Previous Article | Next Article 
J Virol, May 1998, p. 4352-4363, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Epidemiology of Infection with Epstein-Barr Virus Types 1 and 2:
Lessons from the Study of a T-Cell-Immunocompromised Hemophilic
Cohort
Q. Y.
Yao,1
D. S. G.
Croom-Carter,1
R. J.
Tierney,1
G.
Habeshaw,1
J. T.
Wilde,2
F. G. H.
Hill,3
C.
Conlon,4 and
A.
B.
Rickinson1,*
CRC Institute for Cancer Studies, University
of Birmingham, Edgbaston, Birmingham B15 2TA,1
Department of Haematology, University Hospital Trust,
Edgbaston, Birmingham B15 2TH,2
Department of Haematology, Birmingham Children's Hospital,
Ladywood, Birmingham B16 8ET,3 and
Nuffield Department of Medicine, John Radcliffe Hospital,
Headington, Oxford OX3 9DU,4 United Kingdom
Received 17 November 1997/Accepted 4 February 1998
 |
ABSTRACT |
In apparent contrast to earlier work on Epstein-Barr virus (EBV)
carriage in the general Caucasian population, in vitro virus isolations
from human immunodeficiency virus (HIV)-positive male homosexual
cohorts have shown frequent examples of multiple EBV infection and an
overall prevalence of type 2 EBV strains exceeding 30%. Here we ask to
what extent these findings might hold true in another
T-cell-immunocompromised cohort, HIV-positive hemophilic patients.
Resident EBV strains were rescued within lymphoblastoid cell lines
derived from the blood and throat washings of 39 such individuals,
using the same in vitro protocols of virus isolation as for the
homosexual cohort. A mean of 19 independent cell lines was made per
patient, and in each case the resident virus was characterized by
PCR-based viral genomic analysis and by immunoblotting to reveal the
viral "EBNAprint." By these criteria a significant proportion (14 of 39) of the hemophilic cohort carried more than one EBV strain,
suggesting that T-cell impairment does indeed sensitize virus carriers
to reinfection with new strains of exogenously transmitted virus.
However, the overall incidence of type 2 EBV infection was 10%, which
is close to that observed in the earlier work with healthy carriers and
substantially lower than that seen in HIV-positive homosexuals. We
infer that type 2 EBV is relatively rare in the general Caucasian
population but has become endemic in the homosexual community.
 |
INTRODUCTION |
Epstein-Barr virus (EBV), a
gammaherpesvirus widespread in human populations, is usually carried as
a lifelong asymptomatic infection yet is etiologically linked to a
number of different malignancies (reviewed in reference
37). It was the study of one such malignancy, the
endemic (African) form of Burkitt's lymphoma (BL), which first
identified two distinct types of EBV isolates (1, 9),
originally called A and B and now designated types 1 and 2. These are
essentially homologous across large stretches of the genome but are
distinguished by linked polymorphisms in the latent genes encoding the
nuclear antigens EBNA2, -3A, -3B, and -3C (1, 9, 41). The
virus type can therefore be determined at the DNA level by PCR
amplification across these polymorphic loci (2, 41, 47) and
at the protein level by using monoclonal antibodies (MAbs) or human
sera with type-specific reactivities against these antigens (40,
45). Furthermore, within each broad type, individual virus
strains can be distinguished by screening across other defined
polymorphisms in the viral genome (4, 30, 34, 35) and by
determining the strain-specific "EBNAprint," i.e., the precise
sizes of the virus-coded EBNA1, -2, -3A, -3B, and -3C proteins as
visualized in immunoblots (19, 53). Studies on endemic BL
tumors and subsequently on virus isolates rescued as in
vitro-transformed lymphoblastoid cell lines (LCLs) from healthy donors
suggested that type 1 and type 2 strains were of roughly equal
prevalence in at least some parts of equatorial Africa (57).
By contrast, the much rarer cases of EBV-positive sporadic BL occurring
in children in the Western world almost all carried a type 1 virus
(14, 58). This again appeared to reflect the situation
within the general population in these areas, where, based on virus
isolations, type 1 strains were prevalent and <10% of individuals
carried type 2 virus (20, 53). The balance of evidence from
such work also strongly suggested that healthy virus carriers harbored
a single virus strain; multiple infection either with different virus
types or with different strains of the same type appeared to be
extremely rare (20, 53; reviewed in reference
17).
The generality of these conclusions has subsequently been challenged by
observations of AIDS patients in Western communities. Such patients
show an unusually high risk both of Burkitt-like lymphoma, arising
relatively early in the course of AIDS and (like sporadic BL) EBV
genome positive in roughly 30% of cases (22, 48), and of
immunoblastic lymphoma arising in late-stage AIDS and (like
posttransplant lymphoma) EBV genome positive in the majority if not all
cases (22, 32). Unexpectedly, both of these AIDS-associated
lymphomas and also a third EBV-associated malignancy seen in this
patient group, Hodgkin's disease, were found to carry a type 2 EBV
strain in 25 to 50% of EBV genome-positive cases (6, 10, 14, 21,
36, 46). These observations, and an earlier report detecting
coresident EBV genotypes in an AIDS lymphoma patient (26),
prompted several studies of EBV infection in HIV-positive patients as a
whole, analyzing the types of virus that were detectable in the
oropharynx and circulating B-cell pool either directly by PCR analysis
or by virus rescue in vitro (7, 29, 31, 44, 50, 51, 54, 55).
This work clearly showed that the prevalence of type 2 virus infection in such patients was at least 30%, substantially higher than had been
apparent from most studies on the general population from which these
patients were drawn. Interestingly, detailed analysis of such in vitro
isolates revealed that most of the HIV-positive patients with
detectable type 2 EBV also carried a coresident type 1 strain, while
another 25% of the patients carried multiple viruses, all of type 1 (54).
The full biological significance of these findings is still not known.
One interpretation is that the EBV carrier state in HIV-positive
patients faithfully magnifies that which exists generally in the
immunocompetent population and that the full range of resident strains
are simply easier to detect in this immunocompromised setting because
of the higher overall viral load. If that were the case, earlier
studies (20, 53) must have seriously underestimated the true
prevalence of type 2 virus in the general Caucasian population (3,
47); this is possible in that type 2 strains may be subdominant in vivo and are rescued less efficiently than type 1 strains in in
vitro transformation assays (38). In seeking to address
these issues, we noted at the outset that almost all of the work to date on HIV-positive patients, including our own recent analysis (54, 55), had been confined to male homosexual cohorts. We reasoned that if the above-described arguments were true, then a
similar pattern of virus isolations should be obtained from other
T-cell-immunocompromised patient groups. In the present work we have
used the same methods as employed with the HIV-positive homosexual
cohort (54) to screen an equally large cohort of hemophilic
patients who, over a decade earlier, had acquired HIV iatrogenically
from contaminated Factor VIII concentrates.
 |
MATERIALS AND METHODS |
Patients.
The study group comprised 48 HIV-positive
hemophilic patients. These included 31 adult males (mean age, 39 years;
range, 22 to 71) attending outpatient clinics at the Queen Elizabeth
Hospital, Birmingham (designated QEH), or at Churchill Hospital, Oxford (OX), and 17 adolescent males (mean age, 16; range, 13 to 20) attending
outpatient clinics at the Birmingham Children's Hospital (BCH). All
patients had been infected with HIV in the early 1980s from
contaminated batches of factor VIII concentrate; they were studied
between 1993 and 1996, some 10 to 15 years following HIV infection, at
a time when almost all were significantly immunocompromised and showed
depressed CD4+ T-cell counts (median count,
150/mm3; range, 0 to 820). A control group consisted of 38 HIV-negative adolescent hemophilic patients, again sampled via
outpatient clinics at Birmingham Children's Hospital and spanning the
same age range as the 17 HIV-infected adolescent patients described
above. Heparinized blood (20 to 30 ml) and throat washings were taken
and processed as described previously (54), with most
patients being sampled on two separate occasions over the 3-year study
period. Blood samples provided plasma for serological studies and
mononuclear cells for virus isolation and in vitro regression assays,
while throat washings provided cell-free filtrates for virus isolation. Data thus obtained from the HIV-positive and HIV-negative hemophilic patient groups are compared with corresponding results from 40 HIV-positive male homosexuals studied in parallel (54) and
from 56 HIV-negative adult control donors analyzed in an earlier study (53).
Immunological assays.
Plasma preparations were first heat
inactivated at 56°C for 30 min and then stored at
20°C until
testing for immunoglobulin G antibody titers to the EBV capsid antigen
(VCA) by standard immunofluorescence assay (53). When yields
of peripheral blood mononuclear cells (PBM) from EBV-seropositive
patients were sufficiently high, an aliquot of cells was screened for
in vitro regression of B95.8 strain EBV-induced transformation to
provide a measure of EBV-specific cytotoxic T-lymphocyte (CTL) memory
function; results were expressed as the minimum seeding of PBM per
0.3-ml microtest plate well required to observe a 50% incidence of
regression in replicate wells, as described previously (35).
To allow comparison between patient groups, individual regression titer
end points were classified as being within the normal range for most
healthy EBV carriers (<4.5 × 105 PBM/well), weak
compared to those for most healthy carriers (4.5 × 105 to 6 × 105 PBM/well), or undetectable
(>6 × 105 PBM/well).
Virus isolation.
The methods for isolation of virus from
blood and from throat washings were exactly those used in the parallel
study of HIV-positive male homosexuals (54). Briefly, PBM
were cultured in 0.3-ml microtest plate wells at a range of cell
dilutions (six replicates/seeding) in RPMI 1640 medium and 10%
(vol/vol) fetal calf serum, initially supplemented with 0.1 µg of
cyclosporin A per ml to inhibit T-cell activation, and individual wells
developing spontaneously transformed foci of outgrowth were expanded to
provide LCLs carrying the patient's endogenous EBV isolate(s). Throat
washings were similarly assayed for transforming virus by using PBM
from cord blood or from adult EBV-seronegative donors as a source of
indicator cells. Note that these transformation assays were each
conducted over a 12-week period; all wells which developed
microscopically visible foci within that time were expanded
irrespective of growth rate; hence, the time from initial seeding to
LCL cryostorage could be up to 6 months. Occasionally wells developed
transformed foci which failed to expand, and in such cases the culture
was used to provide a DNA sample only.
Identification of virus isolates.
The methods of genomic and
EBNAprint analyses were essentially as described in earlier work
(28, 53, 54). Briefly, DNA from LCL preparations was
subjected to PCR amplification with primer-probe combinations across
type-specific polymorphisms within the EBNA2 and EBNA3C genes
(41), across the 33-bp repeat region of the latent membrane
protein 1 (LMP1) gene (34), and across a locus in LMP1 which
in some virus strains displays a 30-bp deletion relative to the B95.8
prototype (34). Reference EBV strains included in the
genomic analysis were B95.8 (type 1, 4.5 copies of the 33-bp LMP1
repeat, undeleted at the 30-bp LMP1 locus) and AG876 (type 2, 4 copies
of the 33-bp LMP1 repeat, deleted at the 30-bp LMP1 locus). Note that
although it is possible for heterogeneity across the 33-bp repeat
region to be generated during replication of a single EBV strain
(49), in practice we found that the great majority of LCL
clones established by B-cell transformation with a reference laboratory
strain retained the same number of repeats as shown by the cell lines
from which the reference virus was prepared (53a).
EBNAprints of LCL protein extracts were produced by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) separation and
immunoblotting as described previously (54). Reference cell extracts were provided by the EBV-negative B lymphoma line BJAB, the
type 1 EBV-transformed LCL C2+ OBA, and the type 2 EBV-transformed LCL
C2+ BL16. Antibody preparations used in immunoblotting were the
EBNA1-specific MAb IH4 (15), the EBNA2-specific MAb PE2 (56), the type 1 EBNA3C-specific MAb E3C-A10
(33), and human sera AM (preferentially reactive against
EBNA1), MS (preferentially reactive against type 1 EBNA3C), and NZ
(preferentially reactive against type 2 EBNA3C) (54). On
some occasions, immunoblots were also probed with the LMP1-specific MAb
pool CS1-4 (39). Blots were developed as described
previously (54).
On occasions where the above-described genomic and EBNAprint analyses
left some doubt about the relationship between coresident virus
isolates, a naturally polymorphic region of the EBNA1 gene (4) was amplified by using the primers 5'
GAAAAGAGGCCCAGGAGTCCCAGTAGTCAG 3' (B95.8 coordinates 109081 to
109110) and 5' AACAGCACGCATGATGTCTACTGGGGATTT 3' (B95.8
coordinates 109969-109940). The cycle for amplification was 35 cycles
of 94°C for 60 s, 62°C for 90 s, and 72°C for 240 s. The PCR product was run out on a 1% agarose gel and purified with
the Qiaquick gel extraction kit (Qiagen) according to the manufacturer's instructions. Purified DNA was eluted in a 50-µl volume, of which 15 µl was then incorporated into the sequencing reaction. Sequencing was carried out according to the manufacturer's instructions with an Amplicycle sequencing kit (Perkin-Elmer) and a
32P-end-labelled internal sequencing primer, 5'
AGAAGGCCCAAGCACTGGAC 3' (B95.8 coordinates 109278 to 109297), to
determine the nucleotide sequence of EBNA1 codons 470 to 510.
 |
RESULTS |
EBV immune status of hemophilic patients.
We first set out to
determine the status of the HIV-positive hemophilic patients with
respect to prior EBV infection, by using anti-VCA antibodies as a
serological indicator, and to measure the prevailing level of
EBV-specific T-cell immunity in EBV-infected patients, by using the in
vitro regression assay. For this part of the study, the 17 adolescent
patients are considered separately from the rest of the cohort so as to
allow their direct comparison with an adolescent control group of 38 HIV-negative hemophilic patients. As shown in Table
1, roughly two-thirds of these adolescent patients had a history of EBV infection, both in the HIV-positive cohort and in the HIV-negative control group. However anti-VCA titers
were fivefold higher in HIV-positive patients than in HIV-negative patients, an elevation consistent with that reported for other T-cell-immunocompromised cohorts and probably reflecting increased EBV
antigenic load in vivo (52). Furthermore, the level of
EBV-specific T-cell immunity was markedly reduced in the HIV-positive
patients, with six of the seven individuals analyzed failing to
register an end point in the in vitro regression assay; by contrast,
regression end points for EBV-infected hemophilic patients in the
HIV-negative control group were mostly within the normal range.
The results obtained from the 31 adult HIV-positive hemophilic patients
are also presented in Table
1. As might be expected,
a larger
proportion (90%) of these individuals had serological
evidence of an
existing EBV infection, matching the incidence
seen in our previous
screening of a healthy adult control group
(
53). Once again,
however, the mean anti-VCA titer was at least
fivefold higher in the
HIV-positive patients than in controls,
while EBV-specific T-cell
immunity as measured in the regression
assay was very significantly
impaired. Table
1 also includes
for comparison the corresponding values
obtained in a parallel
study of 40 HIV-positive male homosexuals, every
one of whom proved
to be EBV infected (
54). These patients
also showed elevated
anti-VCA titers and impaired T-cell immunity
compared to control
values, although the differences were not quite as
marked as with
the HIV-positive hemophilic patients.
EBV isolations from HIV-positive hemophilic patients.
Virus
isolates were prepared from the blood and/or throat washings of all 39 HIV-positive hemophilic patients (11 adolescent and 28 adult) who had
serological evidence of prior EBV infection. A mean of 19 independent
EBV isolates (range, 4 to 39) per patient was obtained. The different
patterns of results are described below.
(i) Patients with a single detectable EBV strain.
In 25 of the
39 patients studied, all EBV isolates rescued from a single individual
were of a single unique strain. These findings are illustrated here
with reference to BCH10, a patient from whom a total of 34 independent
EBV isolates (14 from blood and 20 from throat washings) were rescued
in vitro from two occasions of testing 2 years apart. Figure
1 presents the results of EBV genomic
analysis of four blood-derived isolates (isolates 1 to 4) and seven
throat washing-derived isolates (isolates 1* to 7*); these are
representative of the data from all 34 isolates from this patient.
Every virus isolate gave a type 1-specific PCR amplification product at
both the EBNA2 and EBNA3C polymorphic loci, and there was no evidence
of any coresident type 2 virus. Furthermore, every one of these type 1 isolates was identical at two well-characterized polymorphisms (the
33-bp repeat and 30-bp deletion loci) within the LMP1 gene sequence;
thus, as shown in Fig. 1, each isolate had six copies of the 33-bp
repeat and displayed a 30-bp deletion. Note that this and all ensuing
PCR assays included as reference virus isolates the prototype 1 B95.8
strain (4.5 copies of the 33-bp repeat and undeleted at the 30-bp
locus) and the prototype 2 AG876 strain (4 copies of the 33-bp repeat
and deleted at the 30-bp locus) (34).

View larger version (66K):
[in this window]
[in a new window]
|
FIG. 1.
PCR analysis of EBV strains carried by blood-derived
LCLs 1 to 4 and throat washing-derived LCLs 1* to 7* from patient
BCH10. For virus typing, EBNA2 gene amplification was carried out with
a common 5' primer and type-specific 3' primers, and EBNA3 gene
amplification was carried out with common 5' and 3' primers; in each
case, the products were probed separately with type-specific probes.
For strain detection, LMP1 gene amplifications were carried out across
the 33-bp repeat and 30-bp deletion loci. Assays included reference DNA
samples from the type 1 EBV-carrying B95.8 cell line (4.5 copies of the
33-bp repeat, undeleted [undel] at the 30-bp locus), the type 2 EBV-carrying AG876 cell line (4 copies of the 33-bp repeat, deleted
[del] at the 30-bp locus), and the EBV-negative (EB-ve) BJAB cell
line. All BCH10-derived isolates were type 1 and were identical by
strain-specific marker analysis. (Longer exposures of the LMP1 deletion
gel showed that isolate 2* was deleted at the 30-bp locus.)
|
|
The implication from these data, that patient BCH10 carried a single
type 1 virus strain, was further supported by the immunoblotting
data.
Here, protein extracts from the BCH10-derived LCLs were
separated by
SDS-PAGE, and the blots were probed with MAbs to
EBNA3C, EBNA2, and
EBNA1; on the same gels were included reference
extracts from the
EBV-negative B-cell line BJAB, from a type 1
virus-transformed LCL, and
from a type 2 virus-transformed LCL.
All 34 lines from patient BCH10
produced the same EBNAprint; representative
blots for blood-derived
LCLs 1 to 4 and throat washing-derived
LCLs 1* to 6* are shown in Fig.
2. The sizes of the EBNA3C, EBNA2,
and
EBNA1 proteins are uniform in every lane, strongly suggesting
that each
line carries the identical viral strain. Note also that
this virus can
be classified as a type 1 strain from the EBNAprint:
first the EBNA3C
protein was detectable by using the type 1 EBNA3C-specific
MAb E3CA10,
and second, the EBNA2 protein lay within the size
range (80 to 90 kDa)
typical of a type 1 allelic product and well
above the 75-kDa position
characteristic of type 2 EBNA2.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 2.
EBNAprint analysis of EBV strains carried by
blood-derived LCLs 1 to 4 and throat washing-derived LCLs 1* to 6* from
patient BCH10. Protein extracts were separated by SDS-PAGE, and the
immunoblots were then probed with the type 1 EBNA3-specific MAb E3CA10,
the EBNA2-specific MAb PE2, and the EBNA1-specific MAb IH4. Immunoblots
included reference protein samples from the type 1 EBV-transformed LCL
C2+ OBA, the type 2 EBV-transformed LCL C2+ BL16, and the EBV-negative
(EB-ve) BJAB cell line. All BCH10-derived isolates gave identical
EBNAprints.
|
|
The individual data for all 25 patients with a single detectable EBV
strain are presented in Table
2 (see
below); in 24 cases
the resident strain was of type 1, and in a single
case it was
of type 2.
(ii) Patients with multiple EBV strains.
The remaining 14 patients gave evidence of infection with more than one EBV strain. For
example, patient BCH3, who could be studied on a single occasion only
and from whom only five viral isolations were made, was interesting in
that one type 1 strain was detected in the blood and two other distinct
type 1 strains were detected in the throat. Figure
3 presents the PCR analysis of genomic
markers, from which it is clear that all five isolates were type 1 at
both the EBNA2 and EBNA3C loci. However, three different patterns
(shown by blood isolates 1 and 2, throat isolates 1* and 2*, and throat
isolate 3*) were observed from analysis of the polymorphic LMP1 loci.
These different viral identities were fully confirmed by the immunoblot
analysis illustrated in Fig. 4. Although
all isolates encoded EBNA2 proteins which migrated to similar positions
within the type 1 size range, the EBNA1 and EBNA3C immunoblots revealed
three different EBNAprints. In the case of EBNA1, the three resident
viral strains could be distinguished by EBNA1 size and by the fact that
the EBNA1 encoded by throat isolates 1* and 2* lacked the MAb IH4
epitope and had to be detected by using a polyvalent human serum, AM,
with strong anti-EBNA1 reactivity. In the case of EBNA3C, the strains
were again distinguishable on the basis of their different-sized EBNA3C
proteins and by the absence of the MAb E3CA10 epitope in the protein
encoded by throat isolate 3*.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 3.
PCR analysis of EBV strains carried by blood-derived
isolates 1 and 2 and throat washing-derived isolates 1* to 3* from
patient BCH3. Assays were conducted with controls as described for Fig.
1. All BCH3-derived isolates were type 1 but could be distinguished
into three groups (1, 2 v 1*, 2* v 3*) by strain-specific marker
analysis.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
EBNAprint analysis of EBV strains carried by
blood-derived isolates 1 and 2 and throat washing-derived isolates 1*
to 3* from patient BCH3. Immunoblots were conducted with controls as
described for Fig. 2; additional blots were probed with polyclonal
human (HU) sera from a type 1 virus-infected donor, MS (known to be
reactive to type 1 EBNA3C), and from donor AM (known to be selectively
reactive to EBNA1). The BCH3-derived isolates could be classified into
three groups (1, 2 v 1*, 2* v 3*) from their distinct
EBNAprints.
|
|
A second example of coinfection with distinct type 1 EBV strains comes
from patient QEH5. Figure
5 shows the PCR
analysis
of viral genome markers for blood-derived isolates 1 to 7 and
for throat washing-derived isolates 1* to 9*. All isolates were
exclusively type 1 at the EBNA2 and EBNA3C type-specific loci,
and all
were undeleted at the LMP1 locus. However, when the analysis
was
extended to the LMP1 33-bp repeat region, there was evidence
of viruses
with either two or six repeats in the blood and of
both these viruses
plus additional repeat size variants in the
throat; note that some LCLs
gave two signals in the LMP1 repeat
assay, suggesting that these are
mixed populations of cells carrying
different virus isolates. On their
own, such findings are not
diagnostic of coinfection with independent
viral strains, because
LMP1 repeat size heterogeneity might be
generated by nonhomologous
recombination during replication of a single
parental strain (
49).
However, the subsequent EBNAprint
analysis strongly suggested
that isolates with two repeats (e.g., LCLs
2, 4, and 2*) and isolates
with six repeats (e.g., LCLs 3, 5, and 8*)
represented distinct
strains. Thus, as shown in Fig.
6, these sets of isolates encoded
slightly different-sized EBNA3C, EBNA2, and EBNA1 proteins.
Interestingly,
when we extended the protein analysis by immunoblotting
with the
LMP1-specific MAb pool CS1-4, we noted that differences in
LMP1
size appeared to reflect the different numbers of 33-bp repeats;
such a correlation had not been observed in earlier studies comparing
the LMP1 proteins encoded by EBV strains known to be independent
of one
another (
28). Therefore, as a final check on the identity
of
the isolates from patient QEH5, we went on to amplify and sequence
across a naturally polymorphic region of the EBNA1 gene (codons
470 to
510) from a number of QEH5-derived LCLs. The sets of isolates
first
distinguished on the basis of LMP1 repeat numbers had clearly
different
sequence changes vis-à-vis B95.8 in this region and
therefore
must represent independent viral strains. Both strains
were rescued
from this patient on three successive occasions of
testing.

View larger version (98K):
[in this window]
[in a new window]
|
FIG. 5.
PCR analysis of EBV strains carried by blood-derived
isolates 1 to 7 and throat washing-derived isolates 1* to 9* from
patient QEH5. Assays were conducted with controls as described for Fig.
1. All QEH5-derived isolates were type 1 and undeleted at the LMP1
30-bp locus but showed different numbers of LMP1 33-bp repeats. Note
that some lanes display more than one PCR product in the LMP1 repeat
analysis, implying that in such cases the LCL is a mixture of cells
carrying different virus strains.
|
|

View larger version (95K):
[in this window]
[in a new window]
|
FIG. 6.
EBNAprint analysis of EBV strains carried by
blood-derived isolates 1 to 5 and throat washing-derived isolates 2*
and 7* to 9* from patient QEH5. Immunoblots were conducted with
controls as described for Fig. 2; an additional blot was probed with
the LMP1-specific MAb pool CS1-4. The two main EBNAprint patterns are
illustrated by isolates 1, 3, 5, and 8* and by isolates 2, 4, and 2*,
respectively.
|
|
In most of the cases (11 of 14) where multiple EBV infections were
identified, the coresident viral strains were all of type
1; only three
individuals were found to carry both type 1 and
type 2 viruses. These
are exemplified by patient BCH7, from whom
12 blood-derived (1 to 12)
and nine throat washing-derived (1*
to 9*) LCLs were rescued in vitro.
As shown by the PCR amplification
data in Fig.
7, all of these gave type 1-specific
signals at both
EBNA2 and EBNA3C polymorphic loci. However, three of
the blood-derived
LCLs
5,
8, and
12 also gave type 2-specific signals at
both loci.
This result was confirmed on several occasions of testing,
including
when the initial freezings of these particular cell
lines were
resuscitated and reanalyzed. The type 2 virus-carrying
cells appeared
to be a minor subpopulation in these LCLs, however,
since their
presence was barely detectable on immunoblots (data
not shown). This
type 2 virus was not detectable in the throat
washing isolates from
BCH7; instead, we found two type 1 viruses
in the throat, one which had
the same PCR profile as the dominant
virus in the blood, with 5.5 copies of the 33-bp repeat and undeleted
at the 30-bp locus, and a
different type 1 strain, with 4.5 copies
of the 33-bp repeat and
undeleted at the 30-bp locus (Fig.
7 and
data not shown). Of the two
other individuals giving evidence
of type 1 plus type 2 coinfection,
patient OX1 resembled BCH7
in that both virus types were detectable in
the blood but only
type 1 virus was detectable in the throat. By
contrast, patient
QEH15 was positive for both virus types in the blood
and in the
throat, a result which was observed on two independent
occasions
of testing 2 years apart. The individual data for all 11 patients
carrying multiple type 1 EBV strains and for the three
patients
carrying both type 1 and type 2 strains are presented in Table
2.

View larger version (110K):
[in this window]
[in a new window]
|
FIG. 7.
PCR analysis of EBV strains carried by blood isolates 1 to 12 and throat washing-derived isolates 1* to 9* from patient BCH7.
Assays were conducted with controls as described for Fig. 1. All LCLs
carried type 1 virus, but LCLs 5, 8, and 12 also contained cells
carrying a type 2 virus; among the type 1 isolates, one was dominant in
the blood, but a second type 1 virus, distinguishable by LMP1 repeat
size, was detectable in the throat (isolates 1* to 4*).
|
|
 |
DISCUSSION |
This work set out to resolve a number of apparently
contradictory findings in the literature regarding the number and type of EBV strains present within virus carriers. On the one hand, the
analysis of healthy EBV-infected individuals in Western countries suggests that most if not all carry a single virus strain only and that
this is of type 1 in at least 90% of cases (reviewed in reference
17). Such conclusions are based on detailed virus isolation studies (20, 53), including prospective sampling of individual donors over several years (53), and on the
fact that familial transmission of particular virus strains can be traced retrospectively between generations (19). On the
other hand, virus isolation studies of HIV-positive patients, largely involving male homosexual cohorts, show that at least half of such
patients carry multiple EBV strains and that the incidence of type 2 virus infection exceeds 30% (7, 31, 44, 54, 55). This
prompts a number of questions. In particular, do the data for
T-cell-immunocompromised patients magnify what is occurring (albeit
undetected) in healthy virus carriers, or are they specific to the
immunocompromised patient group? If the latter, to what extent are the
atypical features of EBV carriage in HIV-positive homosexuals a
consequence of immune impairment per se and to what extent do they
reflect the increased risk of hematogeneous viral transmissions
associated with a homosexual lifestyle? We sought to address these
questions by applying exactly the same EBV isolation protocols to a
second HIV-positive cohort, namely, hemophilic patients who had become
iatrogenically infected with HIV over a decade earlier from
contaminated batches of Factor VIII concentrate.
The preliminary assays of anti-VCA antibody titers and of EBV-specific
T-cell immunity in these hemophilic patients (Table 1) were important
for the following reasons. First, they showed that approximately
one-third of adolescent hemophilic patients, whether from the
HIV-positive study group or HIV-negative controls, had no serological
evidence of prior EBV infection, a value in line with that expected for
this age group in the general population of the United Kingdom
(25). Likewise, adult HIV-positive hemophilic patients had a
90% incidence of EBV seropositivity, again mirroring that seen in the
general adult population (53). Hence, one can discount the
possibility that Factor VIII preparations can act as a source of EBV
infection; it is most likely, therefore, that hemophilic patients
acquire EBV via the natural oral route. Second, using elevated anti-VCA
titers and depressed virus-specific T-cell responses as surrogate
markers of immune T-cell impairment (52), we found that the
HIV-positive hemophilic patients as a group were at least as
immunocompromised as the HIV-positive homosexuals examined in a
parallel study (54). This is further supported by comparing
general criteria of immune status, such as CD4+ T-cell
counts and the proportion of patients with symptoms of AIDS (see
footnotes a and b of Table 3). Hence, any
differences between the two groups in their range of resident EBV
strains cannot be ascribed to differences in host immune competence.
The two studies were also equally rigorous in that here we screened 745 independent virus isolates from 39 hemophilic patients, compared to 560 isolates from 35 homosexual patients in the parallel work (54). Given these numbers, any differences in results are
also unlikely to have arisen through sampling error alone.
Table 3 summarizes the overall data from
the two studies in terms of the numbers of individuals with single or
with multiple EBV strains and the numbers with type 1 and/or type 2 virus infection. These allow us to draw conclusions on two major
issues. The first issue is whether overt multiple infections are a
feature of all T-cell-immunocompromised groups. We were concerned that
the frequency of multiple infection previously seen in the HIV-positive
homosexual patients might reflect the atypical acquisition of
additional EBV strains via a hematogeneous route from sexual contacts.
Likewise, allograft recipients, another immunocompromised group for
whom multiple EBV infections have been reported (18, 20),
might also have acquired virus by an atypical route, namely, from B cells in the allograft itself (16, 23). In fact, we found that a substantial proportion (36%) of HIV-positive hemophilic patients also carry two or more detectable EBV strains, and, as argued
earlier, these almost certainly have been acquired by the natural
route. As an additional control to ask whether hemophilia per se is a
predisposing factor, we also screened several HIV-negative hemophilic
patients without finding evidence of coresident EBV strains
(55a). The data therefore suggest very strongly that immune
T-cell impairment is the major determinant of the overt multiple EBV
infections seen in HIV-positive individuals. It is also interesting
that both here (Table 2) and in the homosexual cohort (54),
multiple infections with virus strains of the same type are more
frequently found in the throat than in the blood; possible reasons for
this are discussed elsewhere (54).
It remains a moot point, however, whether the acquisition of multiple
EBV strains is genuinely restricted to immunocompromised individuals or
is merely easier to detect in such cases because of the elevated virus
load in vivo. In this context, some studies based on the direct PCR
amplification of ex vivo samples, either across polymorphisms in the
EBNA1 gene (4) or in the BamHI-F region of the
genome (30), suggest that different strains coexist in the
blood and/or throat of healthy immunocompetent carriers. On the other
hand, in vitro isolation studies indicate the dominance of a single
transforming strain in the great majority of such carriers, with any
observed heterogeneity among isolates from a single individual being
the result of intrastrain recombination at repeat sequences in the
viral genome (20, 53). Final resolution of this issue will
require a combination of these two approaches and must take into
account the possible involvement of transformation-defective viruses
that would not be rescued in vitro. Nevertheless, the power of in vitro
isolation methods should not be underestimated. In the present work the
detection of coresident EBV strains in HIV-positive hemophilic patients
was not dependent on establishing unusually large numbers of virus
isolates per patient; the mean numbers of isolates from individuals
with overt multiple infection were actually lower than those for
individuals with only one detectable strain (see Table 2, footnote
a). Furthermore, in most cases where coinfection occurred,
the different resident strains were each represented several times in
the panel of LCLs derived from that individual, and so their presence
was not difficult to detect. The uniformity of virus strains observed
among independent virus isolates from healthy carriers (20,
53) is therefore more striking when viewed in this light.
The second issue being addressed by this study is whether type 2 virus
strains are prevalent in all T-cell-immunocompromised groups. Our data
strongly suggest that this is not the case. Thus, we found that just
10% of HIV-positive hemophiliacs had detectable type 2 EBV infection,
and in only one patient was a type 2 virus the dominant strain. This is
significantly different (P < 0.05) from what was seen
in HIV-positive homosexuals, where >30% of patients carried a type 2 virus, often as the dominant or equidominant strain rescuable in vitro
(54). Note that although the slower growth of type 2 virus-transformed LCLs can bias against type 2 virus detection in in
vitro isolation assays (38), our protocols are specifically
designed to minimize this problem. Whatever residual bias exists,
however, must apply equally to the studies of both HIV-positive
cohorts. We conclude, therefore, that there is a real difference in
type 2 virus prevalence between the hemophilic and homosexual patient
groups. It is well established that homosexual groups can harbor a
greater range of infectious agents than are endemic in the general
population. By contrast, apart from iatrogenic infections from Factor
VIII preparations, hemophilic patients tend to mirror the general
population in their viral flora. The example of human herpesvirus 8, a
sexually transmitted gammaherpesvirus, is especially pertinent here;
the incidence of human herpesvirus 8 infection in HIV-positive
homosexuals is markedly higher than that seen in HIV-positive
hemophilic patients or in the general population (12, 27).
We interpret our findings as showing that type 2 strains of EBV, a type
most commonly seen in equatorial Africa, have become endemic in
homosexual communities in the West, whereas they remain relatively rare
in the general population as a whole. The previously reported high
incidence of type 2 virus infection (7, 29, 31, 44, 50, 51, 54,
55) and of type 2 virus-positive malignancies (6, 10, 14,
21, 36, 46) among HIV-positive patients almost certainly reflects
the predominance of male homosexuals in these patient cohorts,
especially during the first 10 years of the AIDS epidemic
(5). It is also necessary to reexamine the notion, to which
these earlier findings gave rise, that type 2 viruses enjoy some kind
of selective advantage over type 1 strains in the immunologically
compromised host. There is no a priori reason for this, and it seems to
us more likely that both viruses are able to take equal advantage of
impaired T-cell surveillance. The implication of our findings is that
the relative prevalence rates of type 1 and type 2 viruses, at least in
the general population in the United Kingdom, are in line with those
first suggested from in vitro isolation studies of healthy individuals,
where the great majority carried type 1 virus and only 5 to 10%
carried type 2 (53). Interestingly, an extensive survey of
virus isolates from Dutch bone marrow transplant recipients led to
similar conclusions regarding type 2 prevalence (20). Such
observations are also in line with the European data from three
EBV-associated tumors, posttransplant lymphoma, sporadic BL, and
Hodgkin's disease, arising in HIV-negative patients; these tumors were
found to carry a type 1 strain in the great majority of EBV
genome-positive cases (8a, 10, 13, 24, 42, 58). This
preponderance of type 1 viruses cannot be due to nonpathogenicity of
type 2 EBV, since type 2 strains are well represented in these same
categories of malignancy arising in (predominantly homosexual) AIDS
cohorts (6, 10, 14, 21, 36, 46). The question of type 2 virus prevalence in other Western societies remains to be resolved and
will require in vitro isolation work to complement the results of
direct PCR amplification assays. It is possible that in North America,
where a greater proportion of the population is of African descent, type 2 prevalence may be higher (47). Even here, however,
the data from EBV-associated tumors arising in HIV-negative patients strongly suggest that type 1 viruses are predominant (8, 11, 14,
29a). It will be important to map the epidemiology of type 1 and
type 2 virus infections more accurately on a worldwide basis so that we
can begin to understand how EBV coevolution with the human species led
to the emergence of these distinct virus types.
 |
ACKNOWLEDGMENTS |
This work was supported by the Cancer Research Campaign, United
Kingdom, and by the Endowment Fund of the University Hospital Birmingham.
We thank Susan Williams for photography and Deborah Williams for
excellent secretarial assistance.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: CRC Institute
for Cancer Studies, University of Birmingham, Edgbaston, Birmingham B15 2TA, United Kingdom. Phone: 121-414-4492. Fax: 121-414-4486. E-mail: Williamsd{at}cancer.bham.ac.uk.
 |
REFERENCES |
| 1.
|
Adldinger, H. K.,
H. Delius,
U. K. Freese,
J. Clarke, and G. W. Bornkamm.
1985.
A putative transforming gene of Jijoye virus differs from that of Epstein-Barr virus prototypes.
Virology
141:221-234[Medline].
|
| 2.
|
Aitken, C.,
S. K. Sengupta,
C. Aedes,
D. J. Moss, and T. B. Sculley.
1994.
Heterogeneity within the Epstein-Barr virus nuclear antigen 2 gene in different strains of Epstein-Barr virus.
J. Gen. Virol.
75:95-100[Abstract/Free Full Text].
|
| 3.
|
Appolloni, A., and T. B. Sculley.
1994.
Detection of A-type and B-type Epstein-Barr virus in throat washings and lymphocytes.
Virology
202:978-981[Medline].
|
| 4.
|
Bhatia, K.,
A. Raj,
M. I. Guttierez,
J.-G. Judde,
G. Spangler,
H. Venkatesh, and I. T. Magrath.
1996.
Variation in the sequence of Epstein-Barr virus nuclear antigen 1 in normal peripheral blood lymphocytes and in Burkitt's lymphomas.
Oncogene
13:177-181[Medline].
|
| 5.
|
Biggar, R. J., and C. S. Rabkin.
1996.
The epidemiology of AIDS-related neoplasms.
Haematol./Oncol. Clin. N. Am.
10:997-1010.
|
| 6.
|
Boyle, M. J.,
W. A. Sewell,
T. B. Sculley,
A. Apolloni,
J. J. Turner,
C. E. Swanson,
R. Penny, and D. A. Cooper.
1991.
Subtypes of Epstein-Barr virus in human immunodeficiency virus-associated non-Hodgkin lymphomas.
Blood
78:3004-3001[Abstract/Free Full Text].
|
| 7.
|
Buisson, M.,
P. Morand,
O. Genoulaz,
M.-J. Bourgeat,
M. Micoud, and J.-M. Seigneurin.
1994.
Changes in the dominant Epstein-Barr virus type during human immunodeficiency virus infection.
J. Gen. Virol.
75:431-437[Abstract/Free Full Text].
|
| 8.
|
Cen, H.,
P. A. Williams,
H. P. McWilliams,
M. C. Breinig,
M. Ho, and J. L. C. McKnight.
1993.
Evidence for restricted Epstein-Barr virus latent gene expression and anti-EBNA antibody response in solid organ transplant recipients with post-transplant lymphoproliferative disorders.
Blood
81:1393-1403[Abstract/Free Full Text].
|
| 8a.
| Crawford, D. H. Personal communication.
|
| 9.
|
Dambaugh, T.,
K. Hennessy,
L. Chamnankit, and E. Kieff.
1984.
U2 region of Epstein-Barr virus DNA may encoded Epstein-Barr nuclear antigen 2.
Proc. Natl. Acad. Sci. USA
81:7632-7636[Abstract/Free Full Text].
|
| 10.
|
De Re, V.,
M. Boiocchi,
S. De Vita,
R. Dolcetti,
A. Gloghini,
S. Uccini,
C. Baroni,
A. Scarpa,
G. Cattoretti, and A. Carbone.
1993.
Subtypes of Epstein-Barr virus in HIV-1-associated and HIV-1-unrelated Hodgkin's Disease cases.
Int. J. Cancer
54:895-898[Medline].
|
| 11.
|
Frank, D.,
E. Cesarman,
Y. F. Liu,
R. E. Michler, and D. M. Knowles.
1995.
Post-transplantation lymphoproliferative disorders frequently contain type A but not type B Epstein-Barr virus.
Blood
85:1396-1403[Abstract/Free Full Text].
|
| 12.
|
Gao, S.-J.,
L. Kingsley,
M. Li,
W. Zheng,
C. Parravicini,
J. Ziegler,
R. Newton,
C. R. Rinaldo,
A. Saah,
J. Phair,
R. Detels,
Y. Chang, and P. S. Moore.
1996.
KSHV antibodies among Americans, Italians and Ugandans with or without Kaposi's sarcoma.
Nat. Med.
2:925-928[Medline].
|
| 13.
|
Gledhill, S.,
A. Gallagher,
D. B. Jones,
A. S. Krajewski,
F. E. Alexander,
E. Klee,
D. H. Wright,
C. O'Brien,
D. E. Onions, and R. F. Jarrett.
1991.
Viral involvement in Hodgkin's Disease detection of clonal type A Epstein-Barr virus genomes in tumour samples.
Br. J. Cancer
64:227-232[Medline].
|
| 14.
|
Goldschmidts, W. L.,
K. Bhatia,
J. Franklin-Johnson,
N. Akar,
M. I. Guttierez,
D. Shibata,
M. Carolan,
A. Levine, and I. T. Magrath.
1992.
Epstein-Barr virus genotypes in AIDS-associated lymphomas are similar to those in endemic Burkitt's lymphoma.
Leukaemia
6:875-878[Medline].
|
| 15.
|
Grasser, F. A.,
P. G. Murray,
E. Kremmer,
K. Klein,
K. Remberger,
W. Feiden,
G. Reynolds,
G. Niedobitek,
L. S. Young, and N. Muller-Lantzsch.
1994.
Monoclonal antibodies directed against the Epstein-Barr virus-encoded nuclear antigen 1: immunohistochemical detection of EBNA1 in the malignant cells of Hodgkin's disease.
Blood
84:3792-3799[Abstract/Free Full Text].
|
| 16.
|
Gratama, J. W.
1994.
Epstein-Barr virus infections of bone marrow transplantation recipients, p. 429-442.
In
S. J. Forman, K. G. Blume, and E. D. Thomas (ed.), Bone marrow transplantation. Blackwell Scientific Publications, New York, N.Y.
|
| 17.
|
Gratama, J. W., and I. Ernberg.
1995.
Molecular epidemiology of Epstein-Barr virus infection.
Adv. Cancer Res.
67:197-255[Medline].
|
| 18.
|
Gratama, J. W.,
E. T. Lennette,
B. Lonnqvist,
M. A. P. Oosterveer,
G. Klein,
O. Ringden, and I. Ernberg.
1992.
Detection of multiple Epstein-Barr viral strains in allogeneic bone marrow transplant recipients.
J. Med. Virol.
37:39-47[Medline].
|
| 19.
|
Gratama, J. W.,
M. A. P. Oosterveer,
G. Klein, and I. Ernberg.
1990.
EBNA size polymorphism can be used to trace Epstein-Barr virus spread within families.
J. Virol.
64:4703-4708[Abstract/Free Full Text].
|
| 20.
|
Gratama, J. W.,
M. A. P. Oosterveer,
W. Weimar,
K. Sintnicolaas,
W. Sizoo,
R. L. H. Bolhuis, and I. Ernberg.
1994.
Detection of multiple `Ebnotypes' in individual Epstein-Barr virus carriers following lymphocyte transformation by virus derived from peripheral blood and oropharynx.
J. Gen. Virol.
75:85-94[Abstract/Free Full Text].
|
| 21.
|
Gunthel, C. J.,
V. Ng,
M. McGrath,
B. Herndier, and B. Shiramizu.
1994.
Association of Epstein-Barr virus types 1 and 2 with acquired immunodeficiency syndrome-related primary central nervous system lymphomas.
Blood
83:618-619[Free Full Text].
|
| 22.
|
Hamilton-Dutoit, S. J.,
M. Raphael,
J. Ardouin,
J. Diebold,
I. Lisse,
C. Pederson,
E. Oksenhendler,
L. Marelle, and G. Pallesen.
1993.
In situ demonstration of Epstein-Barr virus small RNAs (EBER1) in acquired immunodeficiency syndrome-related lymphomas: correlation with tumour morphology and primary site.
Blood
82:619-624[Abstract/Free Full Text].
|
| 23.
|
Haque, T. J., and D. H. Crawford.
1996.
Transmission of Epstein-Barr virus during transplantation.
Rev. Med. Virol.
6:77-84.
[Medline] |
| 24.
|
Haque, T.,
J. A. Thomas,
K. I. Falk,
R. Parratt,
B. J. Hunt,
M. Yacoub, and D. H. Crawford.
1996.
Transmission of donor Epstein-Barr virus (EBV) in transplanted organs causes lymphoproliferative disease in EBV-seronegative recipients.
J. Gen. Virol.
77:1169-1172[Abstract/Free Full Text].
|
| 25.
|
Henle, W., and G. Henle.
1979.
Seroepidemiology of the virus, p. 61-78.
In
M. A. Epstein, and B. G. Achong (ed.), The Epstein-Barr virus. Springer-Verlag, Berlin, Germany.
|
| 26.
|
Katz, B. Z.,
W. A. Andiman,
R. Eastman,
K. Martin, and G. Miller.
1986.
Infection with two genotypes of Epstein-Barr virus in an infant with AIDS and lymphoma of the central nervous system.
J. Infect. Dis.
153:601-604[Medline].
|
| 27.
|
Kedes, D. H.,
E. Operskalski,
M. Busch,
R. Kohn,
J. Flood, and D. Ganem.
1996.
The seroepidemiology of human herpesvirus 8 (Kaposi's sarcoma- associated herpesvirus): distribution of infection in KS risk groups and evidence for sexual transmission.
Nat. Med.
2:918-924[Medline].
|
| 28.
|
Khanim, F.,
Q.-Y. Yao,
G. Niedobitek,
S. Sihota,
A. B. Rickinson, and L. S. Young.
1996.
Analysis of Epstein-Barr virus gene polymorphisms in normal donors and in virus-associated tumours from different geographic locations.
Blood
88:3491-3501[Abstract/Free Full Text].
|
| 29.
|
Kyaw, M. T.,
L. Hurren,
L. Evans,
D. J. Moss,
D. A. Cooper,
E. Benson,
E. Esmore, and T. B. Sculley.
1992.
Expression of B-type Epstein-Barr virus in HIV-infected patients and cardiac transplant recipients.
AIDS Res. Hum. Retroviruses
8:1869-1874[Medline].
|
| 29a.
| Liebowitz, D. Personal communication.
|
| 30.
|
Lung, M. L.,
W. P. Lam,
K. H. Chan,
S. Li,
J. Sham, and D. Choy.
1992.
Direct detection of Epstein-Barr virus in peripheral blood and comparison of Epstein-Barr virus genotypes present in direct specimens and lymphoblastoid cell lines established from nasopharyngeal carcinoma patients and healthy carriers in Hong Kong.
Int. J. Cancer
52:174-177[Medline].
|
| 31.
|
Luxton, J. C.,
A. Williams,
I. Weller, and D. H. Crawford.
1993.
Epstein-Barr virus infection of HIV-seropositive individuals is transiently suppressed by high dose acyclovir treatment.
AIDS
7:1337-1343[Medline].
|
| 32.
|
MacMahon, E. M.,
J. D. Glass,
D. Hayward,
R. B. Mann,
P. S. Becker,
P. Charache,
J. C. McArthur, and R. F. Ambinder.
1991.
Epstein-Barr virus in AIDS-related primary central nervous system lymphoma.
Lancet
338:969-973[Medline].
|
| 33.
|
Maunders, M. J.,
L. Petti, and M. Rowe.
1994.
Precipitation of the Epstein-Barr virus protein EBNA2 by an EBNA3C-specific monoclonal antibody.
J. Gen. Virol.
75:769-778[Abstract/Free Full Text].
|
| 34.
|
Miller, W. E.,
R. H. Edwards,
D. M. Walling, and N. Taab-Traub.
1994.
Sequence variation in the Epstein-Barr virus latent membrane protein 1.
J. Gen. Virol.
75:2729-2740[Abstract/Free Full Text].
|
| 35.
|
Moss, D. J.,
A. B. Rickinson, and J. H. Pope.
1978.
Long-term T cell-mediated immunity to Epstein-Barr virus in man. I. Complete regression of virus-induced transformation in cultures of seropositive donor leukocytes.
Int. J. Cancer
22:662-668[Medline].
|
| 36.
|
Ometto, L.,
C. Menin,
S. Masiero,
L. Bonaldi,
A. del Mistro,
A. M. Cattelan,
E. D'Andrea,
A. de Rossi, and L. Chieco-Bianci.
1997.
Molecular profile of Epstein-Barr virus in human immunodeficiency virus type 1-related lymphadenopathies and lymphomas.
Blood
90:313-322[Abstract/Free Full Text].
|
| 37.
|
Rickinson, A. B., and E. Kieff.
1996.
Epstein-Barr virus, p. 2397-2446.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology. Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 38.
|
Rickinson, A. B.,
L. S. Young, and M. Rowe.
1987.
Influence of the Epstein-Barr virus nuclear antigen EBNA2 on the growth phenotype of virus-transformed B cells.
J. Virol.
61:1310-1317[Abstract/Free Full Text].
|
| 39.
|
Rowe, M.,
H. S. Evans,
L. S. Young,
K. Hennessy,
E. Kieff, and A. B. Rickinson.
1987.
Monoclonal antibodies to the latent membrane protein of Epstein-Barr virus reveal heterogeneity of the protein and inducible expression in virus-transformed cells.
J. Gen. Virol.
68:1575-1586[Abstract/Free Full Text].
|
| 40.
|
Rowe, M.,
L. S. Young,
K. Cadwallader,
L. Petti,
E. Kieff, and A. B. Rickinson.
1989.
Distinction between Epstein-Barr virus type A (EBNA2A) and type B (EBNA2B) isolates extends to the EBNA3 family of nuclear proteins.
J. Virol.
63:1031-1039[Abstract/Free Full Text].
|
| 41.
|
Sample, J.,
L. Young,
B. Martin,
T. Chatman,
E. Kieff,
A. Rickinson, and E. Kieff.
1990.
Epstein-Barr virus type 1 (EBV-1) and 2 (EBV-2) differ in their EBNA-3A, EBNA-3B, and EBNA-3C genes.
J. Virol.
64:4084-4092[Abstract/Free Full Text].
|
| 42.
|
Sandvej, K.,
S. C. Peh,
B. Storstein Andresen, and G. Pallesen.
1994.
Identification of potential hot spots in the carboxy-terminal part of the Epstein-Barr virus (EBV) BNLF-1 gene in both malignant and benign EBV-associated diseases: high frequency of a 30 bp deletion in Malaysian and Danish peripheral T cell lymphomas.
Blood
84:4053-4060[Abstract/Free Full Text].
|
| 43.
|
Schuster, V.,
G. Ott,
S. Seidenspinner, and H. W. Kreth.
1996.
Common Epstein-Barr virus (EBV) type 1 variant strains in both malignant and benign EBV-associated disorders.
Blood
87:1579-1585[Abstract/Free Full Text].
|
| 44.
|
Sculley, T. B.,
A. Apolloni,
L. Hurren,
D. J. Moss, and D. A. Cooper.
1990.
Coinfection with A- and B-type Epstein-Barr virus in human immunodeficiency virus-positive subjects.
J. Infect. Dis.
162:643-648[Medline].
|
| 45.
|
Sculley, T. B.,
A. Apolloni,
D. J. Moss,
N. Mueller-Lantsch,
I. S. Misko, and D. A. Cooper.
1989.
Expression of Epstein-Barr virus nuclear antigens 3, 4 and 6 are altered in cell lines containing B type virus.
Virology
171:401-408[Medline].
|
| 46.
|
Shibata, D.,
L. M. Weiss,
A. M. Hernandez,
B. N. Nathwani,
L. Bernstein, and A. M. Levine.
1993.
Epstein-Barr virus-associated non-Hodgkin's lymphoma in patients infected with the human immunodeficiency virus.
Blood
81:2102-2109[Abstract/Free Full Text].
|
| 47.
|
Sixbey, J. W.,
P. Shirley,
P. J. Chesney,
D. M. Buntin, and L. Resnick.
1989.
Detection of a second widespread strain of Epstein-Barr virus.
Lancet
ii:761-765.
|
| 48.
|
Subar, M.,
A. Neri,
G. Inghirami,
D. M. Knowles, and R. Dalla-Favera.
1988.
Frequent c-myc oncogene activation and infrequent presence of Epstein-Barr virus genome in AIDS-associated lymphoma.
Blood
72:667-671[Abstract/Free Full Text].
|
| 49.
|
Walling, D. M.,
N. M. Clark,
D. M. Markovitz,
T. S. Frank,
D. K. Brawn,
E. Eisenberg,
D. J. Krutchkoff,
D. H. Felix, and N. Raab-Traub.
1995.
Epstein-Barr virus co-infection and recombination in non-human-immunodeficiency virus-associated oral hairy leukoplakia.
J. Infect. Dis.
171:1122-1130[Medline].
|
| 50.
|
Walling, D. M.,
S. N. Edmistan,
J. W. Sixbey,
M. Abdel-Hamid,
L. Resnick, and N. Raab-Traub.
1992.
Co-infection of multiple strains of the Epstein-Barr virus in human immunodeficiency virus-associated hairy leukoplakia.
Proc. Natl. Acad. Sci. USA
89:6560-6564[Abstract/Free Full Text].
|
| 51.
|
Walling, D. M.,
A. G. Perkins,
J. Webster-Cyriaque,
L. Resnick, and N. Raab-Traub.
1994.
The Epstein-Barr virus EBNA-2 gene in oral hairy leukoplakia: strain variation, genetic recombination, and transcriptional expression.
J. Virol.
68:7918-7926[Abstract/Free Full Text].
|
| 52.
|
Yao, Q. Y.,
A. B. Rickinson,
J. S. H. Gaston, and M. A. Epstein.
1985.
In vitro analysis of the Epstein-Barr virus:host balance in long-term renal allograft recipients.
Int. J. Cancer
35:43-49[Medline].
|
| 53.
|
Yao, Q. Y.,
M. Rowe,
B. Martin,
L. S. Young, and A. B. Rickinson.
1991.
The Epstein-Barr virus carrier state: dominance of a single growth-transforming isolate in the blood and in the oropharynx of healthy virus carriers.
J. Gen. Virol.
72:1579-1590[Abstract/Free Full Text].
|
| 53a.
| Yao, Q. Y., and R. J. Tierney. Unpublished
results.
|
| 54.
|
Yao, Q. Y.,
R. J. Tierney,
D. Croom-Carter,
D. Dukers,
G. M. Cooper,
C. J. Ellis,
M. Rowe, and A. B. Rickinson.
1996.
Frequency of multiple EBV infections in T-cell-immunocompromised individuals.
J. Virol.
70:4884-4894[Abstract/Free Full Text].
|
| 55.
|
Yao, Q. Y.,
R. J. Tierney,
D. Croom-Carter,
J. Cooper,
C. Ellis,
M. Rowe, and A. B. Rickinson.
1996.
Isolation of intertypic recombinants of Epstein-Barr virus from T-cell-immunocompromised individuals.
J. Virol.
70:4895-4903[Abstract/Free Full Text].
|
| 55a.
| Yao, Q. Y., et al. Unpublished results.
|
| 56.
|
Young, L. S.,
C. Alfieri,
K. Hennessy,
H. Evans,
C. O'Hara,
K. C. Anderson,
J. Ritz,
R. S. Shapiro,
A. Rickinson,
E. Kieff, and J. I. Cohen.
1989.
Expression of Epstein-Barr virus transformation-associated genes in tissues of patients with EBV lymphoproliferative disease.
N. Engl. J. Med.
321:1080-1085[Abstract].
|
| 57.
|
Young, L. S.,
Q. Y. Yao,
C. M. Rooney,
T. B. Sculley,
D. J. Moss,
H. Rupani,
G. Laux,
G. W. Bornkamm, and A. B. Rickinson.
1987.
New type B isolates of Epstein-Barr virus from Burkitt's lymphoma and from normal individuals in endemic areas.
J. Gen. Virol.
68:2853-2862[Abstract/Free Full Text].
|
| 58.
|
Zimber, U.,
H. K. Adldinger,
G. M. Lenoir,
M. Vuillaume,
M. V. Knebel-Doeberitz,
G. Laux,
C. Desgranges,
P. Wittman,
U. K. Freese,
U. Schneider, and G. W. Bornkamm.
1986.
Geographical prevalence of two Epstein-Barr virus types.
Virology
154:56-66[Medline].
|
J Virol, May 1998, p. 4352-4363, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Harada, S., Kamata, Y., Ishii, Y., Eda, H., Kitamura, R., Obayashi, M., Ito, S., Ban, F., Kuranari, J., Nakajima, H., Kuze, T., Hayashi, M., Okabe, N., Senpuku, H., Miyasaka, N., Nakamura, Y., Kanegane, H., Yanagi, K.
(2004). Maintenance of Serum Immunoglobulin G Antibodies to Epstein-Barr Virus (EBV) Nuclear Antigen 2 in Healthy Individuals from Different Age Groups in a Japanese Population with a High Childhood Incidence of Asymptomatic Primary EBV Infection. CVI
11: 123-130
[Abstract]
[Full Text]
-
Walling, D. M., Brown, A. L., Etienne, W., Keitel, W. A., Ling, P. D.
(2003). Multiple Epstein-Barr Virus Infections in Healthy Individuals. J. Virol.
77: 6546-6550
[Abstract]
[Full Text]
-
Tao, Q., Yang, J., Huang, H., Swinnen, L. J., Ambinder, R. F.
(2002). Conservation of Epstein-Barr Virus Cytotoxic T-Cell Epitopes in Posttransplant Lymphomas : Implications for Immune Therapy. Am. J. Pathol.
160: 1839-1845
[Abstract]
[Full Text]
-
Nikiforow, S., Bottomly, K., Miller, G.
(2001). CD4+ T-Cell Effectors Inhibit Epstein-Barr Virus-Induced B-Cell Proliferation. J. Virol.
75: 3740-3752
[Abstract]
[Full Text]
-
Srivastava, G., Wong, K. Y., Chiang, A. K. S., Lam, K. Y., Tao, Q.
(2000). Coinfection of multiple strains of Epstein-Barr virus in immunocompetent normal individuals: reassessment of the viral carrier state. Blood
95: 2443-2445
[Abstract]
[Full Text]
-
Brooks, J. M., Croom-Carter, D. S. G., Leese, A. M., Tierney, R. J., Habeshaw, G., Rickinson, A. B.
(2000). Cytotoxic T-Lymphocyte Responses to a Polymorphic Epstein-Barr Virus Epitope Identify Healthy Carriers with Coresident Viral Strains. J. Virol.
74: 1801-1809
[Abstract]
[Full Text]
-
Midgley, R. S., Blake, N. W., Yao, Q. Y., Croom-Carter, D., Cheung, S. T., Leung, S. F., Chan, A. T. C., Johnson, P. J., Huang, D., Rickinson, A. B., Lee, S. P.
(2000). Novel Intertypic Recombinants of Epstein-Barr Virus in the Chinese Population. J. Virol.
74: 1544-1548
[Abstract]
[Full Text]
-
Aguirre, A. J., Robertson, E. S.
(2000). Epstein-Barr Virus Recombinants from BC-1 and BC-2 Can Immortalize Human Primary B Lymphocytes with Different Levels of Efficiency and in the Absence of Coinfection by Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
74: 735-743
[Abstract]
[Full Text]
-
van Baarle, D., Hovenkamp, E., Kersten, M. J., Klein, M. R., Miedema, F., van Oers, M. H.J.
(1999). Direct Epstein-Barr Virus (EBV) Typing on Peripheral Blood Mononuclear Cells: No Association Between EBV Type 2 Infection or Superinfection and the Development of Acquired Immunodeficiency Syndrome-Related Non-Hodgkin's Lymphoma. Blood
93: 3949-3955
[Abstract]
[Full Text]
-
Habeshaw, G., Yao, Q. Y., Bell, A. I., Morton, D., Rickinson, A. B.
(1999). Epstein-Barr Virus Nuclear Antigen 1 Sequences in Endemic and Sporadic Burkitt's Lymphoma Reflect Virus Strains Prevalent in Different Geographic Areas. J. Virol.
73: 965-975
[Abstract]
[Full Text]