Previous Article | Next Article 
J Virol, May 1998, p. 4288-4296, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Evolution of Hepatitis C Virus Quasispecies in
Hypervariable Region 1 and the Putative Interferon
Sensitivity-Determining Region during Interferon Therapy and
Natural Infection
Stephen J.
Polyak,1
Susan
McArdle,1
Shan-Lu
Liu,2
Daniel G.
Sullivan,1
Minjun
Chung,1
Wolfgang T.
Hofgärtner,1
Robert L.
Carithers Jr.,3
Brian J.
McMahon,4
James I.
Mullins,1,2,3
Lawrence
Corey,1,2,3 and
David R.
Gretch1,3,*
Departments of Laboratory
Medicine,1
Microbiology,2 and
Medicine,3 University of Washington,
Seattle, Washington, and
Alaska Native Medical Center,
Anchorage, Alaska4
Received 19 September 1997/Accepted 20 January 1998
 |
ABSTRACT |
To study hepatitis C virus (HCV) genetic mutation during interferon
(IFN) therapy, the temporal changes in HCV quasispecies heterogeneity
were compared before and after treatment for nine patients infected
with HCV genotype 1, including four nonresponders, four responders who
relapsed after therapy, and one responder who experienced a
breakthrough of viremia during therapy. Nine untreated patients with an
average time between specimens of 8.4 years served as controls.
Sequences from the second envelope glycoprotein gene
hypervariable region 1 (HVR1) and the putative IFN
sensitivity-determining region (ISDR) of the nonstructural NS5A gene
were analyzed by heteroduplex mobility assays and nucleotide
sequencing. A strong positive correlation was found
between the percent change in a heteroduplex mobility ratio (HMR) and
percent change in nucleotide sequence (r = 0.941, P < 0.001). The rate of fixation of mutations in the
HVR1 was significantly higher for IFN-treated patients than for
controls (6.97 versus 1.31% change in HMR/year; P = 0.02). Similarly, a higher rate of fixation of mutations was observed in the ISDR for IFN-treated patients than for untreated
controls, although the result was not significant (1.45 versus 0.15 amino acid changes/year; P = 0.12). On
an individual patient basis, IFN therapy was
associated with measurable HVR1 and ISDR mutation in nine of nine
(100%) and two of nine (22.2%) patients, respectively. Evolution to IFN-resistant ISDR sequences was observed in only one of
nine IFN-treated patients. These data suggest that IFN therapy
frequently exerts pressure on the HCV envelope region, while pressure
on the ISDR was evident in only a subset of patients. Thus, the
selection pressures evoked on HCV genotype 1 quasispecies during IFN therapy appear to differ among different patients.
 |
INTRODUCTION |
Hepatitis C virus (HCV), the
etiologic agent of chronic non-A, non-B hepatitis, is an
enveloped, positive-stranded RNA virus classified within the
flaviviridae (4). Acute HCV infection results in persistent
viremia in 85 to 95% of cases, and at least 60% of infected
individuals develop chronic hepatitis (1). Furthermore, approximately 20 to 30% of chronic hepatitis C
cases eventually progress to cirrhosis and/or hepatocellular
carcinoma, and chronic hepatitis C is now the leading indication
for orthotopic liver transplantation in the United States
(1).
Currently, recombinant alpha interferon (IFN), at the standard dose of
3 to 5 mU three times per week, is the most widely used treatment for
chronic hepatitis C. A 6-month course of systemic IFN therapy leads to
normalization of serum alanine aminotransferase levels in 40 to
50% of cases. However, biochemical relapse following discontinuation of therapy is common (6, 9, 28, 29). Virological factors including high pretreatment titers of HCV, and the
viral genotype have been associated with either lack of response or
relapse after therapy (6, 26, 44, 48, 53, 54).
HCV exists in infected individuals as a quasispecies which usually
consists of a predominant viral variant and a variable mixture of
highly related yet genetically distinct variants (35). The
study of the biological role of HCV quasispecies has historically focused on hypervariable region 1 (HVR1) of the second envelope (E2)
glycoprotein gene (25, 50). Numerous studies suggest that
the HVR1 is a target of neutralizing antibodies and that the selection
directed at this region of the E2 protein is responsible for the
fixation of the apparent hypervariability (13, 24, 32, 39, 49,
56). With respect to the role of HVR1 in response to IFN therapy,
previous studies have reported an association between a high level of
mutation within the HVR1 and failure to respond to IFN (16, 30,
37, 38, 40, 47). In contrast, for the nonstructural NS5A gene,
conservation of sequence was associated with lack of response to IFN
therapy: a consensus IFN sensitivity-determining region (ISDR) sequence
was associated with lack of response to IFN in Japanese patients
infected with HCV genotype 1b (HCV-1b), while mutations within the ISDR
were associated with response to IFN therapy (2, 11, 12).
Recent studies from Europe on HCV-1b-infected patients (15, 33,
43, 55) do not support such a correlation between ISDR sequences and responses to IFN therapy.
In a recent study of North American patients infected with HCV-1, no
correlation between ISDR sequences and responses to IFN therapy was
found in 15 HCV-1a-infected patients, while the ISDR consensus or
intermediate sequence was detected in four of five HCV-1b-infected
patients who either were nonresponsive to IFN therapy or responded and
then relapsed after stopping IFN therapy (27). Moreover, it
has recently been shown that the NS5A gene product interacts with the
IFN-induced cellular protein kinase, PKR, in an ISDR-dependent fashion,
inhibiting PKR activity (14). Thus, the interaction of NS5A
with PKR may represent one mechanism used by HCV to resist the
antiviral activities of IFN and may explain the clinical observations
of HCV-1b ISDR mutation and response to IFN therapy. Therefore, to
further investigate the role of HCV genetic divergence in the
development of resistance to IFN therapy, we performed a detailed
analysis of the mutational frequency of the E2 HVR1 and NS5A ISDR,
before and after standard IFN therapy, using a combination of
heteroduplex analysis (7, 8, 21, 40, 52) and nucleotide
sequencing. For comparison, we also present data on E2 HVR1 and NS5A
ISDR evolution rates in nine untreated control patients.
 |
MATERIALS AND METHODS |
Patients and virologic monitoring.
Serum samples were
obtained before, during, and after IFN therapy from nine patients with
active HCV infections who were participating under informed consent in
ongoing studies at the University of Washington Medical Center. Active
HCV infection was determined by positive serologic testing for HCV
antibodies (EIA2 [Abbott Laboratories] and RIBA II [Ortho
Diagnostics]), by positive testing for HCV RNA by reverse
transcriptase-mediated PCR (RT-PCR) using primers specific to the 5'
untranslated region, and by abnormal biochemical markers (18,
22). HCV genotype was determined by restriction fragment length
polymorphism analysis of the 5' noncoding region (5).
Changes in HCV RNA levels were monitored by quantitative competitive
PCR and bDNA version 2.0 (Chiron Corporation, Emeryville, Calif.)
(17, 19). Nonresponse was defined as continuous detection of
HCV RNA in patient serum during therapy; four patients (patients 1 to
4) were designated nonresponders. Response to IFN therapy was defined
virologically as the sustained conversion of a patient to HCV
RNA-negative status by RT-PCR during therapy. Patients who relapsed
following discontinuation of therapy (patients 6 to 9) were
designated responder-relapse, while the patient who initially responded
to IFN therapy but experienced breakthrough of HCV viremia while still
on IFN therapy (patient 5) was designated a responder-breakthrough. In
addition, sequential samples taken on average 8.4 years apart were
obtained for nine control patients who did not receive IFN therapy. Of
the nine patients, five were infected with HCV-1a and four were
infected with HCV-1b. Heteroduplex analysis and nucleotide sequencing
results from three control patients (patients 10 to 12) are presented
in detail in this report.
RNA extraction, PCR, cloning, and sequencing.
Total RNA was
extracted from patient sera by the single-step guanidinium method
(3, 52). The HVR1 was amplified by reverse transcriptase-nested PCR and cloned as described previously
(52). Nested PCR was also used to amplify the ISDR. For
genotype 1a, outer primer set 5A-1a-2 (5'TGACGTCCATGCTCACTGAT
and 5'GAGACTTCCGCAGGATTTCT) and inner primer set
5A-1a-1 (5' CCTCCCATATAACAGCAGAG and
5'CGAAGGAGTCCAGAATCACC) were used. For genotype 1b, outer
primer set 5A-1b-2 (5'CAGAGACGGCTAAGCGTAGG and
5'CTGGATTTCCGCAGGATCTC) and inner primer set 5A-1b-1
(5'TCCTTGGCCAGCTCTTCAGC and 5'TCCCTCTCATCCTCCTCGC)
were used. ISDR sequences were amplified by hot-start nested PCR
with the following cycling parameters: 30 s at 94°C, 25 s
at 65°C, and 30 s at 72°C for 30 cycles with 50 pmol of each
primer. PCR products were then cloned in the TA cloning vector
(Invitrogen), and plasmid DNA containing HVR1 or ISDR inserts was
prepared for sequencing using the QIAwell plasmid prep system (Qiagen)
and sequenced by the fluorescence-based Taq dye deoxy
terminator cycle sequencing system (ABI), using M13 universal primers
as described previously (52). For direct sequencing of PCR
products, a third primer set, 5A-1a-3 (5'TAGTCGGGCTTTTTCCACG and 5' TAGGGTCGCAATTACCTTG) or 5A-1b-3
(5'CAGAGACGGCTAAGCGTAGG and 5'CTGGATTTCCGCAGGATCTC),
was used in first-round PCR amplification, followed by either the
5A-1a-2 or 5A-1b-2 primer set in second-round PCR amplification. PCR
products were gel purified and directly sequenced in both directions,
using primer sets 5A-1a-1 and 5A-1b-1 for genotype 1a and 1b ISDR
sequences, respectively. Sequences were analyzed with the Genetics
Computer Group software. For calculation of the rate of fixation of
mutation of the HVR1 and ISDR, the percent change in heteroduplex
mobility ratio (HMR) (see below) per year was calculated.
Heteroduplex analysis.
The heteroduplex mobility assay is a
new technique (7, 8) that we have applied for the
assessment of genetic heterogeneity of HCV quasispecies (21, 40,
52). In a related technique, termed the heteroduplex tracking
assay (HTA), a radiolabeled probe is hybridized to unlabeled target DNA
and analyzed by nondenaturing polyacrylamide gel electrophoresis plus
autoradiography (7, 8). Probe hybridized to itself
(unlabeled) served as a marker for identification of homoduplexes.
Hybrids with nucleotide changes relative to the probe displayed
retarded mobility and were identified as heteroduplexes. To determine
the total number of variants in a quasispecies population (complexity),
the genetic diversity of the individual variants, and their relative
abundance, clonal frequency analysis was performed as described
previously (21, 40, 52). The clonal frequency analysis
technique provides a detailed assessment of the level of quasispecies
complexity and genetic diversity, because a large number of individual
clones are simultaneously analyzed by hybridization with a
patient-specific probe (21, 40, 52). In brief, PCR products
from selected time points were ligated into the TA cloning vector, and
individual clones were reamplified to generate clonal PCR products for
heteroduplex analysis. At least 20 recombinant HVR1 or ISDR clones were
subjected to clonal frequency analysis.
Quasispecies complexity was determined by counting the total number of
unique gel shift patterns. Quasispecies genetic diversity was
determined by deriving the average heteroduplex mobility of all clones
relative to the homoduplex probe control. An HMR was calculated by
dividing the distance in millimeters from the origin of the gel to the
heteroduplex by the distance in millimeters from the origin to the
homoduplex control. In cases where both strands of the heteroduplex
were clearly distinguishable, the average of the distance of each
strand of the heteroduplex was used to calculate heteroduplex mobility
(40). The HMRs for all variants in the population were
averaged to provide the final HMR value. To estimate the percent
genetic change within the HVR1 and ISDR between two time points the
percent change in HMR was calculated as (HMRtime 2
HMRtime 1/HMRtime 1) × 100, where
HMRtime 1 and HMRtime 2 represent the HMRs from
pre-IFN and post-IFN therapy time points, respectively. For the
untreated control patients, HMRtime 1 and HMRtime
2 represent the two time points at which serum was collected. To
follow the temporal changes in the total quasispecies population during
IFN therapy, HTA (7, 8) was performed with a radiolabeled
probe hybridized separately to heterogeneous PCR products amplified
from patient serum before, during, and after IFN therapy as described
previously (21, 40, 52). For some patients, the entire
heterogeneous PCR product was labeled by subjecting the second-round
PCR products to an additional three cycles of PCR in the presence of
[
-33P]dATP and 33 µmol of each deoxynucleoside
triphosphate. Probes were then mixed with target at the ratio of 1:100
in annealing buffer (100 mM NaCl, 10 mM Tris-HCl [pH 7.8], 2 mM
EDTA), denatured in boiling water for 2 min, placed immediately on ice
for 10 min, and then incubated at 55°C for 10 min to form
heteroduplexes (34). The resulting reaction products
were electrophoresed in 5% neutral polyacrylamide gels, dried,
and scanned with a Molecular Dynamics (Sunnyvale, Calif.)
PhosphorImager.
Statistical analyses.
Student's t tests were
used to compare the differences between HMRs at different time points
and between HVR1 and ISDR rates of fixation of mutations, while linear
regression was used to determine the correlation between percent change
in HMR and percent change in nucleotides.
 |
RESULTS |
Assessment of HCV infection during IFN therapy.
The
virological and clinical features of the nine patients who were
treated with IFN and three of the nine untreated control patients are shown in Table 1.
There was no significant difference in pretreatment HCV titers between
any of the response groups.
Utility of heteroduplex analysis to quantitate changes in
quasispecies genetic diversity over time.
We have previously
demonstrated that the extent of HCV quasispecies genetic
diversity, expressed as an HMR (see Materials and Methods), is
proportional to the nucleotide sequence differences between any probe
and target molecule (40). Figure
1 depicts a strong correlation
(r = 0.941, P < 0.01) between the
percent change in nucleotide sequence between two quasispecies variants from two different time points and the percent change in HMR for the two variants, defined as (HMRtime 2
HMRtime
1/ HMRtime 1) × 100. The data were
derived by analysis of HCV heteroduplex mobilities for 60 DNA specimens
amplified from the HVR1 (n = 48) and the ISDR
(n = 12). These data indicate that it is possible
to estimate the extent of change or evolution within the HVR1 and ISDR
between any two time points in a given patient by measuring the percent change in HMR.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 1.
Estimation of percent change in genetic diversity
between two time points, using heteroduplex analysis. The correlation
between percent change in HMR and percent change in nucleotide sequence
of quasispecies major variants between two time points is depicted. The
r value for the correlation was 0.941 (P < 0.01). The data were derived from 60 paired specimens for which both
HMR and nucleotide sequence data were available. Of the 60 measurements, 12 were derived from pairs of ISDR clones and 48 were
derived from pairs of HVR1 clones.
|
|
Figure 2 illustrates the changes in the
clonal frequency of HCV quasispecies among three selected patients,
determined by the clonal frequency analysis technique. In each case,
mutation patterns in the HVR1 and ISDR were compared between two time
points. Figure 2A depicts the changes in the HVR1 and ISDR for control patient 10 over a time interval of 12 years. For this patient, the HVR1
evolved extensively over 12 years, with the HMR decreasing from 0.881 to 0.779 (P < 0.01) between the two time points,
indicating an increase in overall genetic diversity (Fig. 2A, top). The
ISDR, however, remained genetically stable during this interval, as evidenced by similar clonal frequency analysis patterns and similar HMRs (0.992 versus 0.990, P = 0.08) at the two time
points (Fig. 2A, bottom).

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 2.
Clonal frequency analysis of the temporal changes in HCV
quasispecies in the HVR1 and ISDR. The autoradiograms on the left
represent clonal frequency analysis of the HVR1 or the ISDR derived
from time zero (for patient 10) or pretreatment (patients 1 and 2) time
point, while the autoradiograms on the right represent clonal frequency
analysis of the HVR1 or ISDR derived from the year 12 (patient 10) or
posttreatment (patients 1 and 2) time point. Radiolabeled HVR1 or ISDR
probes corresponding to pretreatment quasispecies major variants were
hybridized to HVR1 or ISDR PCR products derived from individual
recombinant HVR1 or ISDR molecules, and heteroduplex analysis was
performed as described in Materials and Methods. The position of the
homoduplex is indicated with a line, while the reference homoduplex
probe is labeled P. (A) Changes in the HVR1 and ISDR for control
patient 10 with a time interval of 12 years between specimens; (B)
profile of changes in the HVR1 and ISDR before and after IFN therapy
(50 weeks) for nonresponsive patient 1; (C) profile of changes in the
HVR1 and ISDR before and after IFN therapy (49 weeks) for nonresponsive
patient 2.
|
|
Figure 2B illustrates the changes in the HVR1 and ISDR before and after
IFN therapy for an IFN nonresponder (patient 1). In the HVR1, two
predominant variant populations were detected at both time points for
patient 1 (Fig. 2B, top). One variant formed slowly migrating
heteroduplexes, indicating substantial divergence from the other
variant. Upon sequencing, we found that variants 1 and 2 differed by 31 nucleotides and 16 amino acids (data not shown). In direct contrast to
the HVR1, patient 1 displayed genetic heterogeneity within the ISDR in
pretreatment serum, with a complexity of eight unique gel shifts
variants (Fig. 2B, bottom). During IFN therapy, the heterogeneity of
the ISDR quasispecies population lessened, so that at 32 weeks only
three unique ISDR variants were detected. The HMR increased from
pretreatment to the posttreatment time point (0.954 versus 0.988, P < 0.01), indicating a reduction in overall ISDR
genetic diversity during therapy. These experiments indicated that for
patient 1, the HCV quasispecies changed less extensively in the HVR1
than the ISDR during IFN. Furthermore, nonresponse to IFN therapy was
associated with homogenization of the ISDR quasispecies population
toward the intermediate type ISDR sequence associated with IFN
resistance (12) (see Fig. 5).
Figure 2C (top) indicates that for nonresponsive patient 2, HVR1
quasispecies heterogeneity increased following IFN therapy relative to the pretreatment time point, as evidenced by slowly migrating heteroduplexes in the posttherapy autoradiogram. The HMR
decreased from 0.9303 to 0.725 (P < 0.01), indicating
an overall increase in quasispecies genetic diversity. For this
patient, one of the major HVR1 variants present at 49 weeks was derived from a minor HVR1 variant present in pretreatment serum, which suggested that selective expansion of a minor variant occurred during
IFN therapy (data not shown). The ISDR quasispecies population in
nonresponsive patient 2 appeared relatively unchanged by IFN therapy,
as shown by similar clonal frequency patterns before and after therapy
(Fig. 2C, bottom). The HMR of the ISDR remained unchanged
between pretreatment and posttreatment time points (0.995 versus 0.995, P = 0.964). Therefore, these results indicate that for
patient 2, evolution of the HVR1 occurred during IFN therapy, while the
ISDR remained relatively unchanged.
Changes in the HVR1 in responder-relapse patients.
Figure
3 depicts the changes in the HVR1
observed during IFN therapy for responder-relapse patients 6 and 8, using a combination of the HTA and clonal frequency analysis. The right
side of Fig. 3A illustrates the HVR1 quasispecies profile detected by
HTA for patient 6; the clonal frequency analysis from the pretreatment time point is shown the left. HTA clearly demonstrates a major change in the HVR1 quasispecies profile of this patient which was
associated with virologic relapse, while the clonal frequency analysis
indicates considerable genetic heterogeneity within this region at the
onset of therapy (HMR = 0.968, complexity = 5 unique variants). Similarly for patient 8, virologic relapse was associated with a clear change in the HVR1 quasispecies distribution. Furthermore, there was extensive pretreatment HVR1 quasispecies genetic
heterogeneity (Fig. 3B), as determined by the extent (HMR = 0.972) and number of unique gel shifts (complexity = 11 unique variants). Responder-relapse patient 7 also displayed
major changes in the HVR1 coincident with virologic relapse, while
patient 9 displayed changes in the proportion of minor HVR1
quasispecies variants (Fig. 4 and data not shown).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 3.
Assessment of pretreatment HVR1 quasispecies
heterogeneity by clonal frequency analysis (left) and analysis of the
temporal changes in HVR1 quasispecies by HTA (right) in
responder-relapse patients 6 (A) and 8 (B). For clonal frequency
analysis, representative pretreatment HVR1 clones were hybridized to a
patient-specific, radiolabeled HVR1 probe and subjected to heteroduplex
analysis. For HTA, heterogeneous HVR1 PCR products from the indicated
time points were subjected to heteroduplex analysis.
|
|

View larger version (51K):
[in this window]
[in a new window]
|
FIG. 4.
HTA for patients 4, 5, 7, and 9 for the HVR1 and ISDR.
Pretreatment and posttreatment HVR1 and ISDR sequences were analyzed by
HTA using the corresponding patient's heterogeneous pretreatment
PCR product as a radiolabeled probe. Lanes: P,
33P-radiolabeled probe; Pr, Po, and BT, pretreatment,
posttreatment, and breakthrough time points, respectively. Note that
for the ISDR, two different-size PCR products were analyzed, one
corresponding to the ISDR from genotype 1a-infected patients and the
other corresponding to the ISDR from genotype 1b-infected patients.
|
|
Changes in the HVR1 and ISDR in patients 4, 5, 7, and 9.
Figure 4 illustrates HTA of the HVR1 and ISDR derived from the
pretreatment and posttreatment time points for patients 4, 5, 7, and 9. As shown in Fig. 4A, HVR1 sequences did not change significantly for
nonresponder patient 4 or for responder-breakthrough patient 5. However, responder-relapse patient 7 displayed a gel shift pattern that
was consistent with a change in the predominant HVR1 quasispecies
variant during virologic relapse. Responder-relapse patient 9 also
displayed changes in the proportions of minor HVR1 quasispecies
variants during virologic relapse, but the predominant HVR1
quasispecies variant remained stable. In contrast to the mutations
observed in the HVR1, no significant changes could be seen in the ISDR
for patients 4, 7, and 9 following IFN therapy compared to the
pretreatment quasispecies (Fig. 4B).
Direct sequencing analysis of the ISDR.
Direct sequencing of
the PCR products from pretreatment and posttreatment time points
confirmed the relative stasis of the ISDR during IFN therapy in most
patients (Fig. 5). As described by
Enomoto and colleagues (11), patients with ISDR sequences identical to the consensus HCV-1b sequence, HCV-J, were generally nonresponsive to IFN therapy. Eighty-seven percent of patients with one
to three mutations in the ISDR (classified as intermediate-type sequences) were nonresponsive to IFN therapy, while most patients with
four or more mutations in the ISDR relative to the consensus sequence
were responsive to therapy. As shown in Fig. 5, nonresponsive patient 1 had two major ISDR variants in pretreatment serum; one (preMV2) had
amino acid mutations consistent with it being classified as IFN
sensitive, while the other major variant (preMV1) would be classified
as intermediate type in the Enomoto classification scheme
(12). Following IFN therapy, only intermediate-type ISDR sequences (preMV1) remained. Nonresponsive patients 2 to 4 all had ISDR
sequences which did not change following IFN therapy. Three amino acid
changes in the ISDR were detected at virologic relapse in
responder-breakthrough patient 5. These changes were maintained until
the end of therapy. Responder-relapse patients 6 to 9 all had ISDR
sequences which did not change during IFN therapy. Control patients 10 and 11 each had ISDR sequences that differed by one amino acid between
the 12- and 9-year follow-up specimens, respectively. Remarkably, the
sequence of the ISDR in patient 12 changed significantly during the
13-year time period, accumulating nine amino acid changes and one
deletion at codon 2218.

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 5.
Direct sequencing of the ISDR before and after IFN
therapy. ISDR sequences are shown for IFN-treated patients 1 to 9 and
untreated control patients 10 to 12. (A) Alignment of the ISDR from
genotype 1a-infected patients relative to the ISDR of the prototype
genotype 1a strain of HCV, HCV-1 (accession no. M62321). The underlines
represent the three amino acid changes in the putative ISDR of genotype
1a that differ from the prototype genotype 1b ISDR. (B) Alignment of
the ISDR from genotype 1b-infected patients relative to the consensus
ISDR associated with IFN resistance from the prototype genotype 1b
strain of HCV, HCV-J (accession no. D90208). For patient 5, BT
represents the breakthrough time point. preMV1 and preMV2 represent the
two ISDR variants detected in pretreatment (pre) serum of patient 1. post, posttreatment.
|
|
Rate of fixation of mutations in the HVR1 and ISDR.
Due to the
strong correlation between the percent change in HMR and percent
nucleotide change between two time points, we were able to calculate
the rate of fixation of mutations for the HVR1 and ISDR for our patient
population. For the IFN-treated patients, the rate of fixation of
mutation of the HVR1 was higher than that of the ISDR (6.97% versus
1.09% change in HMR/year, P = 0.019). The rate of
fixation of mutation of the HVR1 was higher for IFN-treated patients
than for all nine untreated control patients (6.97% versus 1.31%
change in HMR/year, P = 0.02). Similarly, the rate of
fixation of mutations in the ISDR was approximately 10-fold higher for
IFN-treated patients than for untreated control patients (1.45% versus
0.15% percent amino acid changes/year), although the results for ISDR
did not reach statistical significance (P = 0.12). IFN therapy was associated with detectable HVR1 and ISDR
mutation in nine of nine (100%) and two of nine (22.2%)
patients, respectively. These data are depicted graphically for
individual IFN-treated and control patients in Fig.
6A and B and for both patient populations
in Fig. 6C.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 6.
Summary of the changes in rate of fixation of mutations
in the HVR1 and ISDR for IFN-treated patients 1 to 9 and untreated
control patients 10 to 18. (A) Changes in the HVR1, expressed as the
percent change in HMR per year; (B) changes in the ISDR, expressed as
the percent change in amino acids per year; (C) summary graph comparing
changes in both the HVR1 and ISDR for the IFN-treated and control
patient populations. For the HVR1, the average values for IFN-treated
and control patients were 6.97 and 1.31% percent change in HMR per
year, respectively (P = 0.019); for the ISDR, the
average values for IFN-treated and control patients were 1.45 and
0.15% change in amino acids per year, respectively (P = 0.12).
|
|
 |
DISCUSSION |
The effect of IFN therapy on HCV quasispecies is currently an
important and controversial topic. This study presents detailed analysis of two regions of HCV-1 (HVR1 and ISDR) in nine patients before and after IFN therapy and in nine untreated control patients. The most controversial issue related to HCV quasispecies and IFN therapy pertains to the putative ISDR first described for genotype 1b
isolates from Japan by Enomoto and colleagues (11). Although several studies have confirmed this report (2, 12), others do not support such an association (15, 33, 43, 55).
Mutation of the HVR1 during natural HCV infection is well documented
(13, 24, 25, 32, 39, 49, 50, 56), and several groups including our own have reported a significant inverse correlation between the extent of HVR1 divergence in pretreatment sera and subsequent response to IFN therapy (16, 30, 37, 38, 40, 47).
Previous reports have demonstrated changes in HVR1 coincident with
biochemical (10, 36) and virologic (38) relapse
following cessation of IFN therapy. However, the present study is the
first to quantify the rate of HVR1 divergence during therapy in direct comparison with a genotype-matched control population.
The present results can be summarized as follows. IFN therapy was
associated with an increased rate of fixation of mutations in both the
HVR1 and the ISDR of HCV-1 compared to the same regions analyzed in
genotype-matched untreated control patients. The results were
statistically significant for the HVR1 but not for the ISDR, even
though the mean rate of ISDR divergence was 10-fold greater in treated
patients than in controls. Similar to previous studies, we observed
significant HVR1 divergence in two of four IFN nonresponders, the one
responder breakthrough patient, and all four responder-relapse patients, further supporting the hypothesis that IFN partially acts
through immunomodulatory mechanisms in chronic hepatitis C. The lack of
statistical significance related to ISDR divergence may be a
consequence of the small sample size (nine patients). However,
accelerated genetic divergence of the ISDR was observed in only two of
nine treated patients; in the remaining seven patients, the ISDR
quasispecies master sequence remained stable during the 6-month course
of IFN therapy (Fig. 5 and 6B). The most likely explanation for these
results is that IFN exerts selective pressure on the ISDR of only a
subset of patients with HCV-1 infection, which would be consistent with
the controversial findings in clinical studies from Japan and Europe.
It has been postulated that the differences in study outcome possibly
reflects geographic differences in viral or host factors
(23). It is noteworthy that one of the two patients with
divergent ISDR sequences during therapy was infected with genotype 1a
and the other was infected with genotype 1b; thus, our findings may not
be related to HCV subtype. Although mutation in the HVR1 has been
clearly linked to viral persistence in humans via antibody escape
mechanisms (13, 32, 51), the selective forces acting on the
ISDR could be immunological, as is postulated for HVR1, or could
reflect molecular interactions with host cell proteins, as suggested by
studies which demonstrate interaction of NS5A with the cellular protein
kinases, PKR (14), and a member of the CMGC kinase family
(41) (required for phosphorylation of NS5A
[46]). Further studies will help better define the
selective forces acting on the ISDR.
This study demonstrates that HVR1 and ISDR show different patterns of
evolution under IFN pressure. In one subject (patient 1) who was
infected with HCV-1b, we saw no significant effect of IFN on HVR1
sequences, as two major variants were consistently observed in roughly
equal proportions in the patient's serum before, during, and after
therapy. Surprisingly, however, we observed striking alterations in the
ISDR during therapy. Before treatment, many genetic variants existed in
the ISDR, and the work of Enomoto et al. (11, 12) indicated
that a majority had sequences associated with IFN sensitivity. During
IFN therapy, this region became genetically more homogeneous, with a
reduction in genetic complexity and diversity. The genetic variants
which emerged during IFN therapy had the intermediate-type ISDR
sequences associated with IFN resistance. This finding suggests that
IFN induced a selective pressure on the ISDR toward the IFN-resistant
phenotype and that IFN was not exerting selective pressure on the HVR1
in this case. However, it must be stressed that patient 1 was the only
patient who displayed changes in the quasispecies distribution of the
ISDR toward the IFN-resistant motif. The finding of nine amino acid
changes and a single amino acid deletion at codon 2218 in the ISDR of
untreated control patient 12 (Fig. 5) suggests that the ISDR
diversification may occur as a result of other unidentified selective
pressures. In this control patient, genetic change in the ISDR were
associated with a 10-fold decrease in HCV RNA titers, suggesting the
mutation may have reduced the replicative capacity of the virus.
The findings reported herein suggest that the ISDR locus per se does
not function in a manner consistent with a major role in mediating IFN
resistance in the majority of patients from our geographic area. This
is in accord with recent studies from Europe (15, 33, 42,
55) and Japan, which described patients who had consensus
IFN-resistant ISDR sequences yet still responded to IFN therapy
(2). Furthermore, we have recently demonstrated that there
is no particular ISDR sequence associated with response or nonresponse
in HCV-1a-infected patients receiving IFN therapy, while there may be
such an association for HCV-1b infections in patients from our
geographic area (27). Thus, although the ISDR may modulate
in part the response to IFN, as suggested by the inhibition of the
IFN-induced protein kinase, PKR, by NS5A (14), it is
possible that other domains of the NS5A protein possess functions which
directly or indirectly influence response to IFN therapy. In this
regard, recent studies indicate that the amino-terminal region of NS5A
has a transcriptional activation function in yeast (31, 45).
Thus, future clinical and molecular studies should be aimed at the
entire coding region of NS5A in addition to other HCV genes.
The use of clonal frequency analysis in this study allowed multiple
quasispecies clonal variants to be assayed simultaneously, which
provided an accurate assessment of the overall level of quasispecies
heterogeneity (reviewed in reference 20). This technique also identified certain HVR1 minor quasispecies variants which persisted during IFN therapy and reappeared as major quasispecies variants at the end of therapy (e.g., patient 2). This observation attests to the sensitivity of heteroduplex analysis in the detection of
minor quasispecies variants and suggests that IFN therapy induced selective expansion of a minor quasispecies population. Using heteroduplex analysis, Gretch et al. also found emergence of minor quasispecies variants in liver transplant recipients with asymptomatic HCV infections (21).
The clinical importance of the current study is the demonstration of
significant alterations in the HCV genome in nonresponsive or relapse
patients infected with HCV-1 who were treated with IFN via the standard
thrice-weekly regimen. Our results suggest a comparison of the
antiviral efficacy of IFN when given via daily versus intermittent
dosing regimens, or when given as monotherapy compared to combination
therapy, to a cohort of matched subjects, i.e., those with similar HCV
RNA levels and HCV genotypes at study initiation. Such combined
clinical-molecular studies should prove useful for determining the
mechanisms of action of therapeutic agents like IFN and for further
optimizing antiviral therapy for chronic hepatitis C.
 |
ACKNOWLEDGMENTS |
We thank Jeff Wilson, Anthony Marquardt, Corazon dela Rosa, and
Maureen Guajardo for technical assistance, Colleen Lasley and Jean
Moore for assistance with preparation of the manuscript, and
Jean-Michel Pawlotsky and Michael Katze for helpful discussions.
D.R.G. was partially supported by NIH grants AI41320-02 and
AI39049-02; J.I.M. was supported by NIH grants AI27757 and AI32885. This research was partially funded by grants to D.R.G. from the University of Washington Royalty Research Fund and by a nonrestricted educational grant from Schering Plough.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Pacific Medical
Center, 11th Floor, 1200 12th Ave. S., Seattle, WA 98144. Phone: (206) 621-4169. Fax: (206) 323-3084. E-mail:
gretch{at}mail.labmed.washington.edu.
 |
REFERENCES |
| 1.
|
Anonymous.
1997.
National Institutes of Health Consensus Development Conference Panel statement: management of hepatitis C.
Hepatology
26:2S-10S[Medline].
|
| 2.
|
Chayama, K.,
A. Tsubota,
M. Kobayashi,
K. Okamoto,
M. Hashimoto,
Y. Miyano,
H. Koike,
M. Kobayashi,
I. Koida,
H. Arase,
S. Saitoh,
Y. Suzuki,
N. Murashima,
K. Ikeda, and H. Kumada.
1997.
Pretreatment virus load and multiple amino acid substitutions in the interferon sensitivity-determining region predict the outcome of interferon treatment in patients with chronic genotype 1b hepatitis C virus infection.
Hepatology
25:745-749[Medline].
|
| 3.
|
Chomczynski, P., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 4.
|
Choo, Q. L.,
G. Kuo,
A. J. Weiner,
L. R. Overby,
D. W. Bradley, and M. Houghton.
1989.
Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome.
Science
244:359-362[Abstract/Free Full Text].
|
| 5.
|
Davidson, F.,
P. Simmonds,
J. C. Ferguson,
L. M. Jarvis,
B. C. Dow,
E. A. Follett,
C. R. Seed,
T. Krusius,
C. Lin,
G. A. Medgyesi, et al.
1995.
Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5' non-coding region.
J. Gen. Virol.
76:1197-1204[Abstract/Free Full Text].
|
| 6.
|
Davis, G. L.,
L. A. Balart,
E. R. Schiff,
K. Lindsay,
H. C. Bodenheimer, Jr.,
R. P. Perrillo,
W. Carey,
I. M. Jacobson,
J. Payne,
J. L. Dienstag, et al.
1989.
Treatment of chronic hepatitis C with recombinant interferon alfa. A multicenter randomized, controlled trial. Hepatitis Interventional Therapy Group.
N. Engl. J. Med.
321:1501-1506[Abstract].
|
| 7.
|
Delwart, E. L.,
H. W. Sheppard,
B. D. Walker,
J. Goudsmit, and J. I. Mullins.
1994.
Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays.
J. Virol.
68:6672-6683[Abstract/Free Full Text].
|
| 8.
|
Delwart, E. L.,
E. G. Shpaer,
J. Louwagie,
F. E. McCutchan,
M. Grez,
W. H. Rubsamen, and J. I. Mullins.
1993.
Genetic relationships determined by a DNA heteroduplex mobility assay: analysis of HIV-1 env genes.
Science
262:1257-1261[Abstract/Free Full Text].
|
| 9.
|
Di Bisceglie, A. M.,
P. Martin,
C. Kassianides,
M. Lisker Melman,
L. Murray,
J. Waggoner,
Z. Goodman,
S. M. Banks, and J. H. Hoofnagle.
1989.
Recombinant interferon alfa therapy for chronic hepatitis C. A randomized, double-blind, placebo-controlled trial.
N. Engl. J. Med.
321:1506-1510[Abstract].
|
| 10.
|
Enomoto, N.,
M. Kurosaki,
Y. Tanaka,
F. Marumo, and C. Sato.
1994.
Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis.
J. Gen. Virol.
75:1361-1369[Abstract/Free Full Text].
|
| 11.
|
Enomoto, N.,
I. Sakuma,
Y. Asahina,
M. Kurosaki,
T. Murakami,
C. Yamamoto,
N. Izumi,
F. Marumo, and C. Sato.
1995.
Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A gene.
J. Clin. Invest.
96:224-230.
|
| 12.
|
Enomoto, N.,
I. Sakuma,
Y. Asahina,
M. Kurosaki,
T. Murakami,
C. Yamamoto,
Y. Ogura,
N. Izumi,
F. Marumo, and C. Sato.
1996.
Mutations in the nonstructural protein 5A and response to interferon in patients with chronic hepatitis C virus 1b infection.
N. Engl. J. Med.
334:77-81[Abstract/Free Full Text].
|
| 13.
|
Farci, P.,
H. J. Alter,
D. C. Wong,
R. H. Miller,
S. Govindarajan,
R. Engle,
M. Shapiro, and R. H. Purcell.
1994.
Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization.
Proc. Natl. Acad. Sci. USA
91:7792-7796[Abstract/Free Full Text].
|
| 14.
|
Gale, M. J.,
M. J. Korth,
N. M. Tang,
S. L. Tan,
D. A. Hopkins,
T. E. Dever,
S. J. Polyak,
D. R. Gretch, and M. G. Katze.
1997.
Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein.
Virology
230:217-227[Medline].
|
| 15.
|
Germanidis, G.,
M. Pellerin,
A. Bastie,
L. Stuyver,
G. Duverlie,
F. Darthuy,
J. Remire,
J. Duval,
D. Dhumeaux, and J. M. Pawlotsky.
1996.
Study of the genetic heterogeneity of the NS5A region of the HCV-1b genome and evolution under interferon alfa therapy.
Hepatology
24:264A.
|
| 16.
|
Gonzalez-Peralta, R. P.,
K. Qian,
J. Y. She,
G. L. Davis,
T. Ohno,
M. Mizokami, and J. Y. N. Lau.
1996.
Clinical implications of viral quasispecies heterogeneity in chronic hepatitis C.
J. Med. Virol.
49:242-247[Medline].
|
| 17.
|
Gretch, D.,
L. Corey,
J. Wilson,
C. dela Rosa,
R. Willson,
R. Carithers, Jr.,
M. Busch,
J. Hart,
M. Sayers, and J. Han.
1994.
Assessment of hepatitis C virus RNA levels by quantitative competitive RNA polymerase chain reaction: high-titer viremia correlates with advanced stage of disease.
J. Infect. Dis.
169:1219-1225[Medline].
|
| 18.
|
Gretch, D.,
W. Lee, and L. Corey.
1992.
Use of aminotransferase, hepatitis C antibody, and hepatitis C polymerase chain reaction RNA assays to establish the diagnosis of hepatitis C virus infection in a diagnostic virology laboratory.
J. Clin. Microbiol.
30:2145-2149[Abstract/Free Full Text].
|
| 19.
|
Gretch, D. R.,
C. dela Rosa,
R. L. Carithers,
R. A. Willson,
B. Williams, and L. Corey.
1995.
Assessment of hepatitis C viremia using molecular amplification technologies: correlations and clinical implications.
Ann. Intern. Med.
123:321-329[Abstract/Free Full Text].
|
| 20.
|
Gretch, D. R., and S. J. Polyak.
1997.
The quasispecies nature of hepatitis C virus: research methods and biological implications, p. 57-69.
In
Groupe Français d-Etudes Moleculaires des Hépatites (GEMHEP) (ed.), Proceedings of the Hepatitis C virus GEMHEP Conference. John Libbey Eurotext, Paris, France.
|
| 21.
|
Gretch, D. R.,
S. J. Polyak,
J. J. Wilson,
R. L. Carithers,
J. D. Perkins, and L. Corey.
1996.
Tracking hepatitis C virus quasispecies major and minor variants in symptomatic and asymptomatic liver transplant recipients.
J. Virol.
70:7622-7631[Abstract].
|
| 22.
|
Gretch, D. R.,
J. J. Wilson,
R. L. Carithers,
C. dela Rosa,
J. H. Han, and L. Corey.
1993.
Detection of hepatitis C virus RNA: comparison of one-stage polymerase chain reaction (PCR) with nested-set PCR.
J. Clin. Microbiol.
31:289-291[Abstract/Free Full Text].
|
| 23.
|
Herion, D., and J. H. Hoofnagle.
1997.
The interferon sensitivity determining region: all hepatitis C virus isolates are not the same.
Hepatology
25:769-771[Medline].
|
| 24.
|
Higashi, Y.,
S. Kakumu,
K. Yoshioka,
T. Wakita,
M. Mizokami,
K. Ohba,
Y. Ito,
T. Ishikawa,
M. Takayanagi, and Y. Nagai.
1993.
Dynamics of genome change in the E2/NS1 region of hepatitis C virus in vivo.
Virology
197:659-668[Medline].
|
| 25.
|
Hijikata, M.,
N. Kato,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi, and K. Shimotohno.
1991.
Hypervariable regions in the putative glycoprotein of hepatitis C virus.
Biochem. Biophys. Res. Commun.
175:220-228[Medline].
|
| 26.
|
Hino, K.,
S. Sainokami,
K. Shimoda,
S. Iino,
Y. Wang,
H. Okamoto,
Y. Miyakawa, and M. Mayumi.
1994.
Genotypes and titers of hepatitis C virus for predicting response to interferon in patients with chronic hepatitis C.
J. Med. Virol.
42:299-305[Medline].
|
| 27.
|
Hofgärtner, W. T.,
S. J. Polyak,
D. G. Sullivan,
R. L. Carithers, and D. R. Gretch.
1997.
Mutations in the NS5A gene of hepatitis C virus in North American patients infected with HCV genotype 1a or 1b.
J. Med. Virol.
53:118-126[Medline].
|
| 28.
|
Hoofnagle, J. H.,
K. D. Mullen,
D. B. Jones,
V. Rustgi,
A. Di Bisceglie,
M. Peters,
J. G. Waggoner,
Y. Park, and E. A. Jones.
1986.
Treatment of chronic non-A,non-B hepatitis with recombinant human alpha interferon. A preliminary report.
N. Engl. J. Med.
315:1575-1578[Abstract].
|
| 29.
|
Iino, S.,
K. Hino, and K. Yasuda.
1994.
Current state of interferon therapy for chronic hepatitis C.
Intervirology
37:87-100[Medline].
|
| 30.
|
Kanazawa, Y.,
N. Hayashi,
E. Mita,
T. Li,
H. Hagiwara,
A. Kasahara,
H. Fusamoto, and T. Kamada.
1994.
Influence of viral quasispecies on effectiveness of interferon therapy in chronic hepatitis C patients.
Hepatology
20:1121-1130[Medline].
|
| 31.
|
Kato, N.,
K. H. Lan,
S. K. Ono-Nita,
Y. Shiratori, and M. Omata.
1997.
Hepatitis C virus nonstructural region 5A protein is a potent transcriptional activator.
J. Virol.
71:8856-8859[Abstract].
|
| 32.
|
Kato, N.,
H. Sekiya,
Y. Ootsuyama,
T. Nakazawa,
M. Hijikata,
S. Ohkoshi, and K. Shimotohno.
1993.
Humoral immune response to hypervariable region 1 of the putative envelope glycoprotein (gp70) of hepatitis C virus.
J. Virol.
67:3923-3930[Abstract/Free Full Text].
|
| 33.
|
Khorsi, H.,
S. Castelain,
A. Wyseur,
J. Izopet,
V. Canva,
A. Rombout,
D. Capron,
J. P. Capron,
F. Lunel,
L. Stuyver, and G. Duverlie.
1997.
Mutations of hepatitis C virus 1b NS5A 2209-2248 amino acid sequence do not predict the response to recombinant interferon-alfa therapy in French patients.
J. Hepatol.
27:72-77[Medline].
|
| 34.
|
Liu, S.-L.,
T. Schacker,
L. Musey,
D. Shriner,
M. J. McElrath,
L. Corey, and J. I. Mullins.
1997.
Divergent patterns of progression to AIDS after infection from the same source: human immunodeficiency virus type 1 evolution and antiviral responses.
J. Virol.
71:4284-4295[Abstract].
|
| 35.
|
Martell, M.,
J. I. Esteban,
J. Quer,
J. Genesca,
A. Weiner,
R. Esteban,
J. Guardia, and J. Gómez.
1992.
Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution.
J. Virol.
66:3225-3229[Abstract/Free Full Text].
|
| 36.
|
Mizokami, M.,
J. Y. Lau,
K. Suzuki,
T. Nakano, and T. Gojobori.
1994.
Differential sensitivity of hepatitis C virus quasispecies to interferon-alpha therapy.
J. Hepatol.
21:884-886[Medline].
|
| 37.
|
Moribe, T.,
N. Hayashi,
Y. Kanazawa,
E. Mita,
H. Fusamoto,
M. Negi,
T. Kaneshige,
H. Igimi,
T. Kamada, and K. Uchida.
1995.
Hepatitis C viral complexity detected by single-strand conformation polymorphism and response to interferon therapy.
Gastroenterology
108:789-795[Medline].
|
| 38.
|
Okada, S.,
Y. Akahane,
H. Suzuki,
H. Okamoto, and S. Mishiro.
1992.
The degree of variability in the amino terminal region of the E2/NS1 protein of hepatitis C virus correlates with responsiveness to interferon therapy in viremic patients.
Hepatology
16:619-624[Medline].
|
| 39.
|
Okamoto, H.,
M. Kojima,
S. Okada,
H. Yoshizawa,
H. Iizuka,
T. Tanaka,
E. E. Muchmore,
D. A. Peterson,
Y. Ito, and S. Mishiro.
1992.
Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability.
Virology
190:894-899[Medline].
|
| 40.
|
Polyak, S. J.,
G. Faulkner,
R. L. Carithers,
L. Corey, and D. R. Gretch.
1997.
Assessment of hepatitis C virus quasispecies heterogeneity by gel shift analysis: correlation with response to interferon therapy.
J. Infect. Dis.
175:1101-1107[Medline].
|
| 41.
|
Reed, K. E.,
J. Xu, and C. M. Rice.
1997.
Phosphorylation of the hepatitis C virus NS5A protein in vitro and in vivo: properties of the NS5A-associated kinase.
J. Virol.
71:7187-7197[Abstract].
|
| 42.
|
Squadrito, G.,
F. Leone,
M. Sartori,
B. Nalpas,
P. Berthelot,
G. Raimondo,
S. Pol, and C. Brechot.
1996.
HCV NS5A mutations and response of chronic hepatitis to alpha interferon.
Hepatology
24:155A.
|
| 43.
|
Squadrito, G.,
F. Leone,
M. Sartori,
B. Nalpas,
P. Berthelot,
G. Raimondo,
S. Pol, and C. Brechot.
1997.
Mutations in the nonstructural 5A region of hepatitis C virus and response of chronic hepatitis C to interferon alfa.
Gastroenterology
113:567-572[Medline].
|
| 44.
|
Takada, N.,
S. Takase, and A. Takada.
1993.
Effects of genotypes of hepatitis C virus on interferon treatment for chronic type C hepatitis.
Gastroenterol. Jpn.
28:268-275[Medline].
|
| 45.
|
Tanimoto, A.,
Y. Ide,
N. Arima,
Y. Sasaguri, and R. Padmanabhan.
1997.
The amino terminal deletion mutants of hepatitis C virus nonstructural protein NS5A function as transcriptional activators in yeast.
Biochem. Biophys. Res. Commun.
236:360-364[Medline].
|
| 46.
|
Tanji, Y.,
T. Kaneko,
S. Satoh, and K. Shimotohno.
1995.
Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A.
J. Virol.
69:3980-3986[Abstract].
|
| 47.
|
Toyoda, H.,
T. Kumada,
S. Nakano,
I. Takeda,
K. Sugiyama,
T. Osada,
S. Kiriyama,
Y. Sone,
M. Kinoshita, and T. Hadama.
1997.
Quasispecies nature of hepatitis C virus and response to alpha interferon: significance as a predictor of direct response to interferon.
J. Hepatol.
26:6-13[Medline].
|
| 48.
|
Tsubota, A.,
K. Chayama,
Y. Arase,
I. Koida,
S. Saitoh,
K. Ikeda,
S. Iwasaki,
T. Matsumoto,
M. Kobayashi, and H. Kumada.
1993.
Factors useful in predicting the response to interferon therapy in chronic hepatitis C.
J. Gastroenterol. Hepatol.
8:535-539[Medline].
|
| 49.
|
van Doorn, L. J.,
I. Capriles,
G. Maertens,
R. DeLeys,
K. Murray,
T. Kos,
H. Schellekens, and W. Quint.
1995.
Sequence evolution of the hypervariable region in the putative envelope region E2/NS1 of hepatitis C virus is correlated with specific humoral immune responses.
J. Virol.
69:773-778[Abstract].
|
| 50.
|
Weiner, A. J.,
M. J. Brauer,
J. Rosenblatt,
K. H. Richman,
J. Tung,
K. Crawford,
F. Bonino,
G. Saracco,
Q. L. Choo, and M. Houghton.
1991.
Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins.
Virology
180:842-848[Medline].
|
| 51.
|
Weiner, A. J.,
H. M. Geysen,
C. Christopherson,
J. E. Hall,
T. J. Mason,
G. Saracco,
F. Bonino,
K. Crawford,
C. D. Marion,
K. A. Crawford,
M. Brunetto,
P. J. Barr,
T. Miyamura,
J. McHutchinson, and M. Houghton.
1992.
Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections.
Proc. Natl. Acad. Sci. USA
89:3468-3472[Abstract/Free Full Text].
|
| 52.
|
Wilson, J. J.,
S. J. Polyak,
T. D. Day, and D. R. Gretch.
1995.
Characterization of simple and complex hepatitis C virus quasispecies by heteroduplex gel shift analysis: correlation with nucleotide sequencing.
J. Gen. Virol.
76:1763-1771[Abstract/Free Full Text].
|
| 53.
|
Yoshioka, K.,
S. Kakumu,
T. Wakita,
T. Ishikawa,
Y. Itoh,
M. Takayanagi,
Y. Higashi,
M. Shibata, and T. Morishima.
1992.
Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus.
Hepatology
16:293-299[Medline].
|
| 54.
|
Yun, Z. B.,
O. Reichard,
M. Chen,
J. Lundeberg,
G. Norkrans,
A. Fryden,
A. Sonnerborg, and O. Weiland.
1994.
Serum hepatitis C virus RNA levels in chronic hepatitis C importance for outcome of interferon alfa-2b treatment.
Scand. J. Infect. Dis.
26:263-270[Medline].
|
| 55.
|
Zeuzem, S.,
J. H. Lee, and W. K. Roth.
1997.
Mutations in the nonstructural 5A gene of European hepatitis C virus isolates and response to interferon alfa.
Hepatology
25:740-744[Medline].
|
| 56.
|
Ziebert, A.,
E. Schreier, and M. Roggendorf.
1995.
Antibodies in human sera specific to hypervariable region 1 of hepatitis C virus can block viral attachment.
Virology
208:653-661[Medline].
|
J Virol, May 1998, p. 4288-4296, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Herring, B. L., Tsui, R., Peddada, L., Busch, M., Delwart, E. L.
(2005). Wide Range of Quasispecies Diversity during Primary Hepatitis C Virus Infection. J. Virol.
79: 4340-4346
[Abstract]
[Full Text]
-
Puig-Basagoiti, F., Forns, X., Furcic, I., Ampurdanes, S., Gimenez-Barcons, M., Franco, S., Sanchez-Tapias, J. M., Saiz, J.-C.
(2005). Dynamics of hepatitis C virus NS5A quasispecies during interferon and ribavirin therapy in responder and non-responder patients with genotype 1b chronic hepatitis C. J. Gen. Virol.
86: 1067-1075
[Abstract]
[Full Text]
-
Chambers, T. J., Fan, X., Droll, D. A., Hembrador, E., Slater, T., Nickells, M. W., Dustin, L. B., DiBisceglie, A. M.
(2005). Quasispecies Heterogeneity within the E1/E2 Region as a Pretreatment Variable during Pegylated Interferon Therapy of Chronic Hepatitis C Virus Infection. J. Virol.
79: 3071-3083
[Abstract]
[Full Text]
-
Qin, H., Shire, N. J., Keenan, E. D., Rouster, S. D., Eyster, M. E., Goedert, J. J., Koziel, M. J., Sherman, K. E., and the Multicenter Hemophilia Cohort Study Group,
(2005). HCV quasispecies evolution: association with progression to end-stage liver disease in hemophiliacs infected with HCV or HCV/HIV. Blood
105: 533-541
[Abstract]
[Full Text]
-
Margraf, R. L., Erali, M., Liew, M., Wittwer, C. T.
(2004). Genotyping Hepatitis C Virus by Heteroduplex Mobility Analysis Using Temperature Gradient Capillary Electrophoresis. J. Clin. Microbiol.
42: 4545-4551
[Abstract]
[Full Text]
-
Canobio, S., Guilbert, C. M., Troesch, M., Samson, J., Lemay, M., Pelletier, V. A., Bernard-Bonnin, A.-C., Kozielski, R., Lapointe, N., Martin, S. R., Soudeyns, H.
(2004). Differing Patterns of Liver Disease Progression and Hepatitis C Virus (HCV) Quasispecies Evolution in Children Vertically Coinfected with HCV and Human Immunodeficiency Virus Type 1. J. Clin. Microbiol.
42: 4365-4369
[Abstract]
[Full Text]
-
Pellerin, M., Lopez-Aguirre, Y., Penin, F., Dhumeaux, D., Pawlotsky, J.-M.
(2004). Hepatitis C Virus Quasispecies Variability Modulates Nonstructural Protein 5A Transcriptional Activation, Pointing to Cellular Compartmentalization of Virus-Host Interactions. J. Virol.
78: 4617-4627
[Abstract]
[Full Text]
-
Gaudy, C., Moreau, A., Veillon, P., Temoin, S., Lunel, F., Goudeau, A.
(2003). Significance of Pretreatment Analysis of Hepatitis C Virus Genotype 1b Hypervariable Region 1 Sequences To Predict Antiviral Outcome. J. Clin. Microbiol.
41: 3615-3622
[Abstract]
[Full Text]
-
Yan, W., Kitzes, G., Dormishian, F., Hawkins, L., Sampson-Johannes, A., Watanabe, J., Holt, J., Lee, V., Dubensky, T., Fattaey, A., Hermiston, T., Balmain, A., Shen, Y.
(2003). Developing Novel Oncolytic Adenoviruses through Bioselection. J. Virol.
77: 2640-2650
[Abstract]
[Full Text]
-
Sarrazin, C., Herrmann, E., Bruch, K., Zeuzem, S.
(2002). Hepatitis C Virus Nonstructural 5A Protein and Interferon Resistance: a New Model for Testing the Reliability of Mutational Analyses. J. Virol.
76: 11079-11090
[Abstract]
[Full Text]
-
Nadal, A., Martell, M., Lytle, J. R., Lyons, A. J., Robertson, H. D., Cabot, B., Esteban, J. I., Esteban, R., Guardia, J., Gomez, J.
(2002). Specific Cleavage of Hepatitis C Virus RNA Genome by Human RNase P. J. Biol. Chem.
277: 30606-30613
[Abstract]
[Full Text]
-
Contreras, A. M., Hiasa, Y., He, W., Terella, A., Schmidt, E. V., Chung, R. T.
(2002). Viral RNA Mutations Are Region Specific and Increased by Ribavirin in a Full-Length Hepatitis C Virus Replication System. J. Virol.
76: 8505-8517
[Abstract]
[Full Text]
-
Polyak, S. J., Khabar, K. S. A., Paschal, D. M., Ezelle, H. J., Duverlie, G., Barber, G. N., Levy, D. E., Mukaida, N., Gretch, D. R.
(2001). Hepatitis C Virus Nonstructural 5A Protein Induces Interleukin-8, Leading to Partial Inhibition of the Interferon-Induced Antiviral Response. J. Virol.
75: 6095-6106
[Abstract]
[Full Text]
-
Polyak, S. J., Khabar, K. S. A., Rezeiq, M., Gretch, D. R.
(2001). Elevated Levels of Interleukin-8 in Serum Are Associated with Hepatitis C Virus Infection and Resistance to Interferon Therapy. J. Virol.
75: 6209-6211
[Abstract]
[Full Text]
-
Majumder, M., Ghosh, A. K., Steele, R., Ray, R., Ray, R. B.
(2001). Hepatitis C Virus NS5A Physically Associates with p53 and Regulates p21/waf1 Gene Expression in a p53-Dependent Manner. J. Virol.
75: 1401-1407
[Abstract]
[Full Text]
-
Nousbaum, J.-B., Polyak, S. J., Ray, S. C., Sullivan, D. G., Larson, A. M., Carithers, R. L. Jr., Gretch, D. R.
(2000). Prospective Characterization of Full-Length Hepatitis C Virus NS5A Quasispecies during Induction and Combination Antiviral Therapy. J. Virol.
74: 9028-9038
[Abstract]
[Full Text]
-
White, P. A., Zhai, X., Carter, I., Zhao, Y., Rawlinson, W. D.
(2000). Simplified Hepatitis C Virus Genotyping by Heteroduplex Mobility Analysis. J. Clin. Microbiol.
38: 477-482
[Abstract]
[Full Text]
-
Sandres, K., Dubois, M., Pasquier, C., Payen, J. L., Alric, L., Duffaut, M., Vinel, J. P., Pascal, J. P., Puel, J., Izopet, J.
(2000). Genetic Heterogeneity of Hypervariable Region 1 of the Hepatitis C Virus (HCV) Genome and Sensitivity of HCV to Alpha Interferon Therapy. J. Virol.
74: 661-668
[Abstract]
[Full Text]
-
Gerotto, M., Sullivan, D. G., Polyak, S. J., Chemello, L., Cavalletto, L., Pontisso, P., Alberti, A., Gretch, D. R.
(1999). Effect of Retreatment with Interferon Alone or Interferon plus Ribavirin on Hepatitis C Virus Quasispecies Diversification in Nonresponder Patients with Chronic Hepatitis C. J. Virol.
73: 7241-7247
[Abstract]
[Full Text]
-
Pawlotsky, J.-M., Germanidis, G., Frainais, P.-O., Bouvier, M., Soulier, A., Pellerin, M., Dhumeaux, D.
(1999). Evolution of the Hepatitis C Virus Second Envelope Protein Hypervariable Region in Chronically Infected Patients Receiving Alpha Interferon Therapy. J. Virol.
73: 6490-6499
[Abstract]
[Full Text]
-
Majid, A, Jackson, P, Lawal, Z, Pearson, G., Parker, H, Alexander, G., Allain, J., Petrik, J
(1999). Ontogeny of hepatitis C virus (HCV) hypervariable region 1 (HVR1) heterogeneity and HVR1 antibody responses over a 3 year period in a patient infected with HCV type 2b. J. Gen. Virol.
80: 317-325
[Abstract]
-
Sullivan, D. G., Wilson, J. J., Carithers, R. L. Jr., Perkins, J. D., Gretch, D. R.
(1998). Multigene Tracking of Hepatitis C Virus Quasispecies after Liver Transplantation: Correlation of Genetic Diversification in the Envelope Region with Asymptomatic or Mild Disease Patterns. J. Virol.
72: 10036-10043
[Abstract]
[Full Text]
-
Gale, M. Jr., Blakely, C. M., Kwieciszewski, B., Tan, S.-L., Dossett, M., Tang, N. M., Korth, M. J., Polyak, S. J., Gretch, D. R., Katze, M. G.
(1998). Control of PKR Protein Kinase by Hepatitis C Virus Nonstructural 5A Protein: Molecular Mechanisms of Kinase Regulation. Mol. Cell. Biol.
18: 5208-5218
[Abstract]
[Full Text]