Previous Article | Next Article 
J Virol, May 1998, p. 4088-4094, Vol. 72, No. 5
Institut für Virologie und
Immunbiologie, Universität Würzburg, Würzburg,
Germany
Received 22 September 1997/Accepted 3 February 1998
Primate foamy viruses (FVs) express, in addition to the 130-kDa
envelope protein, a 170-kDa glycoprotein, which reacts with antisera
specific for the envelope and Bel proteins. We determined the exact
nature of this 170-kDa glycoprotein by using the molecularly cloned
human FV (HFV). Radioimmunoprecipitation analysis of 293T cells
transfected with appropriate expression constructs by using antisera
specific for the HFV Env, Bel1, and Bel2 proteins, as well as reverse
transcription-PCR analysis of HFV-infected cells, demonstrated that
this protein is an Env-Bet fusion protein that is secreted into the
supernatant. However, it is only loosely associated, or not associated,
with viral particles. gp170 is generated by an alternatively spliced
Env mRNA using a splice donor and splice acceptor pair localized within
the env open reading frame (ORF), which is normally used to
generate Bel1 and Bet transcripts derived from the internal promoter
within the env ORF. gp170 is expressed at a level 30 to
50% of the Env precursor gp130. However, it alone does not confer
infectivity to HFV particles, because capsids derived from proviruses
expressing only the gp170 were not released into the supernatant. In
contrast, viruses derived from proviral clones deficient in gp170
expression showed similar in vitro infectivity and replication kinetics
to wild-type virus. Furthermore, both types of viruses were inactivated
to a similar extent by neutralizing sera, indicating that shedding of
gp170 probably does not affect the humoral immune response in the
infected host.
Human foamy virus (HFV) is the
prototype member of the family Spumavirinae, also referred
to as foamy viruses (FVs). FVs are complex retroid viruses that exploit
a unique replication strategy that has been discovered in recent
studies (6, 25, 36, 37). In addition to the genes for the
Gag, Pol, and Env proteins, FVs harbor open reading frames (ORFs) in
the 3' region of the genome that code for accessory proteins. The first
ORF codes for a DNA-binding protein (Tas/Bel1) that is a potent
trans activator of gene expression directed by promoters of
the cognate virus (16, 17, 24, 31, 38).
FV gene expression involves two promoters and several transcripts, some
of which are multiply spliced (23, 27) (Fig.
1). The long terminal repeat (LTR)
promoter directs the expression of the pregenomic RNA/Gag mRNA;
single-spliced mRNAs for the Pol, Env, and Tas/Bel1 proteins; and a
double-spliced mRNA for the Bet protein (27). Bet is a
highly expressed accessory protein of unknown function made up of
ORF-1- and ORF-2-encoded sequences (1, 14, 27). In the
initial phase of replication, gene expression relies on the internal
promoter (IP) located in the env gene upstream of the
accessory ORFs (22). IP-directed transcripts can give rise
to Tas/Bel1 and Bet proteins. It has been reported that these
transcripts are often spliced in the untranslated leader sequence
overlapping the env gene (22) (Fig. 1).
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Characterization of a Human Foamy Virus
170-Kilodalton Env-Bet Fusion Protein Generated by
Alternative Splicing
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
View larger version (17K):
[in a new window]
FIG. 1.
Known HFV mRNAs derived from the LTR or internal
promoter coding for structural as well as accessory proteins. The mRNAs
are indicated as lines with inserts for the deleted intron sequences,
the coding regions of the individual mRNAs are shown as bars, and the
resulting proteins are listed in the column to the right.
The morphogenesis of HFV appears to be unusual too. HFV capsids do not bud spontaneously across cellular membranes but require the presence of Env protein (7). The 130-kDa Env precursor protein is cleaved by a cellular protease into surface (SU) and transmembrane (TM) subunits during its transport to the cell membrane (10). However, due to the localization of a retention signal in the cytoplasmic domain, most of the 130-kDa HFV Env protein is retained in the endoplasmic reticulum in the absence of either the expression of other HFV structural genes or the inactivation of the endoplasmic reticulum retention signal (10, 11).
Beside the 130-kDa Env precursor, an even larger glycoprotein (170 kDa) has been detected in HFV-infected cells (29). This protein has been reported to cross-react with antibodies recognizing Env, Tas/Bel1, and Bet (9). However, neither mRNA nor any function of this protein has been described yet. In this study, we set about to characterize this enigmatic protein more closely.
| |
MATERIALS AND METHODS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Eukaryotic expression constructs. The expression construct pcHFVenv/bel1-3, containing the env, bel1, bel2, and bel3 ORFs, was generated by inserting a fragment of pHSRV2 (35) from the translation start of the env ORF (nucleotide [nt] 5719 relative to the genomic transcription start) to the SspI site (nt 10445) ~35 bp downstream of the bel2 stop codon into pCDNA3.1+zeo (Invitrogen). Mutants of the parental construct were generated by recombinant PCR with primers harboring the desired mutations. All sequences derived by PCR were sequenced to confirm the introduction of the desired mutations and exclude additional offsite mutations. The following mutants of pcHFVenv/bel1-3 were generated: EM2 (SD/SA mutant), the splice donor (SD) (nt 8530) and splice acceptor (SA) (nt 8648) were inactivated by GT-to-GG and AG-to-AA exchanges, respectively; EM4 (SD mutant), the SD (nt 8530) consensus sequence was changed from GT to GG; and EM6 (Env-Bel1/Bet), deletion of the intron between SD (nt 8530) and SA (nt 8648). In pcHFVenv-bel1 (EM7), the sequences between SD (nt 8530) and SA (nt 8648) were deleted and the SD (nt 8922) and the SA (nt 9224) were inactivated by GT-to-GC and AG-to-TC mutations, respectively. pcHFVenv-bet (EM8) was created by deletion of the sequences between SD (nt 8530) and SA (nt 8648) and between SD (nt 8922) and SA (nt 9224), whereas in pcHFVenv-bel2 (EM9), all intervening sequences between SD (nt 8530) and SA (nt 9224) were deleted. The parental human cytomegalovirus immediate-early promoter-driven infectious proviral clone pcHSRV2 wt has been described recently (25). The individual mutant proviral clones were generated by replacing an 858-bp NheI-ClaI fragment of pcHSRV2 with the respective fragments from the pcHFVenv/bel1-3 constructs.
Generation of recombinant HFV supernatants and RIPA.
Viral
supernatants containing the different recombinant viruses were
generated by transfection of 293T cells (5) essentially as
described previously (21). The viral supernatants were
harvested 48 to 72 hours after transfection. Supernatants from
independent transfections with the same plasmids were pooled and
filtered (pore size, 0.45 µm). The supernatants were used immediately
or stored at 
80°C until use. For characterization of HFV protein expression by radioimmunoprecipitation analysis (RIPA), transiently transfected 293T cells were metabolically labeled with
[35S]methionine for approximately 20 h. At 36 h
after addition of the DNA, the cells were lysed in RIPA buffer (20 mM
Tris [pH 7.4], 0.3 M NaCl, 1% [wt/vol] sodium deoxycholate, 1%
[vol/vol] Triton X-100, 0.1% [wt/vol] sodium dodecyl sulfate)
containing protease inhibitors. Viral proteins were precipitated as
described previously (7) with HFV-positive chimpanzee sera
or with rabbit antisera generated against recombinant HFV proteins and
specific for SU (20), Bel1 (22), Bel1/Bet
(1), and Bet/Bel2 (1). Secreted viral proteins
were analyzed with filtered (pore size 0.45 µm) supernatant
supplemented with 5× RIPA buffer to yield 1× RIPA buffer.
Particle-associated proteins were detected after centrifugation through
a 20% sucrose cushion as described previously (7).
RT-PCR analysis. Human KMST-6 fibroblastoid cells (28) were infected with supernatants of known titer from transfected 293T cells, containing molecularly defined viruses, at a multiplicity of infection (MOI) of 0.5. Mock-infected cultures were incubated with the same amount of supernatant from 293T cells transfected with pCDNA3.1+zeo. At 7 days after infection, total RNA was isolated from the infected cultures with the RNeasy Kit (Qiagen) as specified by the manufacturer. A 1-µg portion of total RNA was used for each individual reverse transcription-PCR (RT-PCR) analysis with the Titan RT-PCR System (Boehringer) as specified by the manufacturer. The primers used were 391 (AAGAGCAGATTGAAAGAGCAAAAGC), hybridizing upstream of the transcription start of the internal promotor (nt 8419) within the env ORF, and 8 (CTGGACTCTTCTAGTAGCCCT), hybridizing downstream of the SA site (nt 9224) within the bel2 ORF. Aliquots of the amplification reaction products were separated by agarose gel electrophoresis.
Determination of virus titers and growth kinetics. The growth kinetics of individual viruses were analyzed by infection of BHK-21 cells or of BHK-21 cells constitutively expressing the HFV transcriptional transactivator (BHK/Bel1 cells) (3) at a MOI of 0.05. Cell-free samples of the supernatant were collected over a period of 26 days and subjected to titer determination on BHK/LTRlacz cells as described previously (35).
Neutralization of HFV infection.
Neutralization of HFV
infectivity by chimpanzee sera was analyzed as described previously
with minor modifications (4). Briefly, 500 focus-forming
units (FFU) of HSRV2 wt or HSRV2 EM4 virus stock generated by transient
transfection of 293T cells was incubated with different antisera
dilutions for 1 h at 37°C in a total volume of 100 µl prior to
the addition to 2 × 103 BHK/LTRlacz indicator cells
plated 24 h previously in 96-well plates. At 48 h later, the
supernatants were aspirated, the cells were washed once with
phosphate-buffered saline, and 100 µl of lysis buffer (Promega) was
added. After a 15-min incubation at room temperature, 100 µl of 2×
assay buffer (20 mM NaH2PO4, 80 mM
Na2HPO4, 0.1 mM MnCl2, 2 mM
MgSO4, 40 mM 2-mercaptoethanol, 4 mg of
o-nitrophenyl-
-D-galactopyranoside [ONPG]
per ml [pH 7.3]) was added and the plates were incubated at 37°C
for an additional 6 to 12 h. The enzymatic reaction was terminated
by the addition of 100 µl of 3 M Na2CO3, and
the absorbance at 405 nm was determined in an enzyme-linked
immunosorbent assay reader (Bio-Rad).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Origin of the Env-Bel fusion proteins. Computer-assisted analysis of the 3' part of the HFV genome coding for the Env, Bel1, and Bet proteins (nt 5719 to 10445) indicated that alternatively spliced Env mRNA utilizing the SD (nt 8530) within the env ORF could potentially encode Env-Bel1, Env-Bet, and/or Env-Bel2 fusion proteins (Fig. 2A and B). Interestingly, all potential Env fusion proteins would lack the complete membrane-spanning domain (MSD) as well as the cytoplasmic domain of the TM subunit containing the ER retention signal (10), suggesting a targeting of these fusion proteins to the cellular secretory pathway. Furthermore, these SD and SA sites seem to be highly conserved in various FV isolates originating from different primates (data not shown). To examine whether such Env-Bel fusion proteins were indeed generated by the 3' part of the HFV genome, a eukaryotic expression construct, pcHFVenv/bel1-3 wt, was generated, containing the complete HFV env ORF as well as the bel1-3 ORFs (Fig. 2C). In addition, expression constructs containing the potential cDNAs coding for Env-Bel1 (EM7), Env-Bet (EM8), and Env-Bel2 (EM9) were generated by joining the respective SA sites with the env SD site by recombinant PCR (Fig. 2B and C). 293T cells were transfected with these expression constructs, and subsequently lysates of metabolically labeled cells were examined by RIPA with antisera specific for all major HFV proteins (Fig. 3A), HFV Env (Fig. 3B), Bel1 (Fig. 3C), and Bel2 (Fig. 3D). Analysis with a chimpanzee serum recognizing all major HFV proteins showed the presence of the 130-kDa Env precursor and a protein of unknown origin of about 170 kDa (Fig. 3A, lane 1), which was expressed at 30 to 50% of the level of the Env precursor gp130. The 170-kDa protein could be precipitated by an antiserum specific for the HFV Env protein (Fig. 3B, lane 1), by an antiserum reactive with the C-terminal amino acids encoded by the bel2 ORF (Fig. 3D, lane 1), or by an antiserum recognizing sequences common to Bel1 and Bet (data not shown), but not by an antiserum specific for amino acids unique to the Bel1 protein (Fig. 3C, lane 1). These results showed that the coding capacity for the 170-kDa HFV protein resides within this part of the HFV genome. Furthermore, the lack of reactivity of the 170-kDa protein with a Bel1-specific antiserum indicated that it is not an Env-Bel1 fusion protein. The sizes of the Env-Bel fusion proteins generated by transfection of 293T cells with the potential cDNA expression constructs (Fig. 3, lanes 3 to 5) suggested that the nature of the 170-kDa Env reactive protein most probably is an Env-Bet rather than an Env-Bel2 fusion protein. This was further supported by the precipitation of gp170 with the Bel1/Bet-specific antiserum (data not shown).
|
|
-HFV) (A), SU (Expression analysis of the Env-Bet fusion protein in the proviral context. A CMV promoter-driven HFV proviral clone, pcHSRV2, has been described recently (25). This construct allowed the production of virus titers up to 105 FFU/ml by transient transfection of 293T cells. To analyze the generation of the HFV Env-Bet protein in the context of the expression of other HFV structural proteins and its influence on HFV replication in vitro, the SD mutation EM4 was introduced into the pcHSRV2 provirus, termed pcHSRV2 EM4. In addition, proviral constructs were generated containing various deletions spanning the SD and SA sites within the env and bel1/2 ORFs, resulting in the loss of expression of the 130-kDa Env protein and its cleavage products. pcHSRV2 EM6 is capable of expressing Env-Bel1 and Env-Bet proteins, whereas pcHSRV2 EM7, EM8, and EM9 can express only Env-Bel1, Env-Bet, and Env-Bel2 fusion proteins, respectively. Different recombinant viruses were generated by transfection of 293T cells and metabolically labeled, and HFV protein expression was examined by RIPA with different antisera in cell lysates (Fig. 3) and supernatants (Fig. 4A). Similar to the results obtained with the subgenomic expression constructs shown above, the analysis of cellular protein expression showed that the 170-kDa protein is precipitated by a chimpanzee serum reactive with all major HFV proteins (Fig. 3A, lane 7), by an Env-specific antiserum (Fig. 3B, lane 7), by a Bel2-specific antiserum (Fig. 3D, lane 7), or by an antiserum recognizing sequences common to Bel1 and Bet (data not shown) but not by a Bel1-specific rabbit serum (Fig. 3C, lane 7). In addition, they demonstrated that the inactivation of the SD site within the env ORF results in a loss of expression of the putative Env-Bet fusion protein (Fig. 3, lanes 8). Furthermore, the analysis of particle-associated HFV proteins indicated that the Env-Bet protein is not particle associated (Fig. 4B, lane 1), even though small amounts of the fusion protein and its cleavage products could be detected in the supernatant of pcHSRV2 wt-transfected cells (Fig. 4A, lane 1). However, it is possible that the 170-kDa Env-Bet fusion protein, which lacks the MSD of the HFV envelope, is loosely associated with HFV particles via interaction of its extracellular domains with the membrane-anchored 130-kDa Env protein and may be shed during purification of the HFV particles by ultracentrifugation through sucrose. Alternatively, the amounts of particle-associated Env-Bet fusion proteins might be to small to be detected by standard RIPA. This analysis also showed that in the absence of the 130-kDa wild-type envelope protein, no HFV particles were released into the supernatant, indicated by the absence of HFV Gag and Env proteins in the viral particle preparations of 293T cells transfected with pcHSRV2 EM6, EM7, EM8, and EM9 (Fig. 4B, lanes 3 to 6). Nevertheless, the different Env fusion proteins and their respective cleavage products were detectable in these supernatants (Fig. 4A, lanes 3 to 6), in even larger amounts than were found in the pcHSRV2 wt sample (Fig. 4A, lane 1). No apparent difference in the extra- and intracellular distribution of virus particles could be observed between wild-type virus and the EM4 mutant when examining Gag expression by RIPA (Fig. 3A, lanes 7 and 8; Fig. 4B, lanes 1 and 2) or the particle maturation by electron microscopy (data not shown).
|
Identification and isolation of Env-Bel mRNAs from HFV-infected
human fibroblasts.
The results of the RIPA shown above suggested
that the 170-kDa protein is an Env-Bet fusion protein. Furthermore, no
Env-Bel1 or Env-Bel2 proteins were detected. To confirm the nature of
the 170-kDa protein as an Env-Bet protein and to determine whether other possible Env-Bel fusion proteins not detected by the RIPA exist,
we performed RT-PCR analysis on infected KMST-6 human fibroblast cultures. 293T cells were transfected with the proviral clones pcHSRV2,
pcHSRV2 EM2, pcHSRV2 EM4, or pCDNA3.1+zeo as a control. Supernatants
containing molecularly defined infectious viruses were harvested
48 h later and subjected to titer determination on BHK/LTRlacz
cells. Subsequently, they were used to infect KMST-6 cells at a MOI of
0.5. Seven days after infection, total RNA was isolated from the
infected cultures and used as template for an RT-PCR analysis. The
primers used hybridize upstream of the transcription start of the
internal promotor (nt 8419) within the env ORF (primer 391)
and downstream of the SA site (nt 9224) within the bel2 ORF (primer 8)
(Fig. 5A). Following amplification,
aliquots of the reaction mixtures were separated by agarose gel
electrophoresis (Fig. 5B). HFV-specific amplification products were
detected only in HFV-infected cultures, and not in mock-infected
cultures, whereas primers specific for the -globin mRNA yielded
amplification products in all samples (data not shown). All
HFV-infected samples yielded fragments corresponding in size to the
expected amplification products of 1,055 bp for the full-length
pregenomic, gag, pol or env mRNA and
of 757 bp for the Bel1-deleted 
HFV (32) pregenomic RNA
(Fig. 5B, lanes 2 to 4). Furthermore, in KMST-6 cells infected with
wild-type HSRV2, an additional 637-bp fragment, corresponding in size
to the putative env-bet mRNA, was detected whereas no fragments of 937 and 363 bp, corresponding to the putative
env-bel1 and env-bel2 mRNA, respectively, could
be detected (Fig. 5B, lane 2). Strikingly, the env-bet
amplification product was present only in samples of KMST-6 cells
infected by wild-type HSRV2 (Fig. 5B, lane 2) but was absent in samples
of KMST-6 cells infected by the HSRV2 EM2 or HSRV2 EM4 mutant viruses
harboring a defective SD site within the env ORF (Fig. 5B,
lanes 3 and 4). Similar results were obtained with primers located
further upstream of the transcription initiation site of the internal
promoter within the env ORF and more 3' of the SA (nt 9224)
within the bel2 ORF (data not shown). All amplification
products were cloned, and at least three individual clones of each
insert size were sequenced. The sequencing data confirmed the nature of
the amplification products as unspliced mRNA for the 1,055-bp fragment,
HFV mRNA for the 757-bp fragment and env-bet mRNA for the
637-bp fragment (data not shown). No fragments coding for potential
Env-Bel1 or Env-Bel2 proteins could be isolated. Taken together, the
results of the RT-PCR analysis of human fibroblasts infected with
molecularly defined HSRV2 strains confirmed the findings of the protein
analysis. The 170-kDa Env-reactive band present in cell lysates of
wild-type-HFV-infected cells represents an Env-Bet fusion protein
generated by alternative splicing of the env mRNA, using the
SD-SA pairs located within the env ORF and the
bel1 and bel2 ORFs.
|
Virus replication kinetics. To determine whether the Env-Bet fusion protein influences the in vitro replication of HFV, we examined the replication kinetics with small amounts of input virus. BHK-21 or BHK/Bel1 cells (3) were infected with stocks of HSRV2 wt or HSRV2 EM4 of known titer at a MOI of 0.05, and secretion of virus into the supernatant was monitored for a period of 26 days by titer determination on indicator cells. The virus production was similar for both types of virus regardless of whether BHK-21 (Fig. 6) or BHK/Bel1 cells (data not shown) were used as targets. Sequencing of PCR-amplified proviral fragments spanning the SD (nt 8530) site on day 14 after infection revealed no signs of reversion of the SD mutation in HSRV2 EM4-infected cells (data not shown). Furthermore, complementation of replication-defective HFV-based vectors with either the 130-kDa Env protein alone or in combination with the 170-kDa Env-Bet fusion protein revealed no difference in the relative infectivity of the different viruses on various target cell types (data not shown). These results indicated that the expression of the Env-Bet protein by HFV does not result in enhanced virus release or higher relative infectivity in vitro.
|
Analysis of the influence of the Env-Bet fusion protein on virus
neutralization.
The shedding of envelope proteins or the secretion
of envelope variants in vivo may affect the antiviral immune response
of the host. To test whether such a mechanism applies to the 170-kDa Env-Bet protein, we examined the neutralization capacity of several chimpanzee sera on different recombinant HFVs in vitro. Supernatants containing wild-type or SD mutant virions were generated by transient transfection of 293T cells with pcHSRV2 wt and pcHSRV2 EM4,
respectively. Subsequently, a specific amount of virus (500 FFU) was
preincubated with different dilutions of chimpanzee sera shown to be
reactive with all major HFV proteins (data not shown), before the
addition to the indicator cells. At 48 h after the addition of the
virus-serum mixture, the cells were lysed and the Tas/Bel1-dependent
expression of -galactosidase was determined in an enzymatic assay.
Both viruses, HSRV2 wt and HSRV2 EM4, were neutralized by the different sera to a similar extent (Fig. 7).
However, the overall amount of -galactosidase produced by HSRV2 EM4
was reproducibly reduced about twofold, although the same amount of
infectious virus, as determined by a focus formation assay on
BHK/LTRlacz cells, was used as the inoculum. These results provide
evidence that the generation of the 170-kDa Env-Bet protein may not be
used to affect the host antiviral immune response, at least to the
extent possible in this in vitro assay.
|
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
HFV has been reported previously to express a protein of about 170 kDa that is recognized by Env- and Bel-specific antisera (9). In this work, we demonstrated by RIPA with various antisera that the 170-kDa reactive band is an Env-Bet fusion protein. Furthermore, using site-directed mutagenesis of splice site consensus sequences and RT-PCR analysis, we could show that it is generated by an alternatively spliced env mRNA that employs SD-SA pairs located within the env and bel1/2 ORFs, which are normally used to generate Bel1 and Bet transcripts derived from the internal promoter within the env ORF. This is by analogy to other retroviruses that express fusion proteins between env and accessory gene products. Human immunodeficiency virus (HIV), for example, generates a Tat-Env-Rev fusion protein termed Tev (2) and other Tat- and Rev-related Env fusion proteins (8, 13, 33) from alternatively spliced mRNAs, some of which retain the activities of the accessory gene products. What distinguishes the Env-Bet fusion protein from these is that the HFV gp170 contains the complete extracellular part of the Env protein whereas the former proteins contain only small segments of the env coding regions. Strikingly, the Env-Bet fusion protein lacks the MSD and cytoplasmic domain of the 130-kDa Env precursor protein, resulting in a targeting to the secretory pathway. Indeed, the Env-Bet fusion protein and its cleavage products, SU and TM-Bet, could be detected in the supernatant of transfected 293T cells (Fig. 4A). Interestingly, in the absence of expression of the 130-kDa Env protein, even larger amounts of the Env-Bet fusion protein and its cleavage product could be detected in the supernatant. The reason for this is unclear at present. However, we were not able to detect particle-associated Env-Bet protein. This implies that the Env-Bet protein plays no direct role in the virus entry process. This is further supported by the findings that FV vectors provided in trans with either gp130 alone or gp130 plus gp170 showed similar relative infectivity and that viruses lacking the Env-Bet protein displayed similar replication kinetics to wild-type virus in vitro. Taken together, the results presented in this report show that gp170 is dispensable for HFV replication in vitro. However, it remains to be seen how the different mutant viruses behave in vivo.
Interestingly, the SD-SA pair within the env ORF used to generate the Env-Bet fusion proteins is highly conserved within FV isolates from different primates, arguing for an important role of the Env-Bet fusion in the virus life cycle. The large amount of gp170 detected in infected cells relative to the gp130 Env precursor is a further argument in favor of the view that the Env-Bet fusion protein plays an important role in FV replication in vivo.
It has been suggested that Env protein shed by HIV particles may affect the host immune system (30). We therefore investigated whether wild-type HFV may be more resistant to neutralization by chimpanzee sera than is a mutant lacking gp170. However, we were unable to demonstrate any difference between HSRV2 wt and HSRV2 EM4 in a neutralization assay. The result implies that the Env-Bet protein is not used to counteract the host humoral immune response, at least as far as can be determined by this in vitro test.
gp170 may also exert its function through the Bet part of the fusion protein. Since no assay system for Bet is available yet and since the function of Bet is virtually unknown, this aspect could not be analyzed in the present study.
The real role of the Env-Bet protein in the FV life cycle will probably be revealed only by examination of different mutant viruses in vivo, as has been done for the HIV/SIV accessory protein Nef, which is also dispensable for in vitro growth (15, 19) but is necessary for high virus loads and establishment of productive infections in the host (18). It will be interesting to see whether there is a selection pressure to retain the expression of the Env-Bet protein in vivo. The use of a small-animal model for HFV infection (34) may be instrumental in shedding more light on the potential function of gp170 in the FV life cycle.
| |
ACKNOWLEDGMENTS |
|---|
We thank A. Saib and H. de The for communicating results prior to publication and R. M. Flügel for the Bel1 specific antiserum.
This work was supported by the EU (BMH4-CT97-2010), Bayerische Forschungsstiftung, and DFG (SFB 165). D.L. is supported by the virology fellowship program of the BMBF, Germany.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Institut für Virologie und Immunbiologie, Universität Würzburg, Versbacher Str. 7, D-97078 Würzburg, Germany. Phone: 49-931-201-3964. Fax: 49-931-201-3934. E-mail: viro066{at}rzbox.uni-wuerzburg.de.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Baunach, G.,
B. Maurer,
H. Hahn,
M. Kranz, and A. Rethwilm.
1993.
Functional analysis of human foamy virus accessory reading frames.
J. Virol.
67:5411-5418 |
| 2. |
Benko, D. M.,
S. Schwartz,
G. N. Pavlakis, and B. K. Felber.
1990.
A novel human immunodeficiency virus type 1 protein, Tev, shares sequences with Tat, Env, and Rev proteins.
J. Virol.
64:2505-2518 |
| 3. | Bieniasz, P. D., O. Erlwein, A. Aguzzi, A. Rethwilm, and M. O. McClure. 1997. Gene transfer using replication-defective human foamy virus vectors. Virology 235:65-72[Medline]. |
| 4. | Bieniasz, P. D., A. Rethwilm, R. Pitman, M. D. Daniel, I. Chrystie, and M. O. McClure. 1995. A comparative study of higher primate foamy viruses, including a new virus from a gorilla. Virology 207:217-228[Medline]. |
| 5. |
Du Bridge, R. B.,
P. Tang,
H. C. Hsia,
P. M. Leong,
J. H. Miller, and M. P. Calos.
1987.
Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system.
Mol. Cell. Biol.
7:379-387 |
| 6. |
Enssle, J.,
I. Jordan,
B. Mauer, and A. Rethwilm.
1996.
Foamy virus reverse transcriptase is expressed independently from the gag protein.
Proc. Natl. Acad. Sci. USA
93:4137-4141 |
| 7. |
Fischer, N.,
M. Heinkelein,
D. Lindemann,
J. Enssle,
C. Baum,
E. Werder,
H. Zentgraf,
J. G. Müller, and A. Rethwilm.
1998.
Foamy virus particle formation.
J. Virol.
72:1610-1615 |
| 8. | Furtado, M. R., R. Balachandran, P. Gupta, and S. M. Wolinsky. 1991. Analysis of alternatively spliced human immunodeficiency virus type-1 mRNA species, one of which encodes a novel tat-env fusion protein. Virology 185:258-270[Medline]. |
| 9. |
Giron, M. L.,
F. Rozain,
M. C. Debons-Guillemin,
M. Canivet,
J. Peries, and R. Emanoil-Ravier.
1993.
Human foamy virus polypeptides: identification of env and bel gene products.
J. Virol.
67:3596-3600 |
| 10. | Goepfert, P. A., K. L. Shaw, G. D. Ritter, Jr., and M. J. Mulligan. 1997. A sorting motif localizes the foamy virus glycoprotein to the endoplasmic reticulum. J. Virol. 71:778-784[Abstract]. |
| 11. | Goepfert, P. A., G. Wang, and M. J. Mulligan. 1995. Identification of an ER retrieval signal in a retroviral glycoprotein. Cell 82:543-544[Medline]. |
| 12. | Green, M. R. 1986. Pre-mRNA splicing. Annu. Rev. Genet. 20:671-708[Medline]. |
| 13. |
Guatelli, J. C.,
T. R. Gingeras, and D. D. Richman.
1990.
Alternative splice acceptor utilization during human immunodeficiency virus type 1 infection of cultured cells.
J. Virol.
64:4093-4098 |
| 14. |
Hahn, H.,
G. Baunach,
S. Bräutigam,
A. Mergia,
D. Neumann-Haefelin,
M. D. Daniel,
M. O. McClure, and A. Rethwilm.
1994.
Reactivity of primate sera to foamy virus Gag and Bet proteins.
J. Gen. Virol.
75:2635-2644 |
| 15. |
Hammes, S. R.,
E. P. Dixon,
M. H. Malim,
B. R. Cullen, and W. C. Greene.
1989.
Nef protein of human immunodeficiency virus type 1: evidence against its role as a transcriptional inhibitor.
Proc. Natl. Acad. Sci. USA
86:9549-9553 |
| 16. | He, F., W. S. Blair, J. Fukushima, and B. R. Cullen. 1996. The human foamy virus Bel-1 transcription factor is a sequence-specific DNA binding protein. J. Virol. 70:3902-3908[Abstract]. |
| 17. |
Keller, A.,
K. M. Partin,
M. Löchelt,
H. Bannert,
R. M. Flügel, and B. R. Cullen.
1991.
Characterization of the transcriptional trans activator of human foamy retrovirus.
J. Virol.
65:2589-2594 |
| 18. | Kestler, H. W. D., D. J. Ringler, K. Mori, D. L. Panicali, P. K. Sehgal, M. D. Daniel, and R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651-662[Medline]. |
| 19. |
Kim, S.,
K. Ikeuchi,
R. Byrn,
J. Groopman, and D. Baltimore.
1989.
Lack of a negative influence on viral growth by the nef gene of human immunodeficiency virus type 1.
Proc. Natl. Acad. Sci. USA
86:9544-9548 |
| 20. | Lehrmann, H., D. Lindemann, S. Bräutigam, and A. Rethwilm. Expression of foamy virus envelope proteins by recombinant baculoviruses and generation of protein-specific antisera. Submitted for publication. |
| 21. | Lindemann, D., M. Bock, M. Schweizer, and A. Rethwilm. 1997. Efficient pseudotyping of murine leukemia virus particles with chimeric human foamy virus envelope proteins. J. Virol. 71:4815-4820[Abstract]. |
| 22. |
Löchelt, M.,
R. M. Flügel, and M. Aboud.
1994.
The human foamy virus internal promoter directs the expression of the functional Bel 1 transactivator and Bet protein early after infection.
J. Virol.
68:638-645 |
| 23. |
Löchelt, M.,
W. Muranyi, and R. M. Flügel.
1993.
Human foamy virus genome possesses an internal, Bel-1-dependent and functional promoter.
Proc. Natl. Acad. Sci. USA
90:7317-7321 |
| 24. |
Mergia, A.,
K. E. Shaw,
E. Pratt Lowe,
P. A. Barry, and P. A. Luciw.
1991.
Identification of the simian foamy virus transcriptional transactivator gene (taf).
J. Virol.
65:2903-2909 |
| 25. | Moebes, A., J. Enssle, P. D. Bieniasz, M. Heinkelein, D. Lindemann, M. Bock, M. O. McClure, and A. Rethwilm. 1997. Human foamy virus reverse transcription that occurs late in the viral replication cycle. J. Virol. 71:7305-7311[Abstract]. |
| 26. | Montell, C., E. F. Fisher, M. H. Caruthers, and A. J. Berk. 1982. Resolving the functions of overlapping viral genes by site-specific mutagenesis at a mRNA splice site. Nature 295:380-384[Medline]. |
| 27. |
Muranyi, W., and R. M. Flügel.
1991.
Analysis of splicing patterns of human spumaretrovirus by polymerase chain reaction reveals complex RNA structures.
J. Virol.
65:727-735 |
| 28. | Namba, M., K. Nishitani, F. Hyodoh, F. Fukushima, and T. Kimoto. 1985. Neoplastic transformation of human diploid fibroblasts (KMST-6) by treatment with 60Co gamma rays. Int. J. Cancer 35:275-280[Medline]. |
| 29. |
Netzer, K. O.,
A. Rethwilm,
B. Maurer, and V. ter Meulen.
1990.
Identification of the major immunogenic structural proteins of human foamy virus.
J. Gen. Virol.
71:1237-1241 |
| 30. |
Parren, W. H.,
D. R. Burton, and Q. J. Sattentau.
1997.
HIV-1 antibody debris or virion?
Nat. Med.
3:366-367[Medline].
|
| 31. |
Rethwilm, A.,
O. Erlwein,
G. Baunach,
B. Maurer, and V. ter Meulen.
1991.
The transcriptional transactivator of human foamy virus maps to the bel 1 genomic region.
Proc. Natl. Acad. Sci. USA
88:941-945 |
| 32. | Saib, A., J. Peries, and H. d. The. 1993. A defective human foamy provirus generated by pregenome splicing. EMBO J. 12:4439-4444[Medline]. |
| 33. | Salfeld, J., H. G. Göttlinger, R. A. Sia, R. E. Park, J. G. Sodroski, and W. A. Haseltine. 1990. A tripartite HIV-1 tat-env-rev fusion protein. EMBO J. 9:965-970[Medline]. |
| 34. | Schmidt, M., S. Niewiesk, J. Heeney, A. Aguzzi, and A. Rethwilm. 1997. Mouse model to study the replication of primate foamy viruses. J. Gen. Virol. 78:1929-1933[Abstract]. |
| 35. | Schmidt, M., and A. Rethwilm. 1995. Replicating foamy virus-based vectors directing high level expression of foreign genes. Virology 210:167-178[Medline]. |
| 36. | Weiss, R. A. 1996. Foamy viruses bubble on. Nature 380:201[Medline]. |
| 37. | Yu, S. F., D. N. Baldwin, S. R. Gwynn, S. Yendapalli, and M. L. Linial. 1996. Human foamy virus replication: a pathway distinct from that of retroviruses and hepadnaviruses. Science 271:1579-1582[Abstract]. |
| 38. |
Zou, J. X., and P. A. Luciw.
1996.
The transcriptional transactivator of simian foamy virus 1 binds to a DNA target element in the viral internal promoter.
Proc. Natl. Acad. Sci. USA
93:326-330 |
J Virol, May 1998, p. 4088-4094, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Stange, A., Luftenegger, D., Reh, J., Weissenhorn, W., Lindemann, D.
(2008). Subviral Particle Release Determinants of Prototype Foamy Virus. J. Virol.
82: 9858-9869
[Abstract] [Full Text] -
Mannigel, I., Stange, A., Zentgraf, H., Lindemann, D.
(2007). Correct Capsid Assembly Mediated by a Conserved YXXLGL Motif in Prototype Foamy Virus Gag Is Essential for Infectivity and Reverse Transcription of the Viral Genome. J. Virol.
81: 3317-3326
[Abstract] [Full Text] -
Delebecque, F., Suspene, R., Calattini, S., Casartelli, N., Saib, A., Froment, A., Wain-Hobson, S., Gessain, A., Vartanian, J.-P., Schwartz, O.
(2006). Restriction of Foamy Viruses by APOBEC Cytidine Deaminases. J. Virol.
80: 605-614
[Abstract] [Full Text] -
Stanke, N., Stange, A., Luftenegger, D., Zentgraf, H., Lindemann, D.
(2005). Ubiquitination of the Prototype Foamy Virus Envelope Glycoprotein Leader Peptide Regulates Subviral Particle Release. J. Virol.
79: 15074-15083
[Abstract] [Full Text] -
Cartellieri, M., Herchenroder, O., Rudolph, W., Heinkelein, M., Lindemann, D., Zentgraf, H., Rethwilm, A.
(2005). N-Terminal Gag Domain Required for Foamy Virus Particle Assembly and Export. J. Virol.
79: 12464-12476
[Abstract] [Full Text] -
Luftenegger, D., Picard-Maureau, M., Stanke, N., Rethwilm, A., Lindemann, D.
(2005). Analysis and Function of Prototype Foamy Virus Envelope N Glycosylation. J. Virol.
79: 7664-7672
[Abstract] [Full Text] -
Stange, A., Mannigel, I., Peters, K., Heinkelein, M., Stanke, N., Cartellieri, M., Gottlinger, H., Rethwilm, A., Zentgraf, H., Lindemann, D.
(2005). Characterization of Prototype Foamy Virus Gag Late Assembly Domain Motifs and Their Role in Particle Egress and Infectivity. J. Virol.
79: 5466-5476
[Abstract] [Full Text] -
Duda, A., Stange, A., Luftenegger, D., Stanke, N., Westphal, D., Pietschmann, T., Eastman, S. W., Linial, M. L., Rethwilm, A., Lindemann, D.
(2004). Prototype Foamy Virus Envelope Glycoprotein Leader Peptide Processing Is Mediated by a Furin-Like Cellular Protease, but Cleavage Is Not Essential for Viral Infectivity. J. Virol.
78: 13865-13870
[Abstract] [Full Text] -
Heinkelein, M., Rammling, M., Juretzek, T., Lindemann, D., Rethwilm, A.
(2003). Retrotransposition and Cell-to-Cell Transfer of Foamy Viruses. J. Virol.
77: 11855-11858
[Abstract] [Full Text] -
Shikova-Lekova, E., Lindemann, D., Pietschmann, T., Juretzek, T., Rudolph, W., Herchenroder, O., Gelderblom, H. R., Rethwilm, A.
(2003). Replication-Competent Hybrids between Murine Leukemia Virus and Foamy Virus. J. Virol.
77: 7677-7681
[Abstract] [Full Text] -
Picard-Maureau, M., Jarmy, G., Berg, A., Rethwilm, A., Lindemann, D.
(2003). Foamy Virus Envelope Glycoprotein-Mediated Entry Involves a pH-Dependent Fusion Process. J. Virol.
77: 4722-4730
[Abstract] [Full Text] -
Meiering, C. D., Linial, M. L.
(2002). Reactivation of a complex retrovirus is controlled by a molecular switch and is inhibited by a viral protein. Proc. Natl. Acad. Sci. USA
99: 15130-15135
[Abstract] [Full Text] -
Lecellier, C.-H., Neves, M., Giron, M.-L., Tobaly-Tapiero, J., Saib, A.
(2002). Further Characterization of Equine Foamy Virus Reveals Unusual Features among the Foamy Viruses. J. Virol.
76: 7220-7227
[Abstract] [Full Text] -
Lecellier, C.-H., Vermeulen, W., Bachelerie, F., Giron, M.-L., Saib, A.
(2002). Intra- and Intercellular Trafficking of the Foamy Virus Auxiliary Bet Protein. J. Virol.
76: 3388-3394
[Abstract] [Full Text] -
Meiering, C. D., Rubio, C., May, C., Linial, M. L.
(2001). Cell-Type-Specific Regulation of the Two Foamy Virus Promoters. J. Virol.
75: 6547-6557
[Abstract] [Full Text] -
Lindemann, D., Pietschmann, T., Picard-Maureau, M., Berg, A., Heinkelein, M., Thurow, J., Knaus, P., Zentgraf, H., Rethwilm, A.
(2001). A Particle-Associated Glycoprotein Signal Peptide Essential for Virus Maturation and Infectivity. J. Virol.
75: 5762-5771
[Abstract] [Full Text] -
Pietschmann, T., Zentgraf, H., Rethwilm, A., Lindemann, D.
(2000). An Evolutionarily Conserved Positively Charged Amino Acid in the Putative Membrane-Spanning Domain of the Foamy Virus Envelope Protein Controls Fusion Activity. J. Virol.
74: 4474-4482
[Abstract] [Full Text] -
Tobaly-Tapiero, J., Bittoun, P., Neves, M., Guillemin, M.-C., Lecellier, C.-H., Puvion-Dutilleul, F., Gicquel, B., Zientara, S., Giron, M.-L., de Thé, H., Saïb, A.
(2000). Isolation and Characterization of an Equine Foamy Virus. J. Virol.
74: 4064-4073
[Abstract] [Full Text] -
Heinkelein, M., Thurow, J., Dressler, M., Imrich, H., Neumann-Haefelin, D., McClure, M. O., Rethwilm, A.
(2000). Complex Effects of Deletions in the 5' Untranslated Region of Primate Foamy Virus on Viral Gene Expression and RNA Packaging. J. Virol.
74: 3141-3148
[Abstract] [Full Text] -
Bansal, A., Shaw, K. L., Edwards, B. H., Goepfert, P. A., Mulligan, M. J.
(2000). Characterization of the R572T Point Mutant of a Putative Cleavage Site in Human Foamy Virus Env. J. Virol.
74: 2949-2954
[Abstract] [Full Text] -
Enssle, J, Moebes, A, Heinkelein, M, Panhuysen, M, Mauer, B, Schweizer, M, Neumann-Haefelin, D, Rethwilm, A
(1999). An active foamy virus integrase is required for virus replication. J. Gen. Virol.
80: 1445-1452
[Abstract] -
Pietschmann, T., Heinkelein, M., Heldmann, M., Zentgraf, H., Rethwilm, A., Lindemann, D.
(1999). Foamy Virus Capsids Require the Cognate Envelope Protein for Particle Export. J. Virol.
73: 2613-2621
[Abstract] [Full Text] -
Linial, M. L.
(1999). Foamy Viruses Are Unconventional Retroviruses. J. Virol.
73: 1747-1755
[Full Text] -
Heinkelein, M., Schmidt, M., Fischer, N., Moebes, A., Lindemann, D., Enssle, J., Rethwilm, A.
(1998). Characterization of a cis-Acting Sequence in the pol Region Required To Transfer Human Foamy Virus Vectors. J. Virol.
72: 6307-6314
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»