Previous Article | Next Article 
J Virol, May 1998, p. 4243-4249, Vol. 72, No. 5
Departments of
Neurology,1
Pathology and Laboratory
Medicine,2 and
Microbiology,4 University of
Pennsylvania Medical Center, Philadelphia, Pennsylvania, and
Department of Neurology, Johns Hopkins University Medical
School, Baltimore, Maryland3
Received 24 September 1997/Accepted 29 January 1998
The role of human immunodeficiency virus (HIV) strain variability
remains a key unanswered question in HIV dementia, a condition affecting around 20% of infected individuals. Several groups have shown that viruses within the central nervous system (CNS) of infected
patients constitute an independently evolving subset of HIV strains. A
potential explanation for the replication and sequestration of viruses
within the CNS is the preferential use of certain chemokine receptors
present in microglia. To determine the role of specific chemokine
coreceptors in infection of adult microglial cells, we obtained a small
panel of HIV type 1 brain isolates, as well as other HIV strains that
replicate well in cultured microglial cells. These viruses and
molecular clones of their envelopes were used in infections, in
cell-to-cell fusion assays, and in the construction of pseudotypes. The
results demonstrate the predominant use of CCR5, at least among the
major coreceptors, with minor use of CCR3 and CXCR4 by some of the
isolates or their envelope clones.
Human immunodeficiency virus (HIV)
dementia (HIVD), also called the AIDS dementia complex, is a primary
disorder of the central nervous system (CNS) that affects about 20% of
HIV-infected individuals (32). Although the pathogenesis of
HIVD has been the subject of many studies, there is no consensus on the
cause of brain dysfunction. Neuropathological and virological studies
have implicated brain microglial cells and microglia-derived giant
cells as the principal CNS cells infected with HIV (3, 35,
39), leading most investigators to believe that microglial cells
are the central element in the development of this complication.
Microglial cells may produce viral proteins that have neurotoxic
properties, or perhaps HIV-infected cells are induced to secrete
soluble neurotoxins like platelet-activating factor, tumor necrosis
factor alpha, or nitric oxide (15, 22, 23, 30).
A key unanswered question in the development of HIVD is the role of
viral strain variability. While only a proportion of infected individuals demonstrate CNS dysfunction, the relative contributions of
viral and host factors are unknown. Data from a number of groups have
indicated that HIV penetrates the CNS early during the course of
systemic HIV infection (5, 8). For example, HIV can be isolated from the cerebrospinal fluid of 50% of individuals early in
the course of infection, and HIV sequences obtained from the CNS
segregate independently of sequences prevalent in the systemic circulation (11, 17, 26, 40). One potential explanation for
the isolated evolution of HIV strains within the CNS is that replication within microglia results in adaptation of the virus for
this cell type (36).
Chemokine receptors, which were recently found to have an essential
role in mediating HIV entry in conjunction with CD4, are responsible
for some of the key differences in HIV cellular tropism (6, 9, 13,
14, 19). Isolates using CXCR4 as a coreceptor replicate in
peripheral blood lymphocytes and in some immortalized T-cell lines,
whereas HIV type 1 (HIV-1) isolates that replicate in monocyte-derived
macrophages (MDM) utilize CCR5, the second major HIV coreceptor
discovered. Several other chemokine receptors, like CCR3, and orphan
receptors such as STRL33 and GPR15 have been shown to have coreceptor
activity with different assays (10, 18, 29). The potential
role of these and other chemokine receptors in HIV pathogenesis is yet
to be explored.
Microglial cells express several chemokine receptors, including CCR3,
CCR5, and CXCR4 (25, 27). Therefore, viruses could theoretically use any of these coreceptors to enter microglial cells.
In fact, clearly T-cell line-tropic viruses like HIV-1HXB will replicate in some microglial preparations (36).
However, for the most part, viruses that replicate in microglial cells also replicate in MDM (36, 37), and they would be expected to at the very least use CCR5 as a coreceptor. However, He and collaborators (25) have recently suggested that utilization of CCR3 as a coreceptor is an important correlate of replication in
fetal microglial cells, since some viruses obtained from the brain
(JRFL and YU-2) (28) were capable of utilizing CCR3 in a
fusion assay, and antibodies against CCR3 inhibited infection of fetal
microglial cells.
To determine the role of chemokine coreceptors in infection of adult
microglial cells, we have obtained a small panel of brain isolates
(20, 21), as well as other HIV strains that replicate well
in cultured microglial cells. These viruses, as well as molecular clones of their envelope (env) genes, have been used in
infection and cell-to-cell fusion assays to determine their chemokine
coreceptor utilization. The results demonstrate the predominant use of
CCR5, at least among the major coreceptors so far identified, but with some use of CCR3 and CXCR4 by some envelope clones.
Cells.
Microglial cultures were prepared as previously
described (1, 36, 41) from fresh adult human brain tissue
obtained from donors undergoing temporal lobectomy for
medication-resistant epilepsy. CD4-expressing human osteosarcoma
(HOS-CD4) cells engineered to express chemokine receptors were obtained
from the AIDS Reference Reagent Program. 293T and U87 cells were
obtained from M. Malim (Department of Microbiology, University of
Pennsylvania) and B. Doranz (Department of Pathology and Laboratory
Medicine, University of Pennsylvania), respectively. The microglial
cells were maintained in M/M medium (Dulbecco's modified Eagle's
medium [DMEM] supplemented with 5% fetal bovine serum, 5% giant
cell tumor supernatant [IGEN Inc., Rockville, Md.]) as described
previously (36); 293T and U87 cells were maintained in DMEM
supplemented with 10% fetal bovine serum with penicillin and
streptomycin (each at 100 U/ml).
HIV isolates.
The isolate HIV-1BORI, which was
obtained from an individual with a primary HIV-1 infection, was
provided by G. Shaw (University of Alabama, Birmingham).
HIV-1BORI-15 was selected by 15 sequential passages of the
parental BORI isolate in microglial cells (36). The primary
brain HIV-1 strains DS-br, RC-br, and KJ-br were isolated by S. Gartner
(20, 21) in MDM. Virus stocks of these isolates were
prepared in macrophages. Molecular HIV clone YU-2(RF-1), originally
cloned by Li et al. (28), was obtained from R. Fouchier (University of Pennsylvania). HIV-1Ada-M was obtained from
the AIDS repository. HIV-189.6 was obtained from R. Collman
(University of Pennsylvania) (7).
Microglial infection.
Microglial cells were plated in
24-well plates at a density of 2 × 105 cells/well and
infected with cell-free virus stocks standardized by
p24gag antigen content (34 ng/ml). The cultures
were exposed to the virus inocula for 16 h at 37°C; the inocula
were then removed and replaced by fresh medium. The culture
supernatants were removed at regular intervals, and fresh medium was
added. The supernatants were stored at Infection of cells expressing chemokine coreceptors.
293T
cells expressing chemokine receptors were prepared by transiently
transfecting 3 × 105 cells/well in a six-well plate
with 2 µg each of pT4 (31), which expresses the CD4
molecule, and plasmids expressing CCR3 (34), CCR5
(9), or CXCR4 (19), using calcium phosphate. The
following day, transfected cells were replated in 96-well plates and
infected with cell-free virus stocks (73 ng of
p24gag viral antigen per ml). Cultures were
exposed to inocula for 5 h at 37°C. Culture supernatants were
removed on days 3, 6, and 8 after infection, and
p24gag antigen concentrations were measured (NEN
DuPont).
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Chemokine Receptor Utilization by Human
Immunodeficiency Virus Type 1 Isolates That Replicate in
Microglia
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
80°C until the
p24gag antigen concentration was measured with
an antigen capture assay (NEN DuPont, Boston, Mass.).
PCR amplification of HIV env genes. The env genes from isolates HIV-1BORI-15, HIV-1RC-br, HIV-1DS-br, and HIV-1KJ-br were molecularly cloned from the genomic DNA extracted from cultured human microglia 3 days after infection. HIV-1BORI was cloned from DNA extracted from infected peripheral blood mononuclear cells. Plasmid YU-2(RF-1) was used to clone the YU-2 envelope. The pCR3.1-JRFL env expression vector was provided by B. Doranz (12), and the BaL env expression plasmid was obtained from J. Moore (Aaron Diamond AIDS Research Center, New York, N.Y.).
The env genes were amplified by PCR using AmpliWax beads (Perkin-Elmer, Norwalk, Conn.) in a DNA Thermal Cycler (Perkin-Elmer). The reaction mixtures contained a total volume of 50 µl and were composed of 1× PCR buffer II (Perkin-Elmer), 2.5 mM MgCl2, 0.4 mM deoxynucleoside triphosphates, 1 µM each env 1 primer (5' AGAAAGAGCAGAAGACAGTGGCAATGA 3') and env 2 primer (5' TTTTGACCACTTGCCACCCAT 3'), and 2.5 U of Amplitaq DNA polymerase (Perkin-Elmer). The reaction conditions were a denaturing step at 93°C for 1 min, 30 cycles with a denaturing step of 93°C for 30 s, an annealing step of 62°C for 30 s, an extension step of 72°C for 4 min, and a final extension step of 72°C for 10 min. The PCR products were visualized by agarose gel electrophoresis, and bands of the appropriate size were purified by using Geneclean (Bio 101, La Jolla, Calif.). env PCR products from HIV-1BORI and HIV-1BORI-15 were ligated by T/A cloning into pCR2.1 (Invitrogen, San Diego, Calif.), and those clones in the proper orientation were directionally subcloned into pcDNA3.1() (Invitrogen) for use in the fusion assays and for the
preparation of pseudotypes. env PCR products from the brain
isolates were ligated by unidirectional T/A cloning directly into
pCR3.1-Uni (Invitrogen). Individual recombinants with full-length
inserts were then selected for use in fusion and pseudotype assays,
based on restriction mapping.
The molecular clones were sequenced in the C2-V4 regions by using a
single primer, 5'-ACAGTACAATGTACACATGG-3'. The sequences were analyzed by using CLUSTAL to ensure that each set of clones were
derived from a distinct parent virus.
Western analysis.
293T cells (106) were infected
with vaccinia virus encoding T7 RNA polymerase (vTF1.1; a gift from B. Moss, National Institute of Allergy and Infectious Diseases [NIAID])
to drive env expression and then transfected with envelope
clones and pNL4-3-LucR+E
(a gift from N. Landau, Aaron Diamond AIDS Research Center) as described below.
Twenty-four hours later, the cells were lysed in 1 ml of lysis buffer
(10 mM Tris [pH 7.5], 0.15 M NaCl, 2 mM EDTA, 0.5% Nonidet P-40,
aprotinin [2 µg/ml], phenylmethylsulfonyl fluoride [50 µg/ml]),
and 30 µl was chromatographed in a sodium dodecyl sulfate-7.5%
polyacrylamide gel. The proteins were transferred to a polyvinylidene
difluoride membrane by using a semidry apparatus, then probed with a
rabbit polyclonal anti-gp120 serum (R2143; a gift of P. Earl, NIAID)
followed by horseradish peroxidase-conjugated goat anti-rabbit serum
(Boehringer Mannheim), and visualized by chemiluminescence (Amersham).
Fusion assays. env clones were tested in a cell-cell fusion assay (13, 33, 34) for the ability to mediate fusion with various coreceptors. env-expressing effector cells were mixed with target cells expressing CD4 and coreceptor. Effector cells also contained vaccinia virus encoding T7 RNA polymerase (vTF1.1) which drove luciferase production upon fusion with the target cells. Effector cells were prepared by infecting 293T cells with vTF1.1 at a multiplicity of infection of 10 for 45 min and then transfecting these cells with constructs expressing env, using calcium phosphate for 4 h. Effector cells were incubated overnight in rifampin to inhibit vaccinia virus replication. Target cells were prepared by transfecting QT6 cells with equal amounts of CD4 and coreceptor plasmids (9, 19, 31, 34) for 4 h at 37°C and incubated overnight. To assay for fusion, effector cells were washed and mixed with target cells in the presence of rifampin and cytosine arabinoside. Fusion proceeded for 9 h at 37°C, and cells were lysed with 0.5% Nonidet P-40. Luciferase activity was measured by adding 50 µl of lysate to 50 µl of luciferase substrate (Promega) and determining chemiluminescence in a luminometer (13).
Production of viral pseudotypes.
Pseudotypes were prepared
essentially as described by Deng et al. (9). In brief, 293T
cells were cotransfected by using calcium phosphate (5 Prime-3 Prime,
Boulder, Colo.) with equivalent amounts of
pNL4-3-LucRE or
pNL4-3-LucR+E (gifts from N. Landau) together
with plasmids expressing the appropriate env gene. Cells
(3 × 105/well) were transfected in six-well plates
with 3 µg of each plasmid; alternatively, 106 cells were
transfected in 10-cm dishes with 15 µg of each plasmid. Supernatants
containing the pseudotyped viruses were collected 2 to 3 days later,
either centrifuged (10 min at 1,750 × g on a Beckman
centrifuge) or filtered through a 0.45-µm-pore-size filter to remove
cellular debris, and then stored at 80°C.
Infection of U87 cells with HIV pseudotypes. U87 cells (105/well) were plated and grown overnight in a 24-well plate. The following day they were transfected with 2 µg each of pT4, which expresses the CD4 molecule (31), and plasmids expressing the desired chemokine receptor. After 24 h, the transfected cells were infected with 200 µl of pseudotyped virus in the presence of Polybrene (8 µg/ml), and 500 µl of medium was added 16 to 24 h later. On the third day after the pseudotype infection, the cells were lysed with 150 µl of buffer as instructed for the Promega luciferase assay system. Luciferase activity was measured by adding 50 µl of luciferase substrate to 20 µl of lysate in 75- by 12-mm tubes (Sarstedt) and reading light activity in a Lumat LB 9501 luminometer (Berthold). In all experiments, light activity is reported as relative light units per 10 s.
Infection of microglia with pseudotyped virus. Pseudotypes expressing the HIV-1BaL envelope were prepared as indicated above. Microglial cells were cultured in 96-well plates for 18 days and then pretreated with anti-CCR5 antibody 45531.111 (R&D Systems, Minneapolis, Minn.), anti-CCR3 antibody 7B11 (AIDS repository), or anti-CXCR-4 antibody 12G5 (17) (obtained from J. Hoxie) at 20 µg/ml for 45 min at 4°C. The cells were then infected with 200 µl of pseudotyped virus for 16 h at 37°C, the medium was replaced, and the cells were lysed 3 days later with 100 µl of lysis buffer; then 40 µl was combined with 100 µl of luciferase substrate, and chemiluminescence read as indicated above.
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Infections of microglial cultures with brain isolates. Several publications have documented the infectability of cultured adult microglia with either primary or laboratory HIV-1 strains (36, 37). Since microglia are the principal cell type infected in the brains of individuals with HIVD, we expected that most or all isolates obtained from the brain would infect microglial cultures. Three HIV isolates cultured from the brain tissue of two adults (HIV-1RC-br and HIV-1DS-br) and one infant (HIV-1KJ-br), all of whom had died with HIVD or HIV encephalopathy, and a well-documented isolate from the frontal lobe (HIV-1JRFL) were used to infect microglial tissue as described in Materials and Methods. The p24gag concentrations in the supernatants on day 17 after infection (which is approximately the time of peak replication) are shown in Table 1. In addition, we used a control dualtropic virus, HIV-189.6. All of the viruses replicated in the microglial cultures, but infection with HIV-1KJ-br resulted in consistently lower p24gag concentrations in eight similar experiments using microglia obtained from different donors. In subsequent experiments, we also used two related isolates, HIV-1BORI, a virus isolated during an acute infection, and a derivative obtained by sequential passage in microglia (HIV-1BORI-15) that replicates to high titer and induces giant syncytia in microglia (36).
|
Cytopathicity in microglial cultures. The most characteristic finding in HIV infection of the nervous system is the multinucleated giant cell, which is thought to represent the fusion of infected microglial cells. Multinucleated giant cell formation was also seen following in vitro infection of microglial cultures (36, 37). Since the chemokine coreceptors are involved in cell-to-cell fusion, we wanted to assess syncytium formation by the viruses used in these experiments (Fig. 1). Cultures infected with the brain isolates HIV-1DS-br and HIV-1RC-br (Fig. 1C and D) demonstrated marked cytopathology, while HIV-1KJ-br-infected (Fig. 1B) and mock-infected (Fig. 1A) microglial cultures had little or no syncytium formation. These findings were repeated in assays of microglial cultures from seven other donors. Similarly, infection with HIV-1BORI induced little or no cytopathology, whereas infection with the sequentially passaged isolate induced extensive fusion (36).
|
Replication in 293T cells transfected with chemokine receptors. We transfected 293T cells with CD4 and one of the major chemokine coreceptors (CCR3, CCR5, or CXCR4), and used these cells in infections as indicated in Materials and Methods. We first performed fusion experiments with CCR3 and did not see any signal above background with our env clones (see below). We then switched to CCR3P, which expresses CCR3 at up to 20-fold-higher levels than the original construct (34). CCR3P was then used for all subsequent experiments, and all results reported here are for that construct.
Infectivity was determined by assay for p24gag 6 days after infection, and the values are reported in Table 2. All of the viruses replicated in the 293T-CD4-CCR5 cells, but there was some variability in the use of the other coreceptors. For example, isolates HIV-1DS-br and HIV-1YU-2 replicated in cells expressing CCR3 (high-expressing construct CCR3P), whereas HIV-1DS-br, HIV-1KJ-br, and HIV-1BORI had p24 values above background in the cells expressing CXCR4.
|
Envelope-mediated cell-to-cell fusion. The envelope genes from the panel of HIV strains that replicated in microglia were then molecularly cloned as described in Materials and Methods. Two to five functional clones were obtained for each brain isolate.
For the cell-to-cell fusion assay, the env gene was expressed in 293T cells (effectors); these were fused with QT6 cells (targets) expressing the CD4 molecule together with one of several coreceptor molecules. The QT6 cells were also transfected with a plasmid expressing the luciferase gene under the control of the T7 promoter, which was activated when cell fusion allowed the translocation of the T7 polymerase protein expressed in the effector cells. The extent of fusion was therefore quantified by chemoluminescence. Data from representative experiments are shown in Fig. 2. Three envelope clones obtained from HIV-1BORI-15 and one env clone obtained from HIV-1BORI clone all showed strong fusion with CCR5-expressing targets, as well as with CCR3-expressing targets (Fig. 2A). Control envelopes from HIV-1JRFL and HIV-1YU-2 fused cells expressing either CCR5 or CCR3, as previously reported (6, 25). Expression of other coreceptors, including CCR1, CCR2, CCR4, and CXCR4, did not lead to fusion of HIV-1BORI or HIV-1BORI-15 env-expressing cells (data not shown). These results indicated that the pattern of coreceptor utilization had not changed after extensive passage in microglia, in spite of the accelerated replication and fusogenicity of the passaged virus.
|
env-pseudotyped virus infection of U87-MG cells. To test the coreceptor utilization by envelope proteins in the context of virions, we used a pseudotyped virus system described by Deng and collaborators (9). env-pseudotyped luciferase-expressing viruses were used to infect with U87 cells transiently transfected with CD4 and various chemokine coreceptors. Since in this system the nef gene has been replaced by the luciferase gene, viral entry was quantified by measuring chemiluminescence.
env clones from each of the viruses were individually tested in multiple experiments, and the geometric mean was obtained (Table 3).
|
|
Antibody blocking of microglial infection. To determine whether antibodies against CCR3, CCR5, and CXCR4 could block infection of microglia, we used pseudotyped virus containing env from HIV-1BaL. These pseudotypes registered positively with cells expressing either CCR3 or CCR5 (Table 3) and were high titered, making these pseudotypes particularly suitable for infection of a primary cell. As shown in Fig. 4, exposure of microglial cells with anti-CCR5 (45531) for 45 min prior to infection resulted in a marked reduction in the luciferase activity. Neither the anti-CCR3 antibody (7B11) nor the anti-CXCR4 antibody (12G5) had a marked effect on infection. However, the anti-CCR3 antibody inhibited infection of HIV-1BaL pseudotypes in U87 cells transiently transfected with CD4 and CCR3 (data not shown).
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
HIV infection of microglia appears to be an essential component of HIVD, since this is the predominant cell type harboring HIV sequences and expressing HIV proteins in the CNS of HIV-infected individuals (3, 24, 38, 39). Several lines of evidence suggest that strain variability could play a role in infection of microglial cells. First, HIV infection of the CNS occurs only in a proportion of HIV-infected individuals, in spite of the nearly universal presence of macrophage-tropic strains, most of which can replicate at least to some extent in microglia (36). Furthermore, studies from several groups have documented that HIV sequences obtained from the CNS cluster together, suggesting an independent evolution, perhaps even adaptation for CNS replication (17, 26, 40). Finally, in vitro, some HIV strains replicate preferentially in microglial cells rather than MDM (36).
Chemokine receptor utilization is a key determinant of cellular tropism (reviewed in reference 4), and since microglial cells express CCR3, CCR5, CXCR4, and perhaps other coreceptors, it is reasonable to propose that differential utilization of chemokine coreceptors could be partly responsible for specific tropism for this cell type. To determine whether in fact viruses that replicate well in microglia have a unique pattern of utilization of chemokine coreceptors, we obtained three viruses cultured from the CNS of individuals with dementia or encephalopathy (the pediatric counterpart of HIVD) and one strain that had been adapted for microglial growth by sequential passage. Infection of microglia with this adapted isolate results in particularly large syncytia. These viruses were used to infect cells engineered to express CD4 in conjunction with one of the major coreceptors. Envelope clones from each isolate were then used in a cell-to-cell fusion assay, and pseudotyped viruses were prepared.
All of the brain isolates as well as the isolate passaged in microglia used CCR5 as the principal coreceptor in all of the assays, although there was some replication in cells expressing CXCR4 or CCR3. This was more noticeable in the isolate adapted to microglia (HIV-1BORI-15), which used CCR3 in the fusion assay performed with a construct that expresses CCR3 well (CCR3P). One of the env clones obtained from this virus also used CCR3 in the pseudotype assay. However, this pattern of chemokine receptor use was similar to that of its parent (HIV-1BORI), indicating that adaptation into a syncytium-forming phenotype for microglia was not associated with alteration in the use of these major coreceptors. Nor was this pattern particularly unique for this virus, since many other isolates use multiple coreceptors, including CCR3 and STRL33 (2, 4, 10, 18, 29). Our data reinforce the importance of CCR5 as a coreceptor for macrophage-like cells but do not exclude the possibility that other coreceptors among the many recently described could influence entry into microglial cells.
He et al. (25) recently reported that CCR3 and CCR5 function as coreceptors for HIV-1 infection of fetal microglia and showed that an antibody directed against CCR3 could inhibit infection of those cells. While we found no compelling evidence for CCR3 predominance among CNS viruses, our experiments were performed with several of the same brain isolates in adult microglia. Perhaps the developmental stage of the microglia or even the influence of other cell types present in the experiments performed by He et al. may account for the discrepancies between these two studies.
We were initially concerned that the isolation procedures for four of the brain isolates or clones could have altered the chemokine coreceptor use, and thus we obtained env clones from DNA extracted from microglia, ensuring that they represent viruses that can enter these cells. Although the results were reasonably uniform, there was some variability among the clones (Table 3), suggesting that direct cloning of envelopes from infected CNS might offer an alternative approach for studies of the utilization of coreceptors in the brain. This is an important area for future studies as the number of potential coreceptors expands, since many of them are expressed in CNS tissues. These experiments also stress the importance of studying coreceptor utilization on primary cells and with multiple clones.
| |
ACKNOWLEDGMENTS |
|---|
A.V.A. and J.T.C.S. contributed equally to this work.
This work was supported by PHS grants NS-27405, NS-35743, training grant AI-07325, and the Medical Scientist Training Program.
We thank E. Berger (NIAID) for the CXCR4 molecular clone, S. Peiper (University of Louisville) for the CCR3 clone, M. Parmentier (Université libre de Bruxelles, Brussels, Belgium) for the CCR5 clone, N. Landau (Aaron Diamond AIDS Research Center) for the pNL4-3-Luc vectors, J. Moore (Aaron Diamond AIDS Research Center) for the BaL env expression vector, P. Earl (NIAID) for the R2143 serum, and J. Hoxie (University of Pennsylvania) for the 12G5 antibody. Other reagents were obtained from the AIDS Research Reference and Reagent Program. We thank B. Doranz and other members of the Doms laboratory for many helpful comments and advice, and we thank H. Sheng for technical help.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Department of Neurology, University of Pennsylvania Medical Center, Clinical Research Building, 415 Curie Blvd., Philadelphia, PA 19104-6146. Phone: (215) 662-3389. Fax: (215) 573-2029. E-mail: Scarano{at}mail.med.upenn.edu.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. | Albright, A. V., J. Strizki, J. M. Harouse, E. Lavi, M. O'Connor, and F. González-Scarano. 1996. HIV-1 infection of cultured human adult oligodendrocytes. Virology 217:211-219[Medline]. |
| 2. | Alkahatib, G., F. Liao, E. A. Berger, J. M. Farber, and K. W. C. Peden. 1997. A new SIV co-receptor STRL33. Nature 388:238[Medline]. |
| 3. | Bagasara, O., E. Lavi, L. Bobroski, R. Tawadros, J. P. Pestaner, and R. J. Pomerantz. 1996. Cellular reservoirs of HIV-1 in the central nervous system of infected-individuals: identification by the combination of in situ PCR and immunohistochemistry. AIDS 10:573-585[Medline]. |
| 4. | Berger, E. A. 1997. HIV entry and tropism: the chemokine receptor connection. AIDS 11(Suppl. A):S3-S16. |
| 5. | Carne, C. A., R. S. Teddr, and A. Smith. 1985. Acute encephalopathy coincident with seroconversion for anti-HTLV-III. Lancet ii:1206-1208. |
| 6. | Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, J. Wu, C. R. Mackay, G. LaRosa, W. Newman, N. Gerard, C. Gerard, and J. Sodroski. 1996. The b-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135-1148[Medline]. |
| 7. |
Collman, R.,
J. W. Balliet,
S. A. Gregory,
H. Friedman,
D. L. Kolson,
N. Nathanson, and A. Srinivasan.
1992.
An infectious molecular clone of an unusual macrophage-tropic and highly cytopathic strain of human immunodeficiency virus type 1.
J. Virol.
66:7517-7521 |
| 8. |
Davis, L. E.,
B. L. Hjelle,
V. E. Miller,
D. L. Palmer,
A. L. Llewellyn,
T. L. Merlin,
S. A. Young,
R. G. Mills,
W. Wachsman, and C. A. Wiley.
1992.
Early viral brain invasion in iatrogenic human immunodeficiency virus infection.
Neurology
42:1736-1739 |
| 9. | Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[Medline]. |
| 10. | Deng, H. K., D. Unutmaz, V. N. KewalRamani, and D. R. Littman. 1997. Expression cloning of new receptors used by simian and human immunodeficiency viruses. Nature 388:296-300[Medline]. |
| 11. | Di Stefano, M., S. Wilt, F. Gray, M. Dubois-Dalcq, and F. Chiodi. 1996. HIV type 1 V3 sequences and the development of dementia during AIDS. AIDS Res. Hum. Retroviruses 12:471-476[Medline]. |
| 12. | Doranz, B. J., Z.-H. Lu, J. Rucker, T.-Y. Zhang, M. Sharron, Y.-H. Cen, Z.-X. Wang, H.-H. Guo, J.-G. Du, M. A. Accavitti, R. W. Doms, and S. C. Peiper. 1997. Two distinct CCR5 domains can mediate coreceptor usage by human immunodeficiency virus type 1. J. Virol. 71:6305-6314[Abstract]. |
| 13. | Doranz, B. J., J. Rucker, Y. Yi, R. J. Smyth, M. Samson, S. C. Peiper, M. Parmentier, R. G. Collman, and R. W. Doms. 1996. A dual-tropic primary HIV-1 isolate that uses fusin and the b-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell 85:1149-1158[Medline]. |
| 14. | Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, J. P. Moore, and W. A. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667-673[Medline]. |
| 15. |
Dreyer, E. B.,
P. K. Kaiser,
J. T. Offerman, and S. A. Lipton.
1990.
HIV coat protein neurotoxicity is prevented by calcium channel antagonists.
Science
248:364-367 |
| 16. | Endres, M. J., P. R. Clapham, M. Marsh, M. Ahuja, J. D. Turner, A. McKnight, J. F. Thomas, B. Stoebenau-Haggerty, S. Choe, P. J. Vance, T. N. C. Wells, C. A. Power, N. R. Landau, and J. A. Hoxie. 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87:745-756[Medline]. |
| 17. | Epstein, L. G., C. Kuiken, B. M. Blumberg, S. Hartman, L. R. Sharer, M. Clement, and J. Goudsmit. 1991. HIV-1 V3 domain variation in brain and spleen of children with AIDS: tissue-specific evolution within host-determined quasispecies. Virology 180:583-590[Medline]. |
| 18. |
Farzan, M.,
H. Choe,
K. Martin,
L. Marcon,
W. Hoffman,
G. Karlsson,
Y. Sun,
P. Barrett,
N. Marchand,
N. Sullivan,
N. Gerard,
C. Gerard, and J. Sodroski.
1997.
Two orphan seven-transmembrane segment receptors which are expressed in CD4-positive cells support simian immunodeficiency virus infection.
J. Exp. Med.
186:405-411 |
| 19. | Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G-protein-coupled receptor. Science 272:872-877[Abstract]. |
| 20. | Gartner, S., and M. Popovic. 1990. Macrophage tropism of HIV-1. AIDS Res. Hum. Retroviruses 6:1017-1021[Medline]. |
| 21. | Gartner, S., R. A. McDonald, E. A. Hunter, F. Bouwman, Y. Liu, and M. Popovic. 1997. Gp120 sequence variation in brain and in T-lymphocyte human immunodeficiency virus type 1 primary isolates. J. Hum. Virol. 1:3-18. [Medline] |
| 22. |
Gelbard, H. A.,
H. S. L. M. Nottet,
S. Swindells,
M. Jett,
K. A. Dzenko,
P. Genis,
R. White,
L. Wang,
Y.-B. Choi,
D. Zhang,
S. A. Lipton,
W. W. Tourtellotte,
L. G. Epstein, and H. E. Gendelman.
1994.
Platelet-activating factor: a candidate human immunodeficiency virus type 1-induced neurotoxin.
J. Virol.
68:4628-4635 |
| 23. |
Giulian, D.,
J. Yu,
X. Li,
D. Tom,
J. Li,
E. Wendt,
S.-N. Lin,
R. Schwarcz, and C. Noonan.
1996.
Study of receptor-mediated neurotoxins released by HIV-1 infected mononuclear phagocytes found in human brain.
J. Neurosci.
16:3139-3153 |
| 24. |
Glass, J. D.,
S. L. Wesselingh,
O. A. Selnes, and J. C. McArthur.
1993.
Clinical-neuropathological correlation in HIV-associated dementia.
Neurology
43:2230-2237 |
| 25. | He, J., Y. Chen, M. Farzan, H. Choe, A. Ohagen, S. Gartner, J. Busciglio, X. Yang, W. Hofmann, W. Newman, C. R. Mackay, J. Sodroski, and D. Gabuzda. 1997. CCR3 and CCR5 are co-receptors for HIV-1 infection of microglia. Nature 385:645-649[Medline]. |
| 26. |
Korber, B. T.,
K. J. Kunstman,
B. K. Patterson,
M. Furtado,
M. M. McEvilly,
R. Levy, and S. M. Wolinsky.
1994.
Genetic differences between blood and brain-derived viral sequences from human immunodeficiency virus type 1-infected patients: evidence of conserved elements in the V3 region of the envelope protein of brain-derived sequences.
J. Virol.
68:7467-7481 |
| 27. | Lavi, E., J. M. Strizki, A. M. Ulrich, W. Zhang, L. Fu, Q. Wang, M. O'Connor, J. A. Hoxie, and F. Gonzalez-Scarano. 1997. CXCR-4 (fusin), a co-receptor for the type 1 human immunodeficiency virus (HIV-1), is expressed in the human brain in a variety of cell types including microglia and neurons. Am. J. Pathol. 151:1035-1042[Abstract]. |
| 28. |
Li, Y.,
J. C. Kappes,
J. A. Conway,
R. W. Price,
G. M. Shaw, and B. H. Hahn.
1991.
Molecular characterization of human immunodeficiency virus type 1 cloned directly from uncultured human brain tissue: Identification of replication-competent and -defective viral genomes.
J. Virol.
65:3973-3985 |
| 29. |
Liao, F.,
G. Alkahatib,
K. W. C. Peden,
G. Sharma,
E. A. Berger, and J. M. Farber.
1997.
STRL33, a novel chemokine receptor-like protein, functions as a fusion cofactor for both macrophage-tropic and T cell line-tropic HIV-1.
J. Exp. Med.
185:2015-2023 |
| 30. | Lipton, S. A., N. J. Sucher, P. K. Kaiser, and E. B. Dreyer. 1991. Synergistic effects of HIV coat protein and NMDA receptor-mediated neurotoxicity. Neuron 7:111-118[Medline]. |
| 31. | Maddon, P. J., A. G. Dalgleish, J. S. McDougal, P. R. Clapham, R. A. Weiss, and R. Axel. 1986. The T4 gene encodes the AIDS virus receptor and is expressed in the immune system and the brain. Cell 47:333-348[Medline]. |
| 32. |
McArthur, J. C.,
D. R. Hoover,
H. Bacellar,
E. N. Miller,
B. A. Cohen,
J. T. Becker,
N. M. H. Graham,
J. H. McArthur,
O. A. Selnes,
L. P. Jacobson,
B. R. Visscher,
M. Concha, and A. Saah.
1993.
Dementia in AIDS patients: incidence and risk factors.
Neurology
43:2245-2251 |
| 33. |
Nussbaum, O.,
C. C. Broder, and E. A. Berger.
1994.
Fusogenic mechanisms of enveloped-virus glycoproteins analyzed by a novel recombinant vaccinia virus-based assay quantitating cell fusion-dependent reporter gene activation.
J. Virol.
68:5411-5418 |
| 34. | Rucker, J., A. L. Edinger, M. Sharron, M. Samson, B. Lee, J. F. Berson, Y. Yi, B. Margulies, R. G. Collman, B. J. Doranz, M. Parmentier, and R. W. Doms. 1997. Utilization of chemokine receptors, orphan receptors, and herpesvirus-encoded receptors by diverse human and simian immunodeficiency viruses. J. Virol. 71:8999-9007[Abstract]. |
| 35. | Sharer, L. R. 1992. Pathology of HIV-1 infection of the central nervous system. A review. J. Neuropathol. Exp. Neurol. 51:3-11[Medline]. |
| 36. | Strizki, J. M., A. V. Albright, H. Sheng, M. O'Connor, L. Perrin, and F. Gonzalez-Scarano. 1996. Infection of primary human microglia and monocyte-derived macrophages with human immunodeficiency virus type 1 isolates: evidence of differential tropism. J. Virol. 70:7564-7662. |
| 37. |
Watkins, B. A.,
H. H. Dorn,
W. B. Kelly,
R. C. Armstrong,
B. J. Potts,
F. Michaels,
C. V. Kufta, and M. Dubois-Dalq.
1990.
Specific tropism of HIV-1 for microglial cells in primary human brain cultures.
Science
249:549-552 |
| 38. | Wiley, C. A. 1995. Quantitative neuropathologic assessment of HIV-1 encephalitis. Curr. Top. Microbiol. Immunol. 202:55-61[Medline]. |
| 39. |
Wiley, C. A.,
R. D. Schrier,
J. Nelson,
P. W. Lampert, and M. B. A. Oldstone.
1986.
Cellular localization of human immunodeficiency virus infection within the brains of acquired immune deficiency syndrome patients.
Proc. Natl. Acad. Sci. USA
83:7089-7093 |
| 40. | Wong, J. K., C. C. Ignacio, F. Torriani, D. Havlir, N. J. S. Fitch, and D. D. Richman. 1997. In vivo compartmentalization of human immunodeficiency virus: evidence from the examination of pol sequences from autopsy tissues. J. Virol. 71:2059-2071[Abstract]. |
| 41. | Yong, V. W., and J. P. Antel. 1992. Culture of glial cells from human brain biopsies, p. 81-96. In S. Fedoroff, and A. Richardson (ed.), Protocols for neural cell culture. Humana Press, Totowa, N.J. |
J Virol, May 1998, p. 4243-4249, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Agrawal, L., Maxwell, C. R., Peters, P. J., Clapham, P. R., Liu, S. M., Mackay, C. R., Strayer, D. S.
(2009). Complexity in human immunodeficiency virus type 1 (HIV-1) co-receptor usage: roles of CCR3 and CCR5 in HIV-1 infection of monocyte-derived macrophages and brain microglia. J. Gen. Virol.
90: 710-722
[Abstract] [Full Text] -
Huang, Y., Erdmann, N., Peng, H., Herek, S., Davis, J. S., Luo, X., Ikezu, T., Zheng, J.
(2006). TRAIL-Mediated Apoptosis in HIV-1-Infected Macrophages Is Dependent on the Inhibition of Akt-1 Phosphorylation. J. Immunol.
177: 2304-2313
[Abstract] [Full Text] -
Pillai, S. K., Pond, S. L. K., Liu, Y., Good, B. M., Strain, M. C., Ellis, R. J., Letendre, S., Smith, D. M., Gunthard, H. F., Grant, I., Marcotte, T. D., McCutchan, J. A., Richman, D. D., Wong, J. K.
(2006). Genetic attributes of cerebrospinal fluid-derived HIV-1 env. Brain
129: 1872-1883
[Abstract] [Full Text] -
Martin-Garcia, J., Cocklin, S., Chaiken, I. M., Gonzalez-Scarano, F.
(2005). Interaction with CD4 and Antibodies to CD4-Induced Epitopes of the Envelope gp120 from a Microglial Cell-Adapted Human Immunodeficiency Virus Type 1 Isolate. J. Virol.
79: 6703-6713
[Abstract] [Full Text] -
Watson, C., Jenkinson, S., Kazmierski, W., Kenakin, T.
(2005). The CCR5 Receptor-Based Mechanism of Action of 873140, a Potent Allosteric Noncompetitive HIV Entry Inhibitor. Mol. Pharmacol.
67: 1268-1282
[Abstract] [Full Text] -
Rock, R. B., Gekker, G., Hu, S., Sheng, W. S., Cheeran, M., Lokensgard, J. R., Peterson, P. K.
(2004). Role of Microglia in Central Nervous System Infections. Clin. Microbiol. Rev.
17: 942-964
[Abstract] [Full Text] -
Kodali, R. B., Kim, W. J.H., Galaria, I. I., Miller, C., Schecter, A. D., Lira, S. A., Taubman, M. B.
(2004). CCL11 (Eotaxin) Induces CCR3-Dependent Smooth Muscle Cell Migration. Arterioscler. Thromb. Vasc. Bio.
24: 1211-1216
[Abstract] [Full Text] -
Bobardt, M. D., Salmon, P., Wang, L., Esko, J. D., Gabuzda, D., Fiala, M., Trono, D., Van der Schueren, B., David, G., Gallay, P. A.
(2004). Contribution of Proteoglycans to Human Immunodeficiency Virus Type 1 Brain Invasion. J. Virol.
78: 6567-6584
[Abstract] [Full Text] -
Ohagen, A., Devitt, A., Kunstman, K. J., Gorry, P. R., Rose, P. P., Korber, B., Taylor, J., Levy, R., Murphy, R. L., Wolinsky, S. M., Gabuzda, D.
(2003). Genetic and Functional Analysis of Full-Length Human Immunodeficiency Virus Type 1 env Genes Derived from Brain and Blood of Patients with AIDS. J. Virol.
77: 12336-12345
[Abstract] [Full Text] -
Willey, S. J., Reeves, J. D., Hudson, R., Miyake, K., Dejucq, N., Schols, D., Clercq, E. D., Bell, J., McKnight, A., Clapham, P. R.
(2003). Identification of a Subset of Human Immunodeficiency Virus Type 1 (HIV-1), HIV-2, and Simian Immunodeficiency Virus Strains Able To Exploit an Alternative Coreceptor on Untransformed Human Brain and Lymphoid Cells. J. Virol.
77: 6138-6152
[Abstract] [Full Text] -
Clapham, P. R., McKnight, A.
(2002). Cell surface receptors, virus entry and tropism of primate lentiviruses. J. Gen. Virol.
83: 1809-1829
[Abstract] [Full Text] -
Gorry, P. R., Taylor, J., Holm, G. H., Mehle, A., Morgan, T., Cayabyab, M., Farzan, M., Wang, H., Bell, J. E., Kunstman, K., Moore, J. P., Wolinsky, S. M., Gabuzda, D.
(2002). Increased CCR5 Affinity and Reduced CCR5/CD4 Dependence of a Neurovirulent Primary Human Immunodeficiency Virus Type 1 Isolate. J. Virol.
76: 6277-6292
[Abstract] [Full Text] -
Obert, L. A., Hoover, E. A.
(2002). Early Pathogenesis of Transmucosal Feline Immunodeficiency Virus Infection. J. Virol.
76: 6311-6322
[Abstract] [Full Text] -
Naif, H. M., Cunningham, A. L., Alali, M., Li, S., Nasr, N., Buhler, M. M., Schols, D., de Clercq, E., Stewart, G.
(2002). A Human Immunodeficiency Virus Type 1 Isolate from an Infected Person Homozygous for CCR5{Delta}32 Exhibits Dual Tropism by Infecting Macrophages and MT2 Cells via CXCR4. J. Virol.
76: 3114-3124
[Abstract] [Full Text] -
Gorry, P. R., Bristol, G., Zack, J. A., Ritola, K., Swanstrom, R., Birch, C. J., Bell, J. E., Bannert, N., Crawford, K., Wang, H., Schols, D., De Clercq, E., Kunstman, K., Wolinsky, S. M., Gabuzda, D.
(2001). Macrophage Tropism of Human Immunodeficiency Virus Type 1 Isolates from Brain and Lymphoid Tissues Predicts Neurotropism Independent of Coreceptor Specificity. J. Virol.
75: 10073-10089
[Abstract] [Full Text] -
Cotter, R. L., Zheng, J., Che, M., Niemann, D., Liu, Y., He, J., Thomas, E., Gendelman, H. E.
(2001). Regulation of Human Immunodeficiency Virus Type 1 Infection, {beta}-Chemokine Production, and CCR5 Expression in CD40L-Stimulated Macrophages: Immune Control of Viral Entry. J. Virol.
75: 4308-4320
[Abstract] [Full Text] -
Martín, J., LaBranche, C. C., González-Scarano, F.
(2001). Differential CD4/CCR5 Utilization, gp120 Conformation, and Neutralization Sensitivity between Envelopes from a Microglia-Adapted Human Immunodeficiency Virus Type 1 and Its Parental Isolate. J. Virol.
75: 3568-3580
[Abstract] [Full Text] -
Cayabyab, M., Hinuma, S., Farzan, M., Choe, H., Fukusumi, S., Kitada, C., Nishizawa, N., Hosoya, M., Nishimura, O., Messele, T., Pollakis, G., Goudsmit, J., Fujino, M., Sodroski, J.
(2000). Apelin, the Natural Ligand of the Orphan Seven-Transmembrane Receptor APJ, Inhibits Human Immunodeficiency Virus Type 1 Entry. J. Virol.
74: 11972-11976
[Abstract] [Full Text] -
Mori, K., Rosenzweig, M., Desrosiers, R. C.
(2000). Mechanisms for Adaptation of Simian Immunodeficiency Virus to Replication in Alveolar Macrophages. J. Virol.
74: 10852-10859
[Abstract] [Full Text] -
Dejucq, N.
(2000). HIV-1 replication in CD4+ T cell lines: the effects of adaptation on co-receptor use, tropism, and accessory gene function. J. Leukoc. Biol.
68: 331-337
[Abstract] [Full Text] -
Persidsky, Y., Zheng, J., Miller, D., Gendelman, H. E.
(2000). Mononuclear phagocytes mediate blood-brain barrier compromise and neuronal injury during HIV-1-associated dementia. J. Leukoc. Biol.
68: 413-422
[Abstract] [Full Text] -
Shieh, J. T. C., Martín, J., Baltuch, G., Malim, M. H., González-Scarano, F.
(2000). Determinants of Syncytium Formation in Microglia by Human Immunodeficiency Virus Type 1: Role of the V1/V2 Domains. J. Virol.
74: 693-701
[Abstract] [Full Text] -
Zheng, J., Ghorpade, A., Niemann, D., Cotter, R. L., Thylin, M. R., Epstein, L., Swartz, J. M., Shepard, R. B., Liu, X., Nukuna, A., Gendelman, H. E.
(1999). Lymphotropic Virions Affect Chemokine Receptor-Mediated Neural Signaling and Apoptosis: Implications for Human Immunodeficiency Virus Type 1-Associated Dementia. J. Virol.
73: 8256-8267
[Abstract] [Full Text] -
Dejucq, N., Simmons, G., Clapham, P. R.
(1999). Expanded Tropism of Primary Human Immunodeficiency Virus Type 1 R5 Strains to CD4+ T-Cell Lines Determined by the Capacity To Exploit Low Concentrations of CCR5. J. Virol.
73: 7842-7847
[Abstract] [Full Text] -
Singh, A., Besson, G., Mobasher, A., Collman, R. G.
(1999). Patterns of Chemokine Receptor Fusion Cofactor Utilization by Human Immunodeficiency Virus Type 1 Variants from the Lungs and Blood. J. Virol.
73: 6680-6690
[Abstract] [Full Text] -
Worgall, S., Connor, R., Kaner, R. J., Fenamore, E., Sheridan, K., Singh, R., Crystal, R. G.
(1999). Expression and Use of Human Immunodeficiency Virus Type 1 Coreceptors by Human Alveolar Macrophages. J. Virol.
73: 5865-5874
[Abstract] [Full Text] -
Howard, O. M. Z., Shirakawa, A.-K., Turpin, J. A., Maynard, A., Tobin, G. J., Carrington, M., Oppenheim, J. J., Dean, M.
(1999). Naturally Occurring CCR5 Extracellular and Transmembrane Domain Variants Affect HIV-1 Co-receptor and Ligand Binding Function. J. Biol. Chem.
274: 16228-16234
[Abstract] [Full Text] -
Zhang, Y.-j., Moore, J. P.
(1999). Will Multiple Coreceptors Need To Be Targeted by Inhibitors of Human Immunodeficiency Virus Type 1 Entry?. J. Virol.
73: 3443-3448
[Abstract] [Full Text] -
Chan, S. Y., Speck, R. F., Power, C., Gaffen, S. L., Chesebro, B., Goldsmith, M. A.
(1999). V3 Recombinants Indicate a Central Role for CCR5 as a Coreceptor in Tissue Infection by Human Immunodeficiency Virus Type 1. J. Virol.
73: 2350-2358
[Abstract] [Full Text] -
Ohagen, A., Ghosh, S., He, J., Huang, K., Chen, Y., Yuan, M., Osathanondh, R., Gartner, S., Shi, B., Shaw, G., Gabuzda, D.
(1999). Apoptosis Induced by Infection of Primary Brain Cultures with Diverse Human Immunodeficiency Virus Type 1 Isolates: Evidence for a Role of the Envelope. J. Virol.
73: 897-906
[Abstract] [Full Text] -
Albright, A. V., Shieh, J. T. C., Itoh, T., Lee, B., Pleasure, D., O'Connor, M. J., Doms, R. W., Gonzalez-Scarano, F.
(1999). Microglia Express CCR5, CXCR4, and CCR3, but of These, CCR5 Is the Principal Coreceptor for Human Immunodeficiency Virus Type 1 Dementia Isolates. J. Virol.
73: 205-213
[Abstract] [Full Text] -
Zhang, Y.-j., Dragic, T., Cao, Y., Kostrikis, L., Kwon, D. S., Littman, D. R., KewalRamani, V. N., Moore, J. P.
(1998). Use of Coreceptors Other Than CCR5 by Non-Syncytium-Inducing Adult and Pediatric Isolates of Human Immunodeficiency Virus Type 1 Is Rare In Vitro. J. Virol.
72: 9337-9344
[Abstract] [Full Text] -
Edinger, A. L., Hoffman, T. L., Sharron, M., Lee, B., Yi, Y., Choe, W., Kolson, D. L., Mitrovic, B., Zhou, Y., Faulds, D., Collman, R. G., Hesselgesser, J., Horuk, R., Doms, R. W.
(1998). An Orphan Seven-Transmembrane Domain Receptor Expressed Widely in the Brain Functions as a Coreceptor for Human Immunodeficiency Virus Type 1 and Simian Immunodeficiency Virus. J. Virol.
72: 7934-7940
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»