This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yasuda, J.
Right arrow Articles by Hunter, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yasuda, J.
Right arrow Articles by Hunter, E.

 Previous Article  |  Next Article 

J Virol, May 1998, p. 4095-4103, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

A Proline-Rich Motif (PPPY) in the Gag Polyprotein of Mason-Pfizer Monkey Virus Plays a Maturation-Independent Role in Virion Release

Jiro Yasudadagger and Eric Hunter*

Department of Microbiology, University of Alabama at Birmingham, Birmingham, Alabama 35294

Received 3 November 1997/Accepted 10 February 1998

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Virus assembly represents one of the last steps in the retrovirus life cycle. During this process, Gag polyproteins assemble at specific sites within the cell to form viral capsids and induce membrane extrusion (viral budding) either as assembly progresses (type C virus) or following formation of a complete capsid (type B and type D viruses). Finally, the membrane must undergo a fusion event to pinch off the particle in order to release a complete enveloped virion. Structural elements within the MA region of the Gag polyprotein define the route taken to the plasma membrane and direct the process of virus budding. Results presented here suggest that a distinct region of Gag is necessary for virus release. The pp24 and pp16 proteins of the type D retrovirus Mason-Pfizer monkey virus (M-PMV) are phosphoproteins that are encoded in the gag gene of the virus. The pp16 protein is a C-terminally located cleavage product of pp24 and contains a proline-rich motif (PPPY) that is conserved among the Gag proteins of a wide variety of retroviruses. By performing a functional analysis of this coding region with deletion mutants, we have shown that the pp16 protein is dispensable for capsid assembly but essential for virion release. Moreover, additional experiments indicated that the virus release function of pp16 was abolished by the deletion of only the PPPY motif and could be restored when this motif alone was reinserted into a Gag polyprotein lacking the entire pp16 domain. Single-amino-acid substitutions for any of the residues within this motif confer a similar virion release-defective phenotype. It is unlikely that the function of the proline-rich motif is simply to inhibit premature activation of protease, since the PPPY deletion blocked virion release in the context of a protease-defective provirus. These results demonstrate that in type D retroviruses a PPPY motif plays a key role in a late stage of virus budding that is independent of and occurs prior to virion maturation.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

In all retroviruses, the gag gene products are translated from unspliced, genome-length mRNA as polyprotein precursors. While the size and sequence content of the precursors vary among the different retrovirus families, all retroviral Gag precursors contain at least three domains: the matrix domain (MA), the major capsid domain (CA), and the nucleocapsid domain (NC) (19). Several studies in a number of systems have shown that expression of the gag gene alone results in the efficient assembly and release of membrane-enveloped virions (10, 13, 15, 20, 26, 32, 39). Thus, the product of this gene has the necessary structural information to mediate intracellular transport, to direct assembly of the capsid shell, and to catalyze the process of membrane extrusion known as budding. In some retroviruses, the regions and modifications of Gag polyproteins required for capsid assembly, intracellular transport, and membrane association have been identified. However, little is known about the viral and cellular requirements for retrovirus budding and release.

Mason-Pfizer monkey virus (M-PMV) represents the prototypical type D retrovirus, characterized by the assembly of immature capsids or procapsids within the cytoplasm of the infected cell (37). Although a full complement of structural and enzymatic proteins together with the viral genomic RNA are required for infectivity, most are dispensable for viral assembly. The Gag polyprotein (Pr78) can form procapsids in the absence of other viral products in both mammalian and insect cells (30, 32). M-PMV procapsid assembly has also been observed in prokaryotic cells and following in vitro translation of Gag polyproteins (18, 28). Mutagenesis studies have shown that portions of the MA and CA domains are indispensable for virion assembly (24, 33). Moreover, in M-PMV, a novel Gag polyprotein domain, p12, is also important for efficient assembly of capsids (32).

Following assembly, the immature capsids located within the cytoplasm are transported to the cell membrane. Both myristylation of MA and specific amino acid sequences within this domain of Gag play crucial roles in mediating the intracytoplasmic transport of preassembled procapsids to their normal site of budding and release at the plasma membrane (24, 27). The separately processed and exported Env protein complex is incorporated into the virion envelope via an interaction with a domain of the Gag polyprotein. It seems likely that a specific association between MA and some portion of the transmembrane protein directs incorporation of the Env complex into virions (5, 6, 25).

Newly budded-off virions undergo a maturation process to acquire infectivity. During the process of virus maturation, the Gag precursors are cleaved by the viral proteinase to yield the individual virion proteins. As in other replication-competent retroviruses, these include the matrix protein (p10 [MA]), the major viral capsid protein (p27 [CA]), and the nucleocapsid protein (p14 [NC]). In addition, the type D retrovirus Gag polyprotein encodes p4, a short C-terminal protein of unknown function; p12, the Gag domain involved in procapsid assembly; and pp24, a phosphoprotein which in M-PMV is further cleaved to yield a second phosphoprotein (pp16). These mature gag gene products are arranged in the order NH2-p10- pp24/16-p12-p27-p14-p4-COOH on the Gag precursor Pr78 (4). Similarly, the Gag-Pro and Gag-Pro-Pol precursors are cleaved to yield the enzymatic components of the virion, thus preparing the system for reverse transcription when it encounters the proper environment.

The function of the pp24 and pp16 proteins (pp24/16) in the process of viral replication has not been defined. The pp16 protein is a C-terminal-cleavage product of pp24 and contains a proline-rich motif, PPPY, that is conserved among a wide variety of retroviral Gag proteins (22, 38). In this study, we examined the role of pp24/16 in capsid assembly and postassembly steps as well as the importance of the PPPY motif in the function of this Gag precursor domain. The results presented here show that the PPPY motif is dispensable for most aspects of M-PMV assembly but plays a critical role in the final release step of virus budding.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Oligonucleotide-directed mutagenesis. Mutagenesis was carried out with the pSelect system (Promega), as described previously (11). The NarI-SacI fragment was excised from the wild-type (WT) M-PMV expression vector pSHRM15 (26) and subcloned into the bacteriophage vector pSELECT-1. Single-stranded recombinant DNA was used as a substrate for mutagenesis. The sequences of the mutagenic oligonucleotides used are as follows: dpp24, TTGAGCTCCTCTTTTGGATTAACAACCGCCATTACTTGTGGGTTAA; dpp16, TTGAGCTCCTCTTTTGGATTAACAACCGCCAGAACTGGGAATCTTT; dN24, CTTTACTAGTTTGTGCTGTTAACATTACTTGTGGGTTAAC; d3PY, GGAGTAGCTTTATTACGGGTTAGGAAGG; d16/IPY, GGATTAACAACCGCGTAAGGAGGTGGCAGAACTGGGAATC; P1G, ATTGTAAGGAGGTCCACGGGTTAGGAAG; P2G, TTTATTGTAAGGACCTGGACGGGTTAGG; P3G, AGCTTTATTGTAACCAGGTGGACGGGTT; and Y4G, AGTAGCTTTATTGCCAGGAGGTGGACGG.

After mutagenesis, each NarI-SacI fragment was excised from the replicative form of the mutant phage and substituted for the WT fragment in pSHRM15. To make d3PY/D26N, the NarI-SacI fragment of d3PY was used to replace that of the D26N provirus, which carries a protease-inactivating mutation (a substitution of asparagine for aspartic acid at position 26) (31). The presence of the mutations was confirmed by dideoxy sequencing (29) of the double-stranded proviral vector DNA.

Cells and transfection. COS-1 and HOS cells were maintained at 37°C in a 5% CO2 incubator in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Each mutant DNA was transfected into COS-1 cells by the calcium phosphate method as described by Chen and Okayama (7). For deletion mutants dpp24, dpp16, and dN24, stably transfected HOS cell lines were also established as described previously (25).

Radiolabeling and immunoprecipitation of viral proteins. COS-1 and HOS cells expressing the WT or, individually, each mutant genome were pulse-labeled for 30 min with [3H]leucine (at 48 h after transfection for COS cells) and chased for various periods of time in complete medium. The cells were lysed, and then the lysate was subjected to immunoprecipitation as described previously (4). The rabbit anti-Pr78gag antiserum used in these experiments was raised against bacterially expressed M-PMV Pr78 (28). Radiolabeled virus particles, which were released from the chased cells into the culture medium, were pelleted by centrifugation for 15 min at 80,000 rpm in a Beckman TLA100.3 rotor at 4°C. The pellet was lysed, and then the lysate was subjected to immunoprecipitation with goat anti-M-PMV antiserum (25). Immunoprecipitated proteins were separated on a 12% resolving gel by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Infectivity assays. The infectivity of the mutant virions was determined by measuring the spread of reverse transcriptase (RT)-containing virus through the inoculated HOS cell culture at various times postinfection. Culture fluids were harvested from COS-1 cells that had been transfected 48 h previously with either WT or mutant DNA. After clarification by centrifugation, the level of RT activity in the medium was measured and an equivalent amount of RT-containing medium was used to infect HOS cells in the presence of 4.0 µg of Polybrene (Sigma) per ml. Culture fluids were harvested on days 3, 6, 9, and 12 postinfection and assayed for RT activity. The RT assay was carried out as described previously (6) except that [35S]TTP was used instead of [3H]TTP. The incorporation of radioactive [35S]TTP into the DNA synthesized in the RT reaction was measured with a radioanalytic imaging system (AMBIS Systems Inc.).

Detection of procapsid assembly. To analyze procapsid formation in mutant-expressing cells, Gag polyproteins were fractionated into free and capsid-associated forms as described previously (25). Each fraction was immunoprecipitated with rabbit anti-Pr78gag antiserum and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis.

Electron microscopy. COS-1 cells transfected with each mutant, individually, were fixed for 1 h at room temperature with 1% glutaraldehyde at 48 h after transfection and then postfixed with 1% osmium tetroxide. The samples were dehydrated and embedded in Epon. Ultrathin sections were stained with uranyl acetate and lead citrate as described previously (32). All samples were examined under a Hitachi H7000 electron microscope.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Analysis of pp24/16 deletion mutants in pulse-chase experiments. (i) Transient expression in COS-1 cells. To determine the function of pp24/16 in the process of viral assembly, we initially constructed three deletion mutants, in which the entire pp24 coding region (dpp24), the pp16 coding region (dpp16), or the N-terminal half of pp24 (dN24) was removed precisely at the cleavage site junction (Fig. 1). Following the introduction of the mutations into pSHRM15, these mutants were analyzed for their ability to express stable Gag precursor proteins and to assemble and release infectious virions. After transfection of each mutant proviral DNA into COS-1 cells, pulse-chase experiments were carried out.


View larger version (38K):
[in this window]
[in a new window]
  		FIG. 1.   Representation of the pp24/16 deletion and the PPPY mutants. Dashed lines represent deleted regions. Filled boxes indicate the location of the PPPY motif. For the point mutants, substituted amino acids are underlined.

In COS-1 cells expressing either WT or mutant genomes, similar levels of Gag precursor were synthesized, with the exception of dN24. These precursor molecules were processed into mature proteins at different rates, as evidenced by the appearance of p27 (CA) (Fig. 2A). The CA protein was detected after a 2-h chase in the case of the WT and dpp24 but only after a 4-h chase in the case of dpp16. In the case of dN24, a faint band of p27 could be seen at the end of the pulse-labeling period. For dpp16, a significant amount of mutant Pr78gag remained even after an 8-h chase, while the dN24 precursor was rapidly turned over during the 2- to 4-h chase period.


View larger version (90K):
[in this window]
[in a new window]
  		FIG. 2.   Pulse-chase analysis of pp24/16 deletion mutants in COS-1 cells. COS-1 cells were transfected with either WT (pSHRM15) or mutant DNAs and pulse-labeled with [3H]leucine for 30 min. After a 2-, 4-, or 8-h chase, virus-specific cell-associated (A) or virion-associated (B) proteins were immunoprecipitated with anti-Pr78 (Gag precursor) or anti-M-PMV antiserum, respectively. (A) In cells expressing either WT or mutant genomes, the Gag precursor polyproteins (Pr78) were labeled in the pulse (0 h) and the processed product (p27) appeared during chase periods. (B) Extracellular virions were pelleted from the culture fluids of chased cells. The positions of p27, the major capsid protein, and gp70 and gp20, the envelope glycoproteins, are shown.

Extracellular virions were pelleted from the culture fluids of the pulse-chased cells. Virion-associated proteins were found only in WT- and dN24-expressing cell supernatants (Fig. 2B). Although the dN24 supernatant contained significantly less virion-associated protein than that seen with the WT, a characteristic pattern of mature viral proteins (including gp70 and gp20) was observed. The release of progeny virions by the WT- or dN24 mutant-expressing cells and a lack of particle release from dpp24- or dpp16-expressing cells were confirmed by quantitating RT activity in the culture supernatants from cells expressing the WT and mutant genomes (data not shown).

(ii) Stable expression in HOS cells. Since the COS-1 expression system results in high levels of viral protein synthesis, we established stably transfected populations of HOS cells expressing WT and mutant genomes in order to more accurately mimic the conditions of virus infection. We have shown previously with p12 domain mutants that different phenotypes can be observed depending on the level of expression (32). As in the COS-1 cell experiments, Gag precursor stability, procapsid assembly, and virion release were determined following the establishment of stably transfected HOS cells. In cells expressing either WT or mutant genomes, similar levels of Gag precursor were synthesized (Fig. 3A). In the case of the WT-, dpp24-, or dN24-expressing cells, the precursors were then processed into mature proteins, as evidenced by the appearance of p27 (CA) in the cell lysates. The CA protein was detected after the 30-min pulse-labeling in dN24-expressing cells and after a 2-h chase in cells expressing the WT or dpp24. In the case of cells expressing dpp16, a very weak band of p27 was observed only after a 4- to 8-h chase. Extracellular virions were released only from the WT- or dN24 mutant-expressing cells (Fig. 3B). These results are essentially identical to those observed with COS-1 cells, suggesting that there is no significant difference in the phenotypes of mutants in the two different expression systems. Therefore, transient expression in COS-1 cells was utilized for the analysis of the additional mutants described below.


View larger version (84K):
[in this window]
[in a new window]
  		FIG. 3.   Pulse-chase immunoprecipitation of HOS cells stably transfected with either WT or pp24/16 deletion mutant DNAs. Viral proteins from the cell lysates (A) and media (B) were analyzed as described in the legend to Fig. 2. Viral proteins were immunoprecipitated with anti-M-PMV antiserum. The migration positions of the WT viral proteins are indicated on the left.

Role of the proline-rich motif (PPPY). The pp16 protein contains a proline-rich motif, PPPY, that is found in the Gag proteins of a variety of retroviruses. To directly analyze the role of this motif, we prepared two mutants; in one, d3PY, a four-codon deletion that removed the PPPY motif was constructed, and in the second, d16/IPY, we engineered a four-codon insertion that reintroduced the PPPY motif into the pp16-deleted genome (dpp16) (Fig. 1). When the mutant DNAs were transfected into COS-1 cells, both mutant Gag precursors were expressed at similar levels (Fig. 4A). In both the WT- and d16/IPY-expressing cells, p27 could be detected after a 2-h chase, indicating that normal processing of the Gag precursor was restored in the d16/IPY mutant. In contrast, in d3PY-expressing cells, the mutant Pr78 was stable and very little p27 could be detected even after an 8-h chase. Moreover, the release of particles into the medium was abolished by the deletion of the PPPY motif in this mutant (Fig. 4B). On the other hand, virus release was restored when the PPPY sequence was added back to the genomic construct from which pp16 had been deleted (d16/IPY), and the d16/IPY mutant virions were released from transfected cells at a rate similar to that of the WT virions. Additional experiments indicated that the mutant and WT virions contained similar complements of viral structural proteins, including glycoprotein (data not shown).


View larger version (61K):
[in this window]
[in a new window]
  		FIG. 4.   Pulse-chase analysis of PPPY mutants in COS-1 cells. Viral proteins from the cell lysates (A) and media (B) were analyzed as described in the legend to Fig. 2, except anti-Pr78 antiserum was used for immunoprecipitation in both cases. The migration positions of the WT viral proteins are indicated on the left.

Effect of single amino acid substitutions within the PPPY motif. To determine which amino acid(s) of the PPPY sequence is critical for its function, we constructed proviruses with point mutations in this region and performed a similar analysis of virus assembly and release. Each residue within the PPPY motif was individually replaced by glycine (Fig. 1). As shown in Fig. 5A, all of the point mutants showed similar phenotypes of viral polyprotein synthesis and processing. These mutant Pr78gag precursors were stable in cells even after an 8-h chase, and p27 was only weakly visible after the longest chase. These results are similar to those observed with the d3PY mutant (Fig. 5A). While low levels of virions (approximately 3 to 5% of WT levels) were released from each of the proline substitution mutants (and d3PY), no evidence of virus particles could be found in the culture medium of cells expressing the tyrosine mutant (Fig. 5B). These results indicate that each of the residues within the PPPY motif is critical for its function and that the tyrosine residue plays a particularly important role.


View larger version (70K):
[in this window]
[in a new window]
  		FIG. 5.   Pulse-chase analysis of PPPY point mutants in COS-1 cells. Viral proteins from the cell lysates (A) and media (B) were analyzed as described in the legend to Fig. 2. The migration positions of the WT viral proteins are indicated on the left.

Infectivity of mutant virions released from COS-1 cells. To determine whether the mutant virions released from COS-1 cells were infectious, virus-containing culture medium was harvested from COS-1 cells transfected with either WT, dN24, or d16/IPY DNAs, normalized for RT activity, and used to infect HOS cells. Culture medium from these infected HOS cells was harvested on days 4, 7, 10, and 13 postinfection and assayed for RT activity. As shown in Fig. 6, WT virus-infected cells showed a rapid increase in the release of RT activity, consistent with the spread of the virus through the culture. In contrast, neither dN24- nor d16/IPY-infected cells showed detectable RT activity over the 13-day period, demonstrating that these mutant viruses are noninfectious. Mutant viruses from stably transfected HOS cells were also noninfectious (data not shown).


View larger version (11K):
[in this window]
[in a new window]
  		FIG. 6.   Infectivity of mutant virions. Virus-containing culture medium from COS-1 cells transfected with either WT, dN24, or d16/IPY genomes was harvested and used to infect HOS cells. Infectivity was monitored as RT released over time following infection. Only WT showed any release of RT activity. In contrast, dN24 and d16/IPY showed no RT activity above that detected with the uninfected cells (Mock), demonstrating that these mutants are noninfectious.

Procapsid formation in mutant-expressing cells. The type D retroviruses provide a unique advantage in studies of morphogenesis, since it is possible to determine if replication-defective mutants can assemble immature capsids in the cytoplasm with normal kinetics; the precursors that are soluble immediately after synthesis assemble into pelletable procapsids. We therefore examined capsid formation in COS-1 cells transfected with the mutant DNAs. Cells were pulse-labeled with [3H]leucine and then chased for 30 min. Following treatment with Triton X-100 buffer, cell lysates were centrifuged to precipitate the assembled capsids. Radiolabeled Gag precursors in the soluble and pellet fractions were immunoprecipitated with anti-Pr78 antiserum. As shown in Fig. 7, WT and mutant Gag precursors were found in both the soluble and the pelletable fractions of the cells, indicating that each of the mutant Gag precursors is assembled into immature capsids with an efficiency similar to that of the WT. In contrast, an analysis of the M-PMV type C morphogenesis mutant R55W, which assembles capsids predominantly at the plasma membrane and not in the cytoplasm (19), showed that the bulk of the Pr78gag remained soluble in this type of experiment (Fig. 7, lower panel). To confirm that the pelleted material was indeed assembled procapsids, the same samples were also analyzed by sucrose density gradient centrifugation. All of the pelletable mutant precursors were found at a density of 1.2 g/ml, consistent with the formation of WT-like capsids (28).


View larger version (78K):
[in this window]
[in a new window]
  		FIG. 7.   Procapsid formation in WT- and mutant-transfected cells. COS-1 cells transfected with either WT or mutant DNA were pulse-labeled with [3H]leucine for 30 min and then chased in complete medium for 30 min. The cells were lysed, and assembled capsids were pelleted by centrifugation. Radiolabeled Gag polyproteins in the soluble (S) and pellet (P) fractions were immunoprecipitated with anti-Pr78 antiserum. WT Gag and all the mutant Gag precursors except R55W can be detected in both the soluble and pellet fractions.

Morphogenesis of the PPPY mutants. The data described above indicated that PPPY mutants formed procapsids but could not release virions. Nevertheless, it was not clear which step (capsid transport, membrane binding of capsids, or budding) was blocked, leading to the deficiency in virus production. To distinguish among these three possibilities, the morphogenesis of the PPPY mutants in COS-1 cells expressing each mutant genome, individually, was determined by electron microscopy (Fig. 8). Consistent with our previous observations, intracytoplasmic immature capsids were observed in cells expressing the WT and each of the mutant genomes (data not shown). However, extracellular mature virions with an electron-dense core were found only in cells expressing the WT or the d16/IPY mutant genome, each of which encodes an intact PPPY sequence (Fig. 8B and E). In contrast, micrographs of cells expressing the d3PY or P2G mutant genome showed no extracellular virions. In these mutants, virion release appeared to be arrested at a late stage in the budding of an immature capsid (Fig. 8C, D, F, and G). This observation indicated that the deletion of, as well as point mutations within, the PPPY motif prohibited the production of progeny viruses at this late budding step.


View larger version (90K):
[in this window]
[in a new window]
  		FIG. 8.   Electron micrographs of COS-1 cells expressing WT and mutant viral genomes. Thin sections of COS-1 cells which had been transfected with WT or mutant DNA were examined under the electron microscope to determine the stage(s) at which mutant virus morphogenesis was blocked. (A and B) WT; (C and D) mutant d3PY; (E) d16/IPY; (F and G) P2G. Bar (panel G), 100 nm.

Analysis of PPPY motif mutants in the context of a defective viral protease. Since it was possible that the PPPY motif acted as a pseudo-cleavage site that served to inhibit premature activation of the viral protease, we investigated the phenotype of a mutant genome that contained both the PPPY deletion and a mutation, D26N, that inactivates the viral aspartyl protease (31). At 48 h posttransfection of COS-1 cells, pulse-labeling showed that the levels of Gag precursor expression among the constructs (WT, D26N, and d3PY/D26N) were similar (Fig. 9A, 0-h chases). In the case of cells expressing the WT construct, p27 (CA) could be seen after a 2-h chase and the level of Pr78gag decreased during the 8-h chase. In contrast, no mature cleavage products were observed in cells expressing either D26N or the double mutant. While the level of Pr78gag declined in the protease mutant (Fig. 9A, D26N), no loss of precursor was observed in cells expressing the double mutant (Fig. 9A, d3PY/D26N). Virions containing a full complement of mature viral proteins were detected in the culture medium after a 2-h chase for the WT construct (Fig. 9B, WT). Similarly, for D26N-expressing cells, significant levels of virions were detected at 2 h and continued to accumulate during the 8-h chase. In contrast to the WT virions, only precursor Gag, Gag-Pro, and Gag-Pro-Pol polyproteins were associated with these pelleted particles. Moreover, as we have described previously, the gp22 (TM) protein remained unprocessed in these protease-deficient virions (Fig. 9B, D26N) (6). A significantly reduced level of virion release was observed for the d3PY/D26N double mutant (Fig. 9B, d3PY/D26N) despite the fact that higher levels of Gag precursor could be seen in the cells following the pulse-labeling (Fig. 9A). Quantitation of the Pr78gag and Pr95gag-pro bands by densitometry indicated that virus particle release was reduced 30-fold in the presence of the d3PY mutation. This is similar to the defect observed in some experiments for the d3PY mutation in the context of the active protease (Fig. 5B, d3PY, 8-h chase).


View larger version (45K):
[in this window]
[in a new window]
  		FIG. 9.   Pulse-chase analysis of a viral-protease-defective PPPY mutant in COS-1 cells. Viral proteins from the cell lysates (A) and media (B) were analyzed as described in the legend to Fig. 2. The migration positions of the WT viral proteins are indicated on the left.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have described here the results of experiments showing that a PPPY sequence within the M-PMV Gag polyprotein plays a critical role in a late step in M-PMV virion budding and release. Initial experiments showed that deletion of either the pp24 or pp16 Gag domain of M-PMV blocked the release of virus particles into the culture medium under conditions of transient high-level expression in COS cells and following stable transfection of HOS cells. In both cases, assembly of intracytoplasmic procapsids appeared to occur with kinetics similar to that of the WT virus. This release-defective phenotype could be reproduced following deletion of just the PPPY motif located within pp16. Most surprisingly, the defect in the dpp16 mutant could be repaired by insertion of the PPPY tetrapeptide alone at the site of the deletion. In this latter mutant, virus particles were released with kinetics similar to that of the WT. The importance of each of the residues within the motif was demonstrated by point mutations, each of which showed a release-defective phenotype similar to that of the d3PY deletion mutant.

The proline-rich (PPPY) motif is conserved among most retroviruses except lentiviruses and is generally located between the MA and CA domains of the Gag polyprotein. In Moloney murine leukemia virus and simian sarcoma virus, the tyrosine at the fourth position is replaced by tryptophan. However, the chemical similarity of these two aromatic amino acids might allow the tryptophan and tyrosine residues to be functionally exchangeable. In the human immunodeficiency virus, a small proline-rich protein, p6, situated at the C terminus of the Gag polyprotein plays a similar role in facilitating virus budding and release. While p6 lacks a PPPY motif, it contains a proline-threonine-alanine-proline (PTAP) sequence that appears to be the functional element (14, 17). Similarly, in equine infectious anemia virus, the C-terminal p9 Gag protein has an analogous L domain function, but in this case a tyrosine-proline-aspartic acid-leucine (YPDL) motif appears to be important (23). The Rous sarcoma virus (RSV) p2b and lentivirus proteins are functionally interchangeable and can act in a positionally independent manner to facilitate budding and release (21, 23). These observations suggest that diverse retroviruses have evolved similar mechanisms of mediating a late stage of the budding process that allow virus release from the cell and that in each case only a small region of the Gag polyprotein is essential for this process. In M-PMV, as in other nonlentiviruses, the PPPY motif is located between MA and CA, within a C-terminally located cleavage product of pp24, the viral phosphoprotein pp16. The degree of homology between the pp24 regions of M-PMV and the other type D viruses is low, and the pp16 region is more divergent among type D retroviruses than are other Gag regions (36). This might suggest that the proline-tyrosine motif is the only important functional domain in this region. Enveloped mutant virus particles released from d16/IPY-transfected cells contained normal levels of the pol gene product, since these virions showed RT activity levels similar to that observed in the WT (data not shown). Moreover, the virions contained a full complement of mature proteins, and electron micrographs indicated that these virions had a dense core, which is consistent with virion maturation. Nevertheless, the d16/IPY virions were completely noninfectious. These results are consistent with pp16 sequences other than PPPY having a functional role in the M-PMV replication cycle.

The pp24 and pp16 proteins are major phosphoproteins of M-PMV, and in many cases, phosphorylation plays a key role in the biological activity of proteins. Indeed, some protein tyrosine kinases recognize proline-rich sequences and catalyze the phosphorylation of tyrosine residues. Thus, one might suspect that phosphorylation of the PPPY motif might be important in particle release. However, Henderson et al. reported previously that the pp16 protein contains phosphoserine but no detectable phosphothreonine or phosphotyrosine (16). Therefore, since the tyrosine within the PPPY is not phosphorylated within virions, it seems unlikely that protein phosphorylation is important for the function of the PPPY motif in the late budding step.

In previous studies, while it was possible to show a defect in virus release, it was more difficult to determine whether mutations in p2b or p6 affected the efficiency of capsid assembly. Because M-PMV assembles capsids within the cytoplasm, it was possible to dissect out the role of the proline-rich motif from this process. In cells expressing mutant genomes, all of the mutant Gag precursors were synthesized at normal levels and were found to assemble into procapsids with kinetics similar to that of the WT. The mutant Gag precursors containing deleted or altered PPPY sequences (dpp16, d3PY, P1G, P2G, P3G, and Y4G) were very stable in cells and showed delayed processing, consistent with our previous observation that processing of M-PMV precursors occurs only very late in the budding process (24). In contrast, in dN24-transfected cells, the mutant Pr78gag was unstable and a fraction of the molecules appeared to be rapidly processed into mature capsid proteins, since mature p27 could be found within cells after the 30-min pulse (Fig. 3). The remaining precursor or cleaved products appear to be degraded, since only a small amount of p27 (CA) was detected in the supernatants of cells following a chase and none accumulated within the cells. Thus, the N-terminal region of pp24 may play a role in precursor stability and maintenance of an inactive viral protease. Previously, it was reported that the C-terminal portion of the RSV p2b protein including the PPPY motif affected the processing of the Gag precursor polyprotein, perhaps by preventing the intracellular activation of the virus-encoded protease (3, 38). In the case of the human immunodeficiency virus, the budding-release defect observed with p6 PTAP domain mutants can be suppressed by inactivation of the viral proteinase, suggesting that at least one function of this region in the lentiviruses might be to prevent premature activation of the proteinase prior to assembly of the protein shell and subsequent membrane extrusion. In contrast, in RSV, inactivation of the viral proteinase did not reverse the late defect of p2b mutations, and we have shown here that protease mutants of M-PMV cannot suppress, to any significant extent, the late defect in budding-release observed with the deletion of the PPPY motif within pp16. Thus, while this motif has elements of a retroviral aspartyl proteinase cleavage site, it clearly does not function merely through suppression of viral proteinase activation.

Wills et al. (38) first reported that the RSV p2b protein, which contains a PPPY motif and is encoded in the gag gene of RSV, is needed late in the budding process of this avian virus, and in initial experiments they showed that mutation of the tyrosine residue to either alanine or glycine reduced the efficiency of virus budding from the cell. This region has been defined as the late (L) assembly domain of the RSV Gag polyprotein (21). More recently, these authors have shown, as we show here for M-PMV, that mutation of individual residues within the PPPY motif results in a reduced efficiency of virus release from the cell and that the motif can function independently of its position within the Gag precursor. The PPPY motif found in the Gag precursors of many retroviruses is also found in the proline-rich peptide motif that binds to the recently described WW domain, a sequence of 38 amino acids containing two widely spaced tryptophans involved in protein-protein interactions, first identified in the Yes oncogene-associated protein Yap but since identified in a variety of regulatory and cytoskeletal proteins (1, 2, 9, 34). By performing a functional screen of a cDNA expression library, these investigators found two sequence-divergent Yap-binding proteins (WBP-1 and WBP-2) that contained a common PPPPY element (35). Alanine-scanning mutagenesis demonstrated that the core sequence that enabled binding to the WW domain was XPPXY (8, 9), consistent with the conserved PPPY late domain found in several retroviruses. Thus, it is conceivable that the late function required for completion of virus budding involves an interaction between Gag precursors and a WW domain-containing protein (12, 40). It should be noted, however, that in the case of the M-PMV motif, replacement of the third proline with glycine (to yield PPGY) resulted in a phenotype as defective as that resulting from substitutions within the prolines that Chen et al. (8, 9) showed were critical for WW domain binding. Moreover, while it is possible to envisage how an interaction between plasma membrane-associated WW domain proteins and Gag precursors might operate late in the assembly-budding process of the type C morphogenic viruses, it is not clear how this might occur in the context of an assembled M-PMV procapsid, in which the PPPY motif would be expected to be internally located. This is particularly true when one considers the d16/IPY mutant, which is released from cells with WT efficiency and yet lacks almost the entire pp16 domain. How these late domains can function independently of their position or sequence context within Gag remains an intriguing question.

    ACKNOWLEDGMENTS

We acknowledge Susan Dubay, Geraldine Long, and Tshana Thomas for excellent technical assistance. We also thank Eugene Arms of the UAB Comprehensive Cancer Center Electron Microscopy Core for excellent assistance with electron microscopy and M. Sakalian and R. Weldon for thoughtful reviews of the manuscript.

This work was supported by grant CA-27834 from the National Cancer Institute. J.Y. was supported by research fellowships from the Uehara Memorial Foundation and the Japan Society for the Promotion of Science.

    FOOTNOTES

* Corresponding author. Mailing address: Department of Microbiology, University of Alabama at Birmingham, 256 Bevill Biomedical Research Building, 845 19th St. South, Birmingham, AL 35294-2170. Phone: (205) 934-2437. Fax: (205) 934-1640. E-mail: ehunter{at}uab.edu.

dagger Present address: Laboratory Animal Research Center, Institute of Medical Science, University of Tokyo, Tokyo 108, Japan.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Bedford, M. T., D. C. Chan, and P. Leder. 1997. FBP WW domains and the Abl SH3 domain bind to a specific class of proline-rich ligands. EMBO J. 16:2376-2383[Medline].
2. Bork, P., and M. Sudol. 1994. The WW domain: a signalling site in dystrophin? Trends Biochem. Sci. 19:531-533[Medline].
3. Bowles, N., D. Bonnet, F. Mulhauser, and P.-F. Spahr. 1994. Site-directed mutagenesis of the P2 region of the Rous sarcoma virus gag gene: effects on Gag polyprotein processing. Virology 203:20-28[Medline].
4. Bradac, J., and E. Hunter. 1984. Polypeptides of Mason-Pfizer monkey virus. I. Synthesis and processing of the gag-gene products. Virology 138:260-275[Medline].
5. Brody, B. A., S. S. Rhee, and E. Hunter. 1994. Postassembly cleavage of a retroviral glycoprotein cytoplasmic domain removes a necessary incorporation signal and activates fusion activity. J. Virol. 68:4620-4627[Abstract/Free Full Text].
6. Brody, B. A., S. S. Rhee, M. A. Sommerfelt, and E. Hunter. 1992. A viral protease-mediated cleavage of the transmembrane glycoprotein of Mason-Pfizer monkey virus can be suppressed by mutations within the matrix protein. Proc. Natl. Acad. Sci. USA 89:3443-3447[Abstract/Free Full Text].
7. Chen, C., and H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745-2752[Abstract/Free Full Text].
8. Chen, H. I., A. Einbond, S. J. Kwak, H. Linn, E. Koepf, S. Peterson, J. W. Kelly, and M. Sudol. 1997. Characterization of the WW domain of human yes-associated protein and its polyproline-containing ligands. J. Biol. Chem. 272:17070-17077[Abstract/Free Full Text].
9. Chen, H. I., and M. Sudol. 1995. The WW domain of Yes-associated protein binds a proline-rich ligand that differs from the consensus established for Src homology 3-binding modules. Proc. Natl. Acad. Sci. USA 92:7819-7823[Abstract/Free Full Text].
10. Delchambre, M., D. Gheysen, D. Thines, C. Thiriart, E. Jacobs, E. Verdin, M. Horth, A. Burny, and F. Bex. 1989. The Gag precursor of simian immunodeficiency virus assembles into virus-like particles. EMBO J. 8:2653-2660[Medline].
11. Dubay, J. W., S. J. Roberts, B. H. Hahn, and E. Hunter. 1992. Truncation of the human immunodeficiency virus type 1 transmembrane glycoprotein cytoplasmic domain blocks virus infectivity. J. Virol. 66:6616-6625[Abstract/Free Full Text].
12. Garnier, L., J. W. Wills, M. F. Verderame, and M. Sudol. 1996. WW domains and retrovirus budding. Nature 381:744-745[Medline]. (Letter.)
13. Gheysen, H. P., E. Jacobs, F. de Foresta, C. Thiriart, M. Francotte, D. Thines, and M. De Wilde. 1989. Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus-infected insect cells. Cell 59:103-112[Medline].
14. Göttlinger, H. G., T. Dorfman, J. G. Sodroski, and W. A. Haseltine. 1991. Effect of mutations affecting the p6 gag protein on human immunodeficiency virus particle release. Proc. Natl. Acad. Sci. USA 88:3195-3199[Abstract/Free Full Text].
15. Haffar, O., J. Garrigues, B. Travis, P. Moran, J. Zarling, and S.-L. Hu. 1990. Human immunodeficiency virus-like, nonreplicating, gag-env particles assemble in a recombinant vaccinia virus expression system. J. Virol. 64:2653-2659[Abstract/Free Full Text].
16. Henderson, L. E., R. Sowder, G. Smythers, R. E. Benveniste, and S. Oroszlan. 1985. Purification and N-terminal amino acid sequence comparisons of structural proteins from retrovirus-D/Washington and Mason-Pfizer monkey virus. J. Virol. 55:778-787[Abstract/Free Full Text].
17. Huang, M., J. M. Orenstein, M. A. Martin, and E. O. Freed. 1995. p6Gag is required for particle production from full-length human immunodeficiency virus type 1 molecular clones expressing protease. J. Virol. 69:6810-6818[Abstract].
18. Klikova, M., S. S. Rhee, E. Hunter, and T. Ruml. 1995. Efficient in vivo and in vitro assembly of retroviral capsids from Gag precursor proteins expressed in bacteria. J. Virol. 69:1093-1098[Abstract].
19. Leis, J., D. Baltimore, J. M. Bishop, J. Coffin, E. Fleissner, S. P. Goff, S. Oroszlan, H. Robinson, A. M. Skalka, H. M. Temin, and V. Vogt. 1988. Standardized and simplified nomenclature for proteins common to all retroviruses. J. Virol. 62:1808-1809[Abstract/Free Full Text].
20. Madisen, L., B. Travis, S.-L. Hu, and A. F. Purchio. 1987. Expression of the human immunodeficiency virus gag gene in insect cells. Virology 158:248-250[Medline].
21. Parent, L. J., R. P. Bennett, R. C. Craven, T. D. Nelle, N. K. Krishna, J. B. Bowzard, C. B. Wilson, B. A. Puffer, R. C. Montelaro, and J. W. Wills. 1995. Positionally independent and exchangeable late budding functions of the Rous sarcoma virus and human immunodeficiency virus Gag proteins. J. Virol. 69:5455-5460[Abstract].
22. Pepinsky, R. B., R. J. Mattaliano, and V. M. Vogt. 1986. Structure and processing of the p2 region of avian sarcoma and leukemia virus gag precursor polyproteins. J. Virol. 58:50-58[Abstract/Free Full Text].
23. Puffer, B. A., L. J. Parent, J. W. Wills, and R. C. Montelaro. 1997. Equine infectious anemia virus utilizes a YXXL motif within the late assembly domain of the Gag p9 protein. J. Virol. 71:6541-6546[Abstract].
24. Rhee, S. S., and E. Hunter. 1991. Amino acid substitutions within the matrix protein of type D retroviruses affect assembly, transport and membrane association of a capsid. EMBO J. 10:535-546[Medline].
25. Rhee, S. S., and E. Hunter. 1990. A single amino acid substitution within the matrix protein of a type D retrovirus converts its morphogenesis to that of a type C retrovirus. Cell 63:77-86[Medline].
26. Rhee, S. S., and E. Hunter. 1990. Structural role of the matrix protein of type D retroviruses in Gag polyprotein stability and capsid assembly. J. Virol. 64:4383-4389[Abstract/Free Full Text].
27. Rhee, S. S., and E. Hunter. 1987. Myristylation is required for intracellular transport but not for assembly of D-type retrovirus capsids. J. Virol. 61:1045-1053[Abstract/Free Full Text].
28. Sakalian, M., S. D. Parker, R. A. Weldon, Jr., and E. Hunter. 1996. Synthesis and assembly of retrovirus Gag precursors into immature capsids in vitro. J. Virol. 70:3706-3715[Abstract].
29. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467[Abstract/Free Full Text].
30. Sommerfelt, M., C. R. Roberts, and E. Hunter. 1993. Expression of simian type D retroviral (Mason-Pfizer monkey virus) capsids in insect cells using recombinant baculovirus. Virology 192:298-306[Medline].
31. Sommerfelt, M. A., S. R. Petteway, Jr., G. B. Dreyer, and E. Hunter. 1992. Effect of retroviral proteinase inhibitors on Mason-Pfizer monkey virus maturation and transmembrane glycoprotein cleavage. J. Virol. 66:4220-4227[Abstract/Free Full Text].
32. Sommerfelt, M. A., S. S. Rhee, and E. Hunter. 1992. Importance of p12 protein in Mason-Pfizer monkey virus assembly and infectivity. J. Virol. 66:7005-7011[Abstract/Free Full Text].
33. Strambio-de-Castillia, C., and E. Hunter. 1992. Mutational analysis of the major homology region of Mason-Pfizer monkey virus by use of saturation mutagenesis. J. Virol. 66:7021-7032[Abstract/Free Full Text].
34. Sudol, M. 1996. Structure and function of the WW domain. Prog. Biophys. Mol. Biol. 65:113-132[Medline].
35. Sudol, M., H. I. Chen, C. Bougeret, A. Einbond, and P. Bork. 1995. Characterization of a novel protein-binding module---the WW domain. FEBS Lett. 369:67-71[Medline].
36. Thayer, R. M., M. D. Power, M. L. Bryant, M. B. Gardner, P. J. Barr, and P. A. Luciw. 1987. Sequence relationships of type D retroviruses which cause simian acquired immunodeficiency syndrome. Virology 157:317-329[Medline].
37. Weldon, R. A., Jr., and E. Hunter. 1996. Molecular requirements for retrovirus assembly, p. 381-410. In W. Chiu, R. M. Burnett, and R. L. Garcea (ed.), Structural biology of viruses. Oxford University Press, New York, N.Y.
38. Wills, J. W., C. E. Cameron, C. B. Wilson, Y. Xiang, R. P. Bennett, and J. Leis. 1994. An assembly domain of the Rous sarcoma virus Gag protein required late in budding. J. Virol. 68:6605-6618[Abstract/Free Full Text].
39. Wills, J. W., R. C. Craven, and J. A. Achacoso. 1989. Creation and expression of myristylated forms of Rous sarcoma virus Gag protein in mammalian cells. J. Virol. 63:4331-4343[Abstract/Free Full Text].
40. Xiang, Y., C. E. Cameron, J. W. Wills, and J. Leis. 1996. Fine mapping and characterization of the Rous sarcoma virus Pr76gag late assembly domain. J. Virol. 70:5695-5700[Abstract/Free Full Text].

J Virol, May 1998, p. 4095-4103, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Tandon, R., AuCoin, D. P., Mocarski, E. S. (2009). Human Cytomegalovirus Exploits ESCRT Machinery in the Process of Virion Maturation. J. Virol. 83: 10797-10807 [Abstract] [Full Text]  
  • Sabo, Y., Laham-Karam, N., Bacharach, E. (2008). Basal Budding and Replication of the Murine Leukemia Virus Are Independent of the Gag L Domains. J. Virol. 82: 9770-9775 [Abstract] [Full Text]  
  • Ushijima, Y., Koshizuka, T., Goshima, F., Kimura, H., Nishiyama, Y. (2008). Herpes Simplex Virus Type 2 UL56 Interacts with the Ubiquitin Ligase Nedd4 and Increases Its Ubiquitination. J. Virol. 82: 5220-5233 [Abstract] [Full Text]  
  • Usami, Y., Popov, S., Popova, E., Gottlinger, H. G. (2008). Efficient and Specific Rescue of Human Immunodeficiency Virus Type 1 Budding Defects by a Nedd4-Like Ubiquitin Ligase. J. Virol. 82: 4898-4907 [Abstract] [Full Text]  
  • Chung, H.-Y., Morita, E., von Schwedler, U., Muller, B., Krausslich, H.-G., Sundquist, W. I. (2008). NEDD4L Overexpression Rescues the Release and Infectivity of Human Immunodeficiency Virus Type 1 Constructs Lacking PTAP and YPXL Late Domains. J. Virol. 82: 4884-4897 [Abstract] [Full Text]  
  • Luttge, B. G., Shehu-Xhilaga, M., Demirov, D. G., Adamson, C. S., Soheilian, F., Nagashima, K., Stephen, A. G., Fisher, R. J., Freed, E. O. (2008). Molecular Characterization of Feline Immunodeficiency Virus Budding. J. Virol. 82: 2106-2119 [Abstract] [Full Text]  
  • Popov, S., Popova, E., Inoue, M., Gottlinger, H. G. (2008). Human Immunodeficiency Virus Type 1 Gag Engages the Bro1 Domain of ALIX/AIP1 through the Nucleocapsid. J. Virol. 82: 1389-1398 [Abstract] [Full Text]  
  • Heidecker, G., Lloyd, P. A., Soheilian, F., Nagashima, K., Derse, D. (2007). The Role of WWP1-Gag Interaction and Gag Ubiquitination in Assembly and Release of Human T-Cell Leukemia Virus Type 1. J. Virol. 81: 9769-9777 [Abstract] [Full Text]  
  • Stansell, E., Apkarian, R., Haubova, S., Diehl, W. E., Tytler, E. M., Hunter, E. (2007). Basic Residues in the Mason-Pfizer Monkey Virus Gag Matrix Domain Regulate Intracellular Trafficking and Capsid-Membrane Interactions. J. Virol. 81: 8977-8988 [Abstract] [Full Text]  
  • Watanabe, T., Sorensen, E. M., Naito, A., Schott, M., Kim, S., Ahlquist, P. (2007). Involvement of host cellular multivesicular body functions in hepatitis B virus budding. Proc. Natl. Acad. Sci. USA 104: 10205-10210 [Abstract] [Full Text]  
  • Urata, S., Noda, T., Kawaoka, Y., Morikawa, S., Yokosawa, H., Yasuda, J. (2007). Interaction of Tsg101 with Marburg Virus VP40 Depends on the PPPY Motif, but Not the PT/SAP Motif as in the Case of Ebola Virus, and Tsg101 Plays a Critical Role in the Budding of Marburg Virus-Like Particles Induced by VP40, NP, and GP. J. Virol. 81: 4895-4899 [Abstract] [Full Text]  
  • Murcia, P. R., Arnaud, F., Palmarini, M. (2007). The Transdominant Endogenous Retrovirus enJS56A1 Associates with and Blocks Intracellular Trafficking of Jaagsiekte Sheep Retrovirus Gag. J. Virol. 81: 1762-1772 [Abstract] [Full Text]  
  • Urata, S., Noda, T., Kawaoka, Y., Yokosawa, H., Yasuda, J. (2006). Cellular factors required for lassa virus budding.. J. Virol. 80: 4191-4195 [Abstract] [Full Text]  
  • Auerbach, M. R., Brown, K. R., Kaplan, A., de Las Nueces, D., Singh, I. R. (2006). A Small Loop in the Capsid Protein of Moloney Murine Leukemia Virus Controls Assembly of Spherical Cores. J. Virol. 80: 2884-2893 [Abstract] [Full Text]  
  • Paul, T. A., Quackenbush, S. L., Sutton, C., Casey, R. N., Bowser, P. R., Casey, J. W. (2006). Identification and Characterization of an Exogenous Retrovirus from Atlantic Salmon Swim Bladder Sarcomas. J. Virol. 80: 2941-2948 [Abstract] [Full Text]  
  • Song, C., Micoli, K., Bauerova, H., Pichova, I., Hunter, E. (2005). Amino Acid Residues in the Cytoplasmic Domain of the Mason-Pfizer Monkey Virus Glycoprotein Critical for Its Incorporation into Virions. J. Virol. 79: 11559-11568 [Abstract] [Full Text]  
  • Neumann, G., Ebihara, H., Takada, A., Noda, T., Kobasa, D., Jasenosky, L. D., Watanabe, S., Kim, J. H., Feldmann, H., Kawaoka, Y. (2005). Ebola Virus VP40 Late Domains Are Not Essential for Viral Replication in Cell Culture. J. Virol. 79: 10300-10307 [Abstract] [Full Text]  
  • Ott, D. E., Coren, L. V., Gagliardi, T. D., Nagashima, K. (2005). Heterologous Late-Domain Sequences Have Various Abilities To Promote Budding of Human Immunodeficiency Virus Type 1. J. Virol. 79: 9038-9045 [Abstract] [Full Text]  
  • Patton, G. S., Morris, S. A., Chung, W., Bieniasz, P. D., McClure, M. O. (2005). Identification of Domains in Gag Important for Prototypic Foamy Virus Egress. J. Virol. 79: 6392-6399 [Abstract] [Full Text]  
  • Stange, A., Mannigel, I., Peters, K., Heinkelein, M., Stanke, N., Cartellieri, M., Gottlinger, H., Rethwilm, A., Zentgraf, H., Lindemann, D. (2005). Characterization of Prototype Foamy Virus Gag Late Assembly Domain Motifs and Their Role in Particle Egress and Infectivity. J. Virol. 79: 5466-5476 [Abstract] [Full Text]  
  • Mura, M., Murcia, P., Caporale, M., Spencer, T. E., Nagashima, K., Rein, A., Palmarini, M. (2004). Late viral interference induced by transdominant Gag of an endogenous retrovirus. Proc. Natl. Acad. Sci. USA 101: 11117-11122 [Abstract] [Full Text]  
  • Heidecker, G., Lloyd, P. A., Fox, K., Nagashima, K., Derse, D. (2004). Late Assembly Motifs of Human T-Cell Leukemia Virus Type 1 and Their Relative Roles in Particle Release. J. Virol. 78: 6636-6648 [Abstract] [Full Text]  
  • Martin-Serrano, J., Perez-Caballero, D., Bieniasz, P. D. (2004). Context-Dependent Effects of L Domains and Ubiquitination on Viral Budding. J. Virol. 78: 5554-5563 [Abstract] [Full Text]  
  • Blot, V., Perugi, F., Gay, B., Prevost, M.-C., Briant, L., Tangy, F., Abriel, H., Staub, O., Dokhelar, M.-C., Pique, C. (2004). Nedd4.1-mediated ubiquitination and subsequent recruitment of Tsg101 ensure HTLV-1 Gag trafficking towards the multivesicular body pathway prior to virus budding. J. Cell Sci. 117: 2357-2367 [Abstract] [Full Text]  
  • Wang, H., Machesky, N. J., Mansky, L. M. (2004). Both the PPPY and PTAP Motifs Are Involved in Human T-Cell Leukemia Virus Type 1 Particle Release. J. Virol. 78: 1503-1512 [Abstract] [Full Text]  
  • Guo, X., Hu, J., Whitney, J. B., Russell, R. S., Liang, C. (2004). Important Role for the CA-NC Spacer Region in the Assembly of Bovine Immunodeficiency Virus Gag Protein. J. Virol. 78: 551-560 [Abstract] [Full Text]  
  • Shehu-Xhilaga, M., Ablan, S., Demirov, D. G., Chen, C., Montelaro, R. C., Freed, E. O. (2004). Late Domain-Dependent Inhibition of Equine Infectious Anemia Virus Budding. J. Virol. 78: 724-732 [Abstract] [Full Text]  
  • Chen, C., Weisz, O. A., Stolz, D. B., Watkins, S. C., Montelaro, R. C. (2004). Differential Effects of Actin Cytoskeleton Dynamics on Equine Infectious Anemia Virus Particle Production. J. Virol. 78: 882-891 [Abstract] [Full Text]  
  • Palmarini, M., Mura, M., Spencer, T. E. (2004). Endogenous betaretroviruses of sheep: teaching new lessons in retroviral interference and adaptation. J. Gen. Virol. 85: 1-13 [Abstract] [Full Text]  
  • Bouamr, F., Melillo, J. A., Wang, M. Q., Nagashima, K., de Los Santos, M., Rein, A., Goff, S. P. (2003). PPPYEPTAP Motif Is the Late Domain of Human T-Cell Leukemia Virus Type 1 Gag and Mediates Its Functional Interaction with Cellular Proteins Nedd4 and Tsg101. J. Virol. 77: 11882-11895 [Abstract] [Full Text]  
  • Martin-Serrano, J., Bieniasz, P. D. (2003). A Bipartite Late-Budding Domain in Human Immunodeficiency Virus Type 1. J. Virol. 77: 12373-12377 [Abstract] [Full Text]  
  • Martin-Serrano, J., Yarovoy, A., Perez-Caballero, D., Bieniasz, P. D. (2003). Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins. Proc. Natl. Acad. Sci. USA 100: 12414-12419 [Abstract] [Full Text]  
  • Yasuda, J., Nakao, M., Kawaoka, Y., Shida, H. (2003). Nedd4 Regulates Egress of Ebola Virus-Like Particles from Host Cells. J. Virol. 77: 9987-9992 [Abstract] [Full Text]  
  • Goff, A., Ehrlich, L. S., Cohen, S. N., Carter, C. A. (2003). Tsg101 Control of Human Immunodeficiency Virus Type 1 Gag Trafficking and Release. J. Virol. 77: 9173-9182 [Abstract] [Full Text]  
  • Gottwein, E., Bodem, J., Muller, B., Schmechel, A., Zentgraf, H., Krausslich, H.-G. (2003). The Mason-Pfizer Monkey Virus PPPY and PSAP Motifs Both Contribute to Virus Release. J. Virol. 77: 9474-9485 [Abstract] [Full Text]  
  • Tanzi, G. O., Piefer, A. J., Bates, P. (2003). Equine Infectious Anemia Virus Utilizes Host Vesicular Protein Sorting Machinery during Particle Release. J. Virol. 77: 8440-8447 [Abstract] [Full Text]  
  • Goila-Gaur, R., Demirov, D. G., Orenstein, J. M., Ono, A., Freed, E. O. (2003). Defects in Human Immunodeficiency Virus Budding and Endosomal Sorting Induced by TSG101 Overexpression. J. Virol. 77: 6507-6519 [Abstract] [Full Text]  
  • Martin-Serrano, J., Zang, T., Bieniasz, P. D. (2003). Role of ESCRT-I in Retroviral Budding. J. Virol. 77: 4794-4804 [Abstract] [Full Text]  
  • Ott, D. E., Coren, L. V., Sowder, R. C. II, Adams, J., Schubert, U. (2003). Retroviruses Have Differing Requirements for Proteasome Function in the Budding Process. J. Virol. 77: 3384-3393 [Abstract] [Full Text]  
  • Davis, D. A., Brown, C. A., Newcomb, F. M., Boja, E. S., Fales, H. M., Kaufman, J., Stahl, S. J., Wingfield, P., Yarchoan, R. (2003). Reversible Oxidative Modification as a Mechanism for Regulating Retroviral Protease Dimerization and Activation. J. Virol. 77: 3319-3325 [Abstract] [Full Text]  
  • Licata, J. M., Simpson-Holley, M., Wright, N. T., Han, Z., Paragas, J., Harty, R. N. (2003). Overlapping Motifs (PTAP and PPEY) within the Ebola Virus VP40 Protein Function Independently as Late Budding Domains: Involvement of Host Proteins TSG101 and VPS-4. J. Virol. 77: 1812-1819 [Abstract] [Full Text]  
  • Yueh, A., Goff, S. P. (2003). Phosphorylated Serine Residues and an Arginine-Rich Domain of the Moloney Murine Leukemia Virus p12 Protein Are Required for Early Events of Viral Infection. J. Virol. 77: 1820-1829 [Abstract] [Full Text]  
  • Sakalian, M., Dittmer, S. S., Gandy, A. D., Rapp, N. D., Zabransky, A., Hunter, E. (2002). The Mason-Pfizer Monkey Virus Internal Scaffold Domain Enables In Vitro Assembly of Human Immunodeficiency Virus Type 1 Gag. J. Virol. 76: 10811-10820 [Abstract] [Full Text]  
  • Le Blanc, I., Prevost, M.-C., Dokhelar, M.-C., Rosenberg, A. R. (2002). The PPPY Motif of Human T-Cell Leukemia Virus Type 1 Gag Protein Is Required Early in the Budding Process. J. Virol. 76: 10024-10029 [Abstract] [Full Text]  
  • Wang, H., Norris, K. M., Mansky, L. M. (2002). Analysis of Bovine Leukemia Virus Gag Membrane Targeting and Late Domain Function. J. Virol. 76: 8485-8493 [Abstract] [Full Text]  
  • Serhan, F., Jourdan, N., Saleun, S., Moullier, P., Duisit, G. (2002). Characterization of Producer Cell-Dependent Restriction of Murine Leukemia Virus Replication. J. Virol. 76: 6609-6617 [Abstract] [Full Text]  
  • Ma, Y. M., Vogt, V. M. (2002). Rous Sarcoma Virus Gag Protein-Oligonucleotide Interaction Suggests a Critical Role for Protein Dimer Formation in Assembly. J. Virol. 76: 5452-5462 [Abstract] [Full Text]  
  • Strack, B., Calistri, A., Gottlinger, H. G. (2002). Late Assembly Domain Function Can Exhibit Context Dependence and Involves Ubiquitin Residues Implicated in Endocytosis. J. Virol. 76: 5472-5479 [Abstract] [Full Text]  
  • Freed, E. O. (2002). Viral Late Domains. J. Virol. 76: 4679-4687 [Full Text]  
  • Patnaik, A., Chau, V., Li, F., Montelaro, R. C., Wills, J. W. (2002). Budding of Equine Infectious Anemia Virus Is Insensitive to Proteasome Inhibitors. J. Virol. 76: 2641-2647 [Abstract] [Full Text]  
  • Patnaik, A., Wills, J. W. (2002). In Vivo Interference of Rous Sarcoma Virus Budding by cis Expression of a WW Domain. J. Virol. 76: 2789-2795 [Abstract] [Full Text]  
  • Ott, D. E., Coren, L. V., Sowder, R. C. II, Adams, J., Nagashima, K., Schubert, U. (2002). Equine Infectious Anemia Virus and the Ubiquitin-Proteasome System. J. Virol. 76: 3038-3044 [Abstract] [Full Text]  
  • Li, F., Chen, C., Puffer, B. A., Montelaro, R. C. (2002). Functional Replacement and Positional Dependence of Homologous and Heterologous L Domains in Equine Infectious Anemia Virus Replication. J. Virol. 76: 1569-1577 [Abstract] [Full Text]  
  • Muller, B., Patschinsky, T., Krausslich, H.-G. (2002). The Late-Domain-Containing Protein p6 Is the Predominant Phosphoprotein of Human Immunodeficiency Virus Type 1 Particles. J. Virol. 76: 1015-1024 [Abstract] [Full Text]  
  • Demirov, D. G., Ono, A., Orenstein, J. M., Freed, E. O. (2002). Overexpression of the N-terminal domain of TSG101 inhibits HIV-1 budding by blocking late domain function. Proc. Natl. Acad. Sci. USA 99: 955-960 [Abstract] [Full Text]  
  • Demirov, D. G., Orenstein, J. M., Freed, E. O. (2002). The Late Domain of Human Immunodeficiency Virus Type 1 p6 Promotes Virus Release in a Cell Type-Dependent Manner. J. Virol. 76: 105-117 [Abstract] [Full Text]  
  • Parker, S. D., Hunter, E. (2001). Activation of the Mason-Pfizer monkey virus protease within immature capsids invitro. Proc. Natl. Acad. Sci. USA 10.1073/pnas.251460998v1 [Abstract] [Full Text]  
  • Harty, R. N., Brown, M. E., McGettigan, J. P., Wang, G., Jayakar, H. R., Huibregtse, J. M., Whitt, M. A., Schnell, M. J. (2001). Rhabdoviruses and the Cellular Ubiquitin-Proteasome System: a Budding Interaction. J. Virol. 75: 10623-10629 [Abstract] [Full Text]  
  • Chen, C., Li, F., Montelaro, R. C. (2001). Functional Roles of Equine Infectious Anemia Virus Gag p9 in Viral Budding and Infection. J. Virol. 75: 9762-9770 [Abstract] [Full Text]  
  • Hong, S., Choi, G., Park, S., Chung, A.-S., Hunter, E., Rhee, S. S. (2001). Type D Retrovirus Gag Polyprotein Interacts with the Cytosolic Chaperonin TRiC. J. Virol. 75: 2526-2534 [Abstract] [Full Text]  
  • Yu, F., Joshi, S. M., Ma, Y. M., Kingston, R. L., Simon, M. N., Vogt, V. M. (2001). Characterization of Rous Sarcoma Virus Gag Particles Assembled In Vitro. J. Virol. 75: 2753-2764 [Abstract] [Full Text]  
  • Harty, R. N., Brown, M. E., Wang, G., Huibregtse, J., Hayes, F. P. (2000). A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: Implications for filovirus budding. Proc. Natl. Acad. Sci. USA 10.1073/pnas.250277297v1 [Abstract] [Full Text]  
  • Vogt, V. M. (2000). Ubiquitin in retrovirus assembly: Actor or bystander?. Proc. Natl. Acad. Sci. USA 97: 12945-12947 [Full Text]  
  • Strack, B., Calistri, A., Accola, M. A., Palu, G., Gottlinger, H. G. (2000). A role for ubiquitin ligase recruitment in retrovirus release. Proc. Natl. Acad. Sci. USA 97: 13063-13068 [Abstract] [Full Text]  
  • Patnaik, A., Chau, V., Wills, J. W. (2000). Ubiquitin is part of the retrovirus budding machinery. Proc. Natl. Acad. Sci. USA 97: 13069-13074 [Abstract] [Full Text]  
  • Jayakar, H. R., Murti, K. G., Whitt, M. A. (2000). Mutations in the PPPY Motif of Vesicular Stomatitis Virus Matrix Protein Reduce Virus Budding by Inhibiting a Late Step in Virion Release. J. Virol. 74: 9818-9827 [Abstract] [Full Text]  
  • Yuan, B., Campbell, S., Bacharach, E., Rein, A., Goff, S. P. (2000). Infectivity of Moloney Murine Leukemia Virus Defective in Late Assembly Events Is Restored by Late Assembly Domains of Other Retroviruses. J. Virol. 74: 7250-7260 [Abstract] [Full Text]  
  • Accola, M. A., Strack, B., Göttlinger, H. G. (2000). Efficient Particle Production by Minimal Gag Constructs Which Retain the Carboxy-Terminal Domain of Human Immunodeficiency Virus Type 1 Capsid-p2 and a Late Assembly Domain. J. Virol. 74: 5395-5402 [Abstract] [Full Text]  
  • Parker, S. D., Hunter, E. (2000). A Cell-Line-Specific Defect in the Intracellular Transport and Release of Assembled Retroviral Capsids. J. Virol. 74: 784-795 [Abstract] [Full Text]  
  • Sakalian, M., Hunter, E. (1999). Separate Assembly and Transport Domains within the Gag Precursor of Mason-Pfizer Monkey Virus. J. Virol. 73: 8073-8082 [Abstract] [Full Text]  
  • Dettenhofer, M., Yu, X.-F. (1999). Proline Residues in Human Immunodeficiency Virus Type 1 p6Gag Exert a Cell Type-Dependent Effect on Viral Replication and Virion Incorporation of Pol Proteins. J. Virol. 73: 4696-4704 [Abstract] [Full Text]  
  • Harty, R. N., Paragas, J., Sudol, M., Palese, P. (1999). A Proline-Rich Motif within the Matrix Protein of Vesicular Stomatitis Virus and Rabies Virus Interacts with WW Domains of Cellular Proteins: Implications for Viral Budding. J. Virol. 73: 2921-2929 [Abstract] [Full Text]  
  • Craven, R. C., Harty, R. N., Paragas, J., Palese, P., Wills, J. W. (1999). Late Domain Function Identified in the Vesicular Stomatitis Virus M Protein by Use of Rhabdovirus-Retrovirus Chimeras. J. Virol. 73: 3359-3365 [Abstract] [Full Text]  
  • Puffer, B. A., Watkins, S. C., Montelaro, R. C. (1998). Equine Infectious Anemia Virus Gag Polyprotein Late Domain Specifically Recruits Cellular AP-2 Adapter Protein Complexes during Virion Assembly. J. Virol. 72: 10218-10221 [Abstract] [Full Text]  
  • Harty, R. N., Brown, M. E., Wang, G., Huibregtse, J., Hayes, F. P. (2000). A PPxY motif within the VP40 protein of Ebola virus interacts physically and functionally with a ubiquitin ligase: Implications for filovirus budding. Proc. Natl. Acad. Sci. USA 97: 13871-13876 [Abstract] [Full Text]  
  • Parker, S. D., Hunter, E. (2001). Activation of the Mason-Pfizer monkey virus protease within immature capsids invitro. Proc. Natl. Acad. Sci. USA 98: 14631-14636 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yasuda, J.
Right arrow Articles by Hunter, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yasuda, J.
Right arrow Articles by Hunter, E.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»