG3')
and the other for the detection of the endogenous
glyceraldehyde-3-phospho-dehydrogenase (G3PDH) gene (forward primer,
5'GACCCCTTCATTGACCTCAACTACA3'; reverse primer,
5'CATGTGGGCCATGAGGTCCACCAC3'). Twenty-seven cycles were performed for both reactions as follows: 45 s at 91°C, 45 s
at 58°C, and 45 s at 71°C. The PCR products were transferred
onto a nylon membrane, revealed with 32P-labeled probes,
and quantitated with the PhosphorImager system (Molecular Dynamics,
Sunnyvale, Calif.). The PCRs were performed under strictly defined
conditions such that a linear relationship between the initial cell
number and the PCR signal intensity was obtained. In order to determine
the limit of detection for BLV provirus, we included PCRs with
linearized plasmid pBLV13 serially diluted in an uninfected PBMC
lysate. The detection limit under our PCR conditions corresponded to
0.5% of cells infected with one viral copy per sample. The intensity
of the BLV signal obtained in the two B-cell populations indicated that
at most 2.5% of the B cells were infected at that time. Under such
conditions, the theoretical signal corresponding to 0.1% of
contaminating infected B cells is below the detection level. The BLV
signal was normalized between samples by using the G3PDH internal
control (Fig. 2A), and a viral load ratio
(VLR) for the CD11b+ B cells and the CD11b
B
cells was calculated (Fig. 2B). In sheep 27, the VLR was 1.7 ± 0.17 (mean ± standard error of the mean [SEM] from eight
independent PCRs), and in sheep 42, the VLR was 1.2 ± 0.2 (n = 8) (Fig. 2B). At 4 weeks after infection, the
CD11b+ B-cell number showed 2- and 1.2-fold increases over
the values for the day of infection in sheep 27 and sheep 42, respectively, whereas the CD11b
B-cell number was
unchanged; this increase probably accounts for the slightly higher
viral load detected in the CD11b+ B cells. Overall, these
results indicate that there is no restricted or clear preferential
viral tropism for the CD11b+ B-cell population compared to
the CD11b
B-cell population at the beginning of
infection.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 2.
BLV viral loads in CD11b+ and
CD11b B cells in newly infected and long-term-infected
sheep. (A) BLV provirus detection in sorted (by fluorescence-activated
cell sorting) CD11b+ B and CD11b B cells from
two 4-week-infected sheep (sheep 27 and 42). Uncultured
CD11b+ and CD11b B cells were sorted, lysed,
and analyzed for the detection of BLV provirus and the endogenous G3PDH
gene by PCR, followed by Southern blotting and 32P-specific
probing. The signals were analyzed with a PhosphorImager. The BGR
obtained for each sorted population is shown. (B) VLRs for the BGRs of
the CD11b+ and CD11b B-cell subsets were
calculated for newly infected (4-week-infected) sheep and long-term
(6-year)-infected sheep. Means and SEMs of the VLRs obtained for 8 (sheep 27 and 42) and 12 (sheep 105, 79, and 121) independent PCR
experiments are shown.
|
|
In order to assess whether lymphocytosis is associated with the
accumulation of BLV-infected CD11b+ B cells, the BLV
proviral loads in the CD11b+ and CD11b
B-lymphocyte populations were similarly examined in long-term-infected sheep at different stages of PL. Depending on the animals, the BLV/G3PDH signal ratios (BGRs) indicated that between 8 and 40% of the
B-1-like cells were infected (data not shown). The VLRs were 2.5 ± 0.3 for sheep 105 (which had low-level PL) (mean ± SEM,
n = 12), 3.7 ± 0.9 for sheep 121 (n = 12), and 5.4 ± 1.3 for sheep 79 (n = 12) (the latter two sheep both had high-level PL)
(Fig. 2B). The higher viral load in CD11b+ cells than in
CD11b
B cells probably reflects the accumulation of
BLV-infected CD11b+ B cells in these long-term-infected
sheep. Furthermore, the VLR showed a tendency to increase when the
magnitude of the PL increased (Fig. 2B and Table 1).
Altogether, our data show that although BLV infects both
CD11b+ and CD11b
B cells at the onset of
infection, it preferentially induces an accumulation of infected
CD11b+ B cells that is reflected by a higher proviral load
in this subset at late stages of infection. The initial viral tropism
cannot account for the quasiexclusive involvement of CD11b+
B cells in PL.
BLV-induced protection from apoptosis in B cells mainly affects the
CD11b+ B-cell subset.
B lymphocytes from BLV-infected
sheep were shown to be resistant to spontaneous apoptosis, in contrast
to B lymphocytes from uninfected sheep (7, 31). As
CD11b+ B lymphocytes are the major contributors to PL, the
BLV-induced increase in cell survival was analyzed in
CD11b+ and CD11b
B lymphocytes. PBMCs were
cultured for 48 h and then triply labeled with an anti-CD21 MAb,
an anti-CD11b MAb, and fluorescein isothiocyanate (FITC)-conjugated
annexin V (Boehringer Mannheim, Mannheim, Germany); the percentages of
surviving (i.e., annexin V negative) among CD21+
CD11b+ and CD21+ CD11b
lymphocytes could thus be established (Fig.
3). As shown in Fig. 3 and Table
3, CD11b+ B lymphocytes from
BLV-infected sheep presented a marked increase in survival compared to
controls. Conversely, the ex vivo survival of the CD11b
B
lymphocytes appeared to be only slightly increased. The data also
indicate that the magnitude of the ex vivo survival in B-1-like cells
increases with the clinical stage (Table 3).

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 3.
CD11b+ B cells from BLV-infected sheep show
increased ex vivo survival. PBMCs from control and BLV-infected sheep
with low- and high-level PL were cultured for 48 h and labeled
with FITC-annexin V and for detection of the CD11b and the CD21 markers
[CC125 followed by a tricolor conjugated F(ab')2 goat
anti-mouse IgG1 antibody (Caltag Laboratories) and DU2-104 followed by
a phycoerythrin-conjugated F(ab')2 goat anti-mouse IgM
antibody, respectively). The cells positive for both CD11b and CD21
(CD11b+) were gated, as were the cells positive for CD21
and negative for CD11b (CD11b ). The proportions of
surviving cells (annexin V negative) among the gated B cells are
indicated.
|
|
These results show that BLV infection essentially protects the B-1-like
lymphocyte subpopulation from apoptosis, with a marginal effect on the
B-2-like cell subpopulation. Although BLV initially infects both B-1-
and B-2-like cells, the B-1-like population is the main BLV target for
both ex vivo resistance to apoptosis and in vivo lymphocytosis.
BLV-induced protection from apoptosis is not related to restricted
viral expression in the CD11b+ B-cell subset.
We
(31) and Dequiedt et al. (7) showed previously
that the majority of BLV-expressing cells ex vivo were resistant to apoptosis, suggesting a direct role for the virus in the increased lymphocyte life span. The resistance to apoptosis limited to the B-1-like cells that we saw here could have been the result of restricted viral expression in this subpopulation. We thus analyzed viral expression in both CD11b+ and CD11b
B
cells ex vivo. PBMCs from sheep 79 cultured for 48 h were labeled for detection of the CD11b and CD21 markers, fixed, permeabilized in
70% methanol, and analyzed for expression of the BLV major capsid
protein, p24, by using a pool of anti-BLV p24 MAbs (31). By
flow cytometry, the CD11b+ B cells and the
CD11b
B cells were gated and were analyzed. Both subsets
were found to express p24 (Fig. 4); a
higher percentage of CD11b+ B cells (46%) than
CD11b
B cells (18%) expressed p24, reflecting the higher
proviral load in the CD11b+ B-cell population. Overall,
these results demonstrate that the resistance to apoptosis in
CD11b+ B cells is not associated with a restriction of the
viral expression in this cell subset.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 4.
In situ detection of BLV p24 expression in
CD11b+ and CD11b B cells.
Forty-eight-hour-cultured PBMCs from sheep 79 were labeled with an
anti-CD21 MAb (DU2-104 followed by phycoerythrin-conjugated anti-mouse
IgM) and an anti-CD11b MAb (ILA-130 followed by FITC-conjugated
anti-mouse IgG2a), permeabilized with 70% methanol, and processed for
BLV p24 detection (anti-p24 MAbs followed by triply conjugated
anti-mouse IgG1). The p24-positive cells among gated CD11b+
and CD11b B cells are shown. The overlaid left histogram
represents background fluorescence of permeabilized CD11b+
and CD11b B cells obtained with a control mouse IgG1
antibody to mutant p53 (Ctrl).
|
|
Resistance to apoptosis in B-1-like lymphocytes is acquired in
vivo.
Whereas BLV expression is largely repressed in vivo, a short
culturing leads to rapid activation of viral expression
(25). The resistance to apoptosis seen in our assay could
thus be the result of the high expression of a viral protein that
rarely occurs in vivo and/or occurs in small amounts. In order to
demonstrate that the activation of viral expression is not required for
increased survival in B-1 cells, inhibitors of BLV activation were used in the ex vivo culture. Inhibitors of protein kinase C, such as H7
{[1-(5-isoquinolinylsulfonyl)-3-methylpiperazine
dihydrochloride]}, have been previously illustrated to strongly
affect the activation of BLV expression (14). We thus
treated the cultured PBMCs with H7 (10 and 15 µM; Sigma, St. Louis,
Mo.) for 15 h. The time of the culture needed to be shortened to
15 h because H7 induced cell toxicity in the control PBMCs after
48 h of incubation. After 15 h of culturing, the cells from
control sheep 190 presented a low level of survival that was not
significantly altered by H7 treatments (Fig.
5A). Treatment of sheep 121 PBMCs with H7 was associated with a reduced level of p24 expression at an H7 concentration of 10 µM and with the inability to detect p24 at 15 µM (Fig. 5C). In parallel, H7 did not significantly affect the high
survival level of CD11b+ B cells (Fig. 5A). A general
inhibitor of protein synthesis, cycloheximide (CHX), was used in order
to confirm the results obtained with H7. After 15 h, CHX (Sigma)
at 10 and 15 µg/ml slightly but not significantly increased the
survival of CD11b+ B cells from the control sheep (Fig.
5B). CHX treatments of sheep 121 PBMCs totally prevented p24 expression
as determined by Western blot analysis (Fig. 5C) and
fluorescence-activated cell sorter analyses (data not shown). CHX
treatments did not modify the survival of CD11b+ B cells
from sheep 121.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 5.
Inhibition of viral activation with H7 or CHX does not
alter the increased survival in CD11b+ B cells from
BLV-infected sheep with PL. PBMCs from a control sheep (sheep 190) and
from a BLV-infected sheep with high-level PL (sheep 121) were cultured
for 15 h without or with H7 (A) or with CHX (B). At the end of the
culturing, the cells were labeled with FITC-annexin V and for detection
of the CD11b (CC125) and CD21 (DU2-104) markers. The percentages of
cell survival in each cell subset were obtained for three independent
cultures, and means and standard deviations are reported. (C)
Inhibition of viral capsid p24 expression with H7 and CHX treatments
was analyzed by Western blotting with a pool of anti-BLV p24 MAbs (5 µg/ml) and an antiactin MAb (0.5 µg/ml, clone AC-15; Sigma) as an
internal control.
|
|
We can conclude from these experiments that the dramatic increase of
cell survival induced by BLV in CD11b+ B-1-like lymphocytes
is not due to the high ex vivo expression of a viral product that does
not occur in vivo. The viral process involved in conferring resistance
to apoptosis on CD11b+ B lymphocytes has thus happened in
vivo.
Significance of susceptibility and resistance of B-1-like cells to
apoptosis in BLV pathogenesis.
B-1 cells in mice and in humans are
often present during the development of B-cell leukemia and lymphomas
(9), suggesting that these cells are particularly prone to
cellular transformation. In the present study, we show that BLV-induced
B-cell lymphocytosis in sheep mainly involves a CD11b+
B-cell subpopulation that presents phenotypic similarities to murine
B-1 cells. In addition, BLV infection confers a potent resistance to
spontaneous apoptosis on B-1-like cells and barely affects B-2-like
cells, although both subsets are initially infected and both subsets
support viral replication. Collectively, our results suggest that the
reactivity of B-1-like cells is not due to restricted viral expression
in this subset; rather, B-1-like cells may present a peculiar
sensitivity to viral products or to cellular gene activation induced by
BLV infection.
Regarding sensitivity to viral products, CD11b+ B
lymphocytes may be relatively more responsive than CD11b
B cells to the transforming properties of BLV Tax (33).
Actually, the cellular context appears to be important for HTLV-1
Tax-mediated effects: soluble recombinant HTLV-1 Tax induces tumor
necrosis factor alpha synthesis in differentiated NT-2 neuronal cells
but not in undifferentiated NT-2 cells (5).
BLV infection may modulate the expression of cellular genes interfering
with the apoptotic response in CD11b+ B cells specifically.
Because the number of known death-modulating genes is increasing, many
molecular candidates could be analyzed. In homologous viral infection
with HTLV-1, the bcl-2 gene was found to be upregulated in
infected endothelial cells (23); however, in our previous
report (31), we showed that the bcl-2 mRNA level
was not altered in B lymphocytes from sheep with PL. The HTLV-1 Tax
protein was also reported to downregulate bax and p53 gene
expression (2, 32); we could not detect the corresponding proteins in sheep B-cell lysates in Western blot analyses, probably because of the poor interspecies reactivity of the antibodies. Interestingly, BLV infection in cows was shown to be associated with
interleukin-10 (IL-10) mRNA overexpression (27). B-1 cells from mice produce IL-10, which acts as an autocrine growth factor (24): IL-10 is overexpressed in aged mice with B-1-cell
proliferation (24), and treatment at birth with antibodies
to IL-10 leads to essentially no B-1 cells in the peritoneal cavity but
to normal B-cell numbers in the spleen and lymph nodes (11).
Consequently, the increased expression of IL-10 in BLV-infected animals
may contribute to the preferential expansion of the B-1-like lymphocyte population in sheep.
Yet the hypothesis that B-cell proliferation in BLV-infected animals
may affect CD11b
B lymphocytes that acquire the CD11b
marker remains. The viral infection would thus lead to both acquisition
of the CD11b marker and apoptosis resistance in the same cells; in
parallel, the infected B cells that remain CD11b
would
show unchanged survival properties. Although possible, this complex
scenario is unlikely because the strong ex vivo viral expression in
both B-cell subsets is not associated with an increased number of
CD11b+ B cells in the culture, which would indicate the
induction of CD11b expression by BLV. In addition, in uninfected sheep,
the CD11b+ phenotype is associated with a higher relative
sensitivity to apoptosis (Table 3).
Three experimental findings in this present work support the idea that
increased cell survival is involved in PL development: (i) PL and
increased ex vivo survival both affect the B-1-like cell subset, (ii)
the magnitude of ex vivo cell survival increases with the clinical
stage of PL, and (iii) in vivo viral expression is enough to confer
apoptosis resistance on B-1-like cells, as CHX and H7 treatments do not
affect the higher survival rate of B-1-like cells. The increased
survival is thus not an in vitro artifact of the high expression of
viral or cellular gene products. The low level of BLV expression and
its transience encountered in animals (8) are thus enough to
confer resistance to cell death.
Altogether, our report shows that in sheep, the CD11b+
B-cell subset, a B-1-like cell population, is highly sensitive to
BLV-induced in vivo accumulation and to ex vivo increased cell
survival. This viral model could be a tool for uncovering the molecular
and cellular bases involved in the peculiar sensitivity of the murine
and human B-1 subsets to unregulated growth and leukemogenesis.
 |
ACKNOWLEDGMENTS |
We warmly thank Alain Bernier and Lahcen Souini for taking good
care of the sheep herd and for being so patient with us. We are
grateful to W. Hein (Basel Institute for Immunology, Basel, Switzerland) for the DU2-104 hybridoma, J. Naessens (International Laboratory for Research on Animal Disease, Nairobi, Kenya) for the
ILA-130 MAb, C. Howard (Institute for Animal Health, Compton, United
Kingdom) for the CC17 and CC125 hybridomas, M. Pépin (Centre National d'Etudes Vétérinaires et Alimentaires, Sofia
Antepolis, France) for the OM1 hybridoma, J. J. Letesson (Namur,
Belgium) for the 1H4 hybridoma, and D. Portetelle (Gembloux, Belgium)
for the anti-p24 antibodies. We are indebted to B. Polack for his help
in many instances, to I. Bouchaert for her expertise in flow cytometry
and her involvement in the cell sorting experiments, and to M. Bomsel,
B. Schwartz, and M. Mericskay for critical reviews of the manuscript.
We thank P. Rodrigues and D. Sitterlin for access to the
PhosphorImager.
This work was supported by the Institut National de la Recherche
Agronomique.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: URA INRA IPCM,
ENVA, 7 Avenue du Général de Gaulle, 94704 Maisons-Alfort
Cedex, France. Phone: 33 1 43 96 70 75. Fax: 33 1 43 96 71 25. E-mail:
schwartz{at}jouy.inra.fr.
 |
REFERENCES |
| 1.
|
Birkebak, T. A.,
G. H. Palmer,
W. C. Davis,
D. P. Knowles, and T. F. McElwain.
1994.
Association of GP51 expression and persistent CD5+ B-lymphocyte expansion with lymphomatogenesis in bovine leukemia virus infected sheep.
Leukemia
8:1890-1899[Medline].
|
| 2.
|
Brauweiler, A.,
J. E. Garrus,
J. C. Reed, and J. K. Nyborg.
1997.
Repression of bax gene expression by the HTLV-1 Tax protein: implications for suppression of apoptosis in virally infected cells.
Virology
231:135-140[Medline].
|
| 3.
|
Burny, A.,
C. Bruck,
H. Chanhenne,
Y. Cleuter,
D. Dekegel,
J. Ghysdael,
R. Kettmann,
M. Leclercq,
J. Leunen,
M. Mammerickx, and D. Portetelle.
1980.
In
Bovine leukemia virus: molecular biology and epidemiology, p. 231-278.
Raven Press, New York, N.Y.
|
| 4.
|
Cong, Y.-Z.,
E. Rabin, and H. H. Wortis.
1991.
Treatment of murine CD5 B-cells with anti-Ig, but not LPS, induces surface CD5: two B-cell activation pathways.
Int. Immunol.
3:467-476[Abstract/Free Full Text].
|
| 5.
|
Cowan, E. P.,
R. K. Alexander,
S. Daniel,
F. Kashanchi, and J. N. Brady.
1997.
Induction of tumor necrosis factor alpha in human neuronal cells by extracellular human T-cell lymphotropic virus type 1 Tax1.
J. Virol.
71:6982-6989[Abstract].
|
| 6.
|
Depelchin, A.,
J. J. Letesson,
N. Lostrie Trussart,
M. Mammerickx,
D. Portetelle, and A. Burny.
1989.
Bovine leukemia virus (BLV)-infected B-cells express a marker similar to the CD5 T-cell marker.
Immunol. Lett.
20:69-76[Medline].
|
| 7.
|
Dequiedt, F.,
E. Hanon,
P. Kerkhofs,
P.-P. Pastoret,
D. Portetelle,
A. Burny,
R. Kettmann, and L. Willems.
1997.
Both wild-type and strongly attenuated bovine leukemia viruses protect peripheral blood mononuclear cells from apoptosis.
J. Virol.
71:630-639[Abstract].
|
| 8.
|
Haas, L.,
T. Divers, and J. W. Casey.
1992.
Bovine leukemia virus gene expression in vivo.
J. Virol.
66:6223-6225[Abstract/Free Full Text].
|
| 9.
|
Hayakawa, K., and R. R. Hardy.
1988.
Normal, autoimmune, and malignant CD5+ B cells: the Ly-1 B lineage.
Annu. Rev. Immunol.
6:219-249[Medline].
|
| 9a.
| Hein, W. Personal communication.
|
| 10.
|
Ikematsu, W.,
H. Ikematsu,
S. Okamura,
T. Otsuka,
M. Harada, and Y. Niho.
1994.
Surface phenotype and Ig heavy-chain gene usage in chronic B-cell leukemia: expression of myelomonocytic surface markers in CD5 chronic B-cell leukemia.
Blood
83:2602-2610[Abstract/Free Full Text].
|
| 11.
|
Ishida, H.,
R. Hastings,
J. Kearney, and M. Howard.
1992.
Continuous anti-interleukin 10 antibody administration depletes mice of Ly-1 B cells but not conventional B cells.
J. Exp. Med.
175:1213-1220[Abstract/Free Full Text].
|
| 12.
|
Johnston, E. R.,
M. A. Powers,
L. C. Kidd, and C. Radke.
1996.
Peripheral blood mononuclear cells from sheep infected with a variant of bovine leukemia virus synthesize envelope glycoproteins but fail to induce syncytia in culture.
J. Virol.
70:6296-6303[Abstract].
|
| 13.
|
Kasaian, M. T.,
H. Ikematsu, and P. Casali.
1992.
Identification and analysis of a novel human surface CD5 B lymphocyte subset producing natural antibodies.
J. Immunol.
148:2690-2702[Abstract].
|
| 14.
|
Kerkhofs, P.,
E. Adam,
L. Droogmans,
D. Portetelle,
M. Mammerickx,
A. Burny,
R. Kettmann, and L. Willems.
1996.
Cellular pathways involved in the ex vivo expression of bovine leukemia virus.
J. Virol.
70:2170-2177[Abstract].
|
| 15.
|
Kouri, Y. H.,
R. S. Basch, and S. Karpatkin.
1992.
B-cell subsets and platelet counts in HIV-1 seropositive subjects.
Lancet
339:1445-1446[Medline].
|
| 16.
|
Letesson, J. J.,
A. Mager,
M. Mammerickx,
A. Burny, and A. Depelchin.
1990.
B cells from bovine leukemia virus (BLV)-infected sheep with hematological disorders express the CD5 T-cell marker.
Leukemia
4:377-379[Medline].
|
| 17.
|
Mammerickx, M.,
R. Palm,
D. Portetelle, and A. Burny.
1988.
Experimental transmission of leukosis in sheep: latency period of the tumoral disease.
Leukemia
2:103-107[Medline].
|
| 18.
|
Matheise, J. P.,
M. Delcommenne,
A. Mager,
C. H. Didembourg, and J. J. Letesson.
1992.
CD5+ B cells from bovine leukemia virus-infected cows are activated cycling cells responsive to interleukin 2.
Leukemia
6:304-309[Medline].
|
| 19.
|
Mirsky, M. L.,
C. A. Olmstead,
Y. Da, and H. A. Lewin.
1996.
The prevalence of proviral bovine leukemia virus in peripheral blood mononuclear cells at two subclinical stages of infection.
J. Virol.
70:2178-2183[Abstract].
|
| 20.
|
Murakami, K.,
K. Okada,
Y. Ikawa, and Y. Aida.
1994.
Bovine leukemia virus induces CD5 B cell lymphoma in sheep despite temporarily increasing CD5+ B cells in asymptomatic stage.
Virology
202:458-465[Medline].
|
| 21.
|
Murakami, M., and T. Honjo.
1995.
Involvement of B-1 cells in mucosal immunity and autoimmunity.
Immunol. Today
16:534-539[Medline].
|
| 22.
|
Naessens, J., and J. Hopkins.
1996.
Introduction and summary to workshop findings.
Vet. Immunol. Immunopathol.
52:213-235[Medline].
|
| 23.
|
Nicot, T.,
T. Astier-Gin, and B. Guillemain.
1997.
Activation of bcl-2 expression in human endothelial cells chronically expressing the human T-cell lymphotropic virus type I.
Virology
236:47-53[Medline].
|
| 24.
|
O'Garra, A.,
R. Chang,
N. Go,
R. Hastings,
G. Haughton, and M. Howard.
1992.
Ly-1 B (B-1) cells are the main source of B cell-derived interleukin 10.
Eur. J. Immunol.
22:711-717[Medline].
|
| 25.
|
Powers, M. A., and K. Radke.
1992.
Activation of bovine leukemia virus transcription in lymphocytes from infected sheep: rapid transition through early to late gene expression.
J. Virol.
66:4769-4777[Abstract/Free Full Text].
|
| 26.
|
Press, C. M.,
W. R. Hein, and T. Landsverk.
1993.
Ontogeny of leukocyte population in the spleen of fetal lambs with emphasis on the early prominence of B cells.
Immunology
80:598-604[Medline].
|
| 27.
|
Pyeon, D.,
K. L. O'Reilly, and G. A. Splitter.
1996.
Increased interleukin-10 mRNA expression in tumor-bearing or persistently lymphocytotic animals infected with bovine leukemia virus.
J. Virol.
70:5706-5710[Abstract/Free Full Text].
|
| 28.
|
Rovnak, J.,
A. L. Boyd,
J. W. Casey,
M. A. Gonda,
W. A. Jensen, and G. L. Cockerell.
1993.
Pathogenicity of molecularly cloned bovine leukemia virus.
J. Virol.
67:7096-7105[Abstract/Free Full Text].
|
| 29.
|
Schwartz, I.,
A. Bensaid,
B. Polack,
B. Perrin,
M. Berthelemy, and D. Levy.
1994.
In vivo leukocyte tropism of bovine leukemia virus in sheep and cattle.
J. Virol.
68:4589-4596[Abstract/Free Full Text].
|
| 30.
|
Schwartz, I., and D. Levy.
1994.
Pathobiology of bovine leukemia virus.
Vet. Res.
25:521-536[Medline].
|
| 31.
|
Schwartz-Cornil, I.,
N. Chevallier,
C. Belloc,
D. Le Rhun,
V. Lainé,
M. Berthelemy, and D. Levy.
1997.
Bovine leukemia virus-induced lymphocytosis in sheep is associated with reduction of spontaneous B cell apoptosis.
J. Gen. Virol.
78:153-162[Abstract].
|
| 32.
|
Uittenbogaard, M. N.,
H. A. Giebler,
D. Reisman, and J. K. Nyborg.
1985.
Transcriptional repression of p53 by human T-cell leukemia virus type I Tax protein.
J. Biol. Chem.
270:28503-28506[Abstract/Free Full Text].
|
| 33.
|
Willems, L.,
H. Heremans,
G. Chen,
D. Portetelle,
A. Billiau,
A. Burny, and R. Kettmann.
1990.
Cooperation between bovine leukaemia virus transactivator protein and Ha-ras oncogene product in cellular transformation.
EMBO J.
9:1577-1581[Medline].
|
J Virol, May 1998, p. 4413-4420, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pascale, F., Contreras, V., Bonneau, M., Courbet, A., Chilmonczyk, S., Bevilacqua, C., Eparaud, M., Niborski, V., Riffault, S., Balazuc, A.-M., Foulon, E., Guzylack-Piriou, L., Riteau, B., Hope, J., Bertho, N., Charley, B., Schwartz-Cornil, I.
(2008). Plasmacytoid Dendritic Cells Migrate in Afferent Skin Lymph. J. Immunol.
180: 5963-5972
[Abstract]
[Full Text]
-
Florins, A., Gillet, N., Asquith, B., Debacq, C., Jean, G., Schwartz-Cornil, I., Bonneau, M., Burny, A., Reichert, M., Kettmann, R., Willems, L.
(2006). Spleen-Dependent Turnover of CD11b Peripheral Blood B Lymphocytes in Bovine Leukemia Virus-Infected Sheep. J. Virol.
80: 11998-12008
[Abstract]
[Full Text]
-
Debacq, C., Gillet, N., Asquith, B., Sanchez-Alcaraz, M. T., Florins, A., Boxus, M., Schwartz-Cornil, I., Bonneau, M., Jean, G., Kerkhofs, P., Hay, J., Thewis, A., Kettmann, R., Willems, L.
(2006). Peripheral Blood B-Cell Death Compensates for Excessive Proliferation in Lymphoid Tissues and Maintains Homeostasis in Bovine Leukemia Virus-Infected Sheep. J. Virol.
80: 9710-9719
[Abstract]
[Full Text]
-
Fulton, B. E. Jr., Portella, M., Radke, K.
(2006). Dissemination of bovine leukemia virus-infected cells from a newly infected sheep lymph node.. J. Virol.
80: 7873-7884
[Abstract]
[Full Text]
-
Cailhier, J. F., Sawatzky, D. A., Kipari, T., Houlberg, K., Walbaum, D., Watson, S., Lang, R. A., Clay, S., Kluth, D., Savill, J., Hughes, J.
(2006). Resident Pleural Macrophages Are Key Orchestrators of Neutrophil Recruitment in Pleural Inflammation. Am. J. Respir. Crit. Care Med.
173: 540-547
[Abstract]
[Full Text]
-
Bonneau, M., Epardaud, M., Payot, F., Niborski, V., Thoulouze, M.-I., Bernex, F., Charley, B., Riffault, S., Guilloteau, L. A., Schwartz-Cornil, I.
(2006). Migratory monocytes and granulocytes are major lymphatic carriers of Salmonella from tissue to draining lymph node. J. Leukoc. Biol.
79: 268-276
[Abstract]
[Full Text]
-
Debacq, C., Asquith, B., Kerkhofs, P., Portetelle, D., Burny, A., Kettmann, R., Willems, L.
(2002). Increased cell proliferation, but not reduced cell death, induces lymphocytosis in bovine leukemia virus-infected sheep. Proc. Natl. Acad. Sci. USA
99: 10048-10053
[Abstract]
[Full Text]
-
Twizere, J.-C., Kerkhofs, P., Burny, A., Portetelle, D., Kettmann, R., Willems, L.
(2000). Discordance between Bovine Leukemia Virus Tax Immortalization In Vitro and Oncogenicity In Vivo. J. Virol.
74: 9895-9902
[Abstract]
[Full Text]
-
Dequiedt, F., Cantor, G. H., Hamilton, V. T., Pritchard, S. M., Davis, W. C., Kerkhofs, P., Burny, A., Kettmann, R., Willems, L.
(1999). Bovine Leukemia Virus-Induced Persistent Lymphocytosis in Cattle Does Not Correlate with Increased Ex Vivo Survival of B Lymphocytes. J. Virol.
73: 1127-1137
[Abstract]
[Full Text]