Previous Article | Next Article ![]()
J Virol, May 1998, p. 3973-3979, Vol. 72, No. 5
Department of Pathology, Duke University
Medical Center, Durham, North Carolina
27705,1 and
Division of
Hematology/Oncology, Mayo Clinic, Jacksonville, Florida
322242
Received 24 September 1997/Accepted 20 January 1998
C57BL/10 (B10) strains congenic at the mouse major
histocompatibility locus (H-2) were injected with a
modified ecotropic SL3-3 murine leukemia virus (MuLV) to determine the
effect of the H-2 genes on the envelope gene structure of
recombinant MuLVs. All tested strains rapidly developed T-cell
lymphomas, and recombinant proviruses were detected in the tumor DNAs
by Southern blot. The B10.D2 (H-2d), B10.Br
(H-2k), B10.Q (H-2q),
and B10.RIII (H-2r) strains exhibited a TI
phenotype in which almost all tumors contained type I recombinants.
These recombinants characteristically acquire envelope gene sequences
from the endogenous polytropic viruses but retain the 5' p15E (TM) gene
sequences from the ecotropic virus. The parental B10
(H-2b) strain, however, had a novel phenotype
that was designated NS for nonselective. Only 30% of the B10 tumors
had detectable type I recombinants, whereas a proportion of the others
appeared to contain type II recombinants that lacked the type
I-specific ecotropic p15E gene sequences. Studies of other B10 congenic
strains with hybrid H-2 loci and selected F1
animals revealed that the NS phenotype was regulated by a dominant
gene(s) that mapped to the A region of H-2b.
These results demonstrate that a host gene within the major histocompatibility complex can influence the genetic evolution of
pathogenic retroviruses in vivo.
The consequences of retrovirus
infections in mice, cats, sheep, and humans may depend on the genetic
evolution of pathogenic retroviruses in vivo (4, 29).
Spontaneous mutations and recombination between different viral genomes
create genetic diversity in the virus population. This allows for the
selection of those variants that replicate more efficiently and are
more pathogenic than the original dominant species in the viral
population. In the inbred mouse strains AKR, HRS, C58, and CWD, the
generation and selection of pathogenic recombinant murine leukemia
viruses (MuLVs) is an important step in the development of
spontaneous lymphomas (3, 5, 13, 15, 17, 23, 32, 33, 35).
Animals of these strains express early in life endogenous
ecotropic MuLVs that subsequently acquire pathogenic sequences by
recombination with endogenous polytropic and xenotropic viruses.
Similarly, the injection of exogenous ecotropic MuLVs, such as
SL3-3, into these or other susceptible strains induces leukemias and
the formation of envelope gene recombinants (6, 10, 31). The
recombinants typically incorporate 5' envelope gene sequences
from one or more of the 20 or so endogenous polytropic viruses. This
portion of the gene encodes the receptor binding domain of the major
envelope protein, SU or gp70, and thus confers a polytropic host range
(2, 3, 5, 13, 15, 17, 23, 27, 32, 33, 35). The polytropic domain within gp70 appears to promote leukemogenesis by enhancing virus
replication in lymphoid target cells and through the activation of
growth factor signaling pathways (3, 22, 39).
The MuLV envelope gene (env) encodes a common precursor
protein, gp85, that is cleaved to yield two products, the mature gp70 and the minor envelope protein, TM or p15E (12, 43). The 5' portion of the gp70 gene of the recombinant viruses is composed of
sequences inherited from the endogenous polytropic viruses, but the 5'
portion of the p15E gene may be derived from either the ecotropic
or polytropic virus parent (6, 23, 32, 35, 37). Recombinants
in which the 5' p15E gene contains ecotropic virus sequences are
classified as type I recombinants, whereas those that acquire the
allelic polytropic virus sequences in this region are designated type
II recombinants (Fig. 1; references 6 and 23). We had previously
shown that the presence of type I or type II recombinants within
lymphoma cells is influenced by a host gene located on mouse chromosome
17. In these experiments, the injection of the ecotropic SL3-3 MuLV
induced tumors and type I recombinants in HRS/J mice, whereas tumors
from injected CWD mice contained type II recombinants (6, 32,
37). The type I-forming phenotype (TI) of HRS/J mice was dominant
with respect to the type II-forming phenotype (TII) of CWD mice and
segregated with restriction fragment length polymorphisms on chromosome
17 which are located within the H-2 locus, the mouse major
histocompatibility complex.
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Mouse H-2A Region Influences the Envelope Gene
Structure of Tumor-Associated Murine Leukemia Viruses
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (22K):
[in a new window]
FIG. 1.
Predicted amino acid sequences of p15E proteins of type
I and type II recombinant MuLVs in relationship to known or suspected
functional domains. Underlined residues may participate in the
formation of a leucine zipper-like region.
The earlier genetic studies of the TI gene of HRS/J and CBA/J mice and the observation that all H-2k strains exhibited the TI phenotype suggested that the TI gene(s) may be located within or near the H-2 locus (6, 23, 32, 37). To test if the H-2 genes regulate the TI or TII phenotype, we injected a modified ecotropic SL3-3 MuLV into C57BL/10 (B10) strains that were congenic at H-2. As reported here, we discovered that all strains tested except the parental B10 were TI strains. The latter strain exhibited a new phenotype, referred to as NS for nonselective, in which one-half or less of the tumors contained detectable type I recombinant proviruses. The B10 NS phenotype was distinct from and dominant with respect to TI and TII phenotypes of other strains and was regulated by a gene(s) that is located in or near H-2Ab.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Mice. CWD breeding stock (cw/+ and cw/cw) was obtained from the Jackson Laboratory, Bar Harbor, Maine, and was maintained at the University of Virginia vivarium (cw/+ to cw/cw). A breeding colony of CWD mice has been continuously maintained by brother-sister matings for 8 years. H-2 congenic and intra-H-2 recombinant congenic mice were obtained from the Jackson Laboratory.
Leukemogenesis. To induce leukemia, 0.05 to 0.1 ml of reverse transcriptase-positive supernatants from SL3-3NB-infected NIH 3T3 fibroblasts was injected into the peritoneal cavity of animals less than 48 h old (6). The animals were observed regularly for signs of disease and sacrificed by metafane inhalation when moribund. Animals that died in their cages were refrigerated until necropsy. Spleen, thymus, and any other affected tissues were cut into aliquots and immediately stored in liquid nitrogen for use in DNA extraction at a later date.
DNA isolation. DNA was extracted from tumor tissue aliquots that had been stored in liquid nitrogen by one of two methods. The organic extraction method has been described previously (6). The second was a nonorganic extraction method in which tissue aliquots were added to 5 ml of STE buffer (150 mM NaCl, Tris-Cl [pH 7.4], 20 mM EDTA) and homogenized in 15-ml glass grinders. Homogenate was transferred to fresh tubes, and 5 ml of STE buffer and 1 ml of 10% sodium dodecyl sulfate were added. Homogenate was digested with proteinase K (200 µg/ml) at 50°C for 4 to 5 h. Protein was precipitated by the addition of 3 ml of saturated NaCl solution and vigorous agitation. Following centrifugation, supernatant was transferred to a fresh 50-ml tube, and 2 volumes of room temperature 100% ethanol was added. The DNA precipitate was pelleted and washed with room temperature 70% ethanol. DNA was then lyophilized and resuspended in Tris-EDTA (10:1) at a concentration of between 0.150 and 2.0 mg/ml.
Southern blotting, hybridization probes, and labeling. Five micrograms of DNA was digested with the appropriate restriction enzyme(s) and blotted by using techniques described previously (6). The pAKV5 probe, a subcloned fragment of the 5' portion of the AKV ecotropic p15E TM gene, was the gift of Winship Herr (18). The TCRbeta probe hybridizes to both C1 and C2 regions of the beta chain of the T-cell receptor and was a gift of Tak Mak. The probes for the immunoglobulin heavy-chain joining region (JH) and the light-chain joining region (Jkappa) were gifts of Roger Perlmutter.
All probes were excised from the plasmids by digestion with the appropriate restriction enzymes and purified from low-melting-point agarose gels after electrophoresis. The fragments were labeled with 32P by the random primer-extension method, using a kit from Boehringer Mannheim (Indianapolis, Ind.).Amplification of viral sequences by PCR. PCR was used to selectively amplify envelope and long terminal repeat (LTR) sequences of recombinant viruses. A master mix of buffer, MgCl2, and Amplitaq (Perkin-Elmer Cetus, Norwalk, Conn.) was added to 500 ng of each DNA sample. Tubes were heated to 84°C in a DNA Thermal Cycler (Perkin-Elmer Cetus), at which point a second mix containing primers and nucleotides was added. The reaction mix was then topped off with a single drop of mineral oil. A 2-min incubation at 94°C was followed by 30 cycles of 1 min at 94°C, 1 min at 49°C, and 30 s at 72°C. Cycles were followed by a single-step incubation at 72°C for 2 min that was immediately followed by 4°C incubation until samples could be analyzed. The presence of PCR product was confirmed by running 2.5 µl of reaction mix on a 1.5% agarose gel in using Tris-agarose-EDTA buffer.
The final volume for all PCRs was 25 µl. With the exception of primers, all reagents were provided by Perkin-Elmer Cetus. Final concentrations of reagents were 200 mM each of the four deoxynucleoside triphosphates, 1× PCR buffer II, 2.5 mM MgCl2, 0.02 U of Amplitaq per ml, 20 ng of the experimental DNA template per ml, and 0.5 mM each primer. Primers were obtained from the University of Virginia sequencing facility. The 5' primer was GCGAATTCTCTATAGTCCCTGAGACTG, which is specific for polytropic gp70 sequences, and the 3' primer was TTCCCGGGTCTCTTGAAACTGTTGTTG, which is specific for ecotropic sequences in the LTR.Cloning and DNA analysis.
PCR products were cloned by using
the TA cloning system (Invitrogen, San Diego, Calif.) according to
the manufacturer's directions. In brief, PCR mixtures were diluted
1:100, and 1 µl was added to 6 µl of sterile water, 1 µl of 10×
ligation buffer, 2 µl of pCR vector (25 ng/µl), and 1 µl of T4
DNA ligase and incubated at 9°C overnight. One microliter of this TA
ligation reaction was transformed into 50 µl of competent
Escherichia coli INVaF cells to which was added
450 µl of SOC medium for a total volume of 500 µl; 25 µl was
plated on LB agar plates containing kanamycin (50 mg/ml) and
5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside (X-Gal;
50 ng/ml). White colonies were screened by using selective restriction
enzyme digests and sequenced by using a dideoxy-based Sequenase kit
from U.S. Biochemical (Cleveland, Ohio). The primers used for PCR were
also used for DNA sequence analysis. Internal primers which anneal to
both polytropic and ecotropic p15E
sequences, CCGCCCATAGTAAGTCCTCC and CATTCTTCTTTTAGGGCAGCAC, were
also obtained from the University of Virginia sequencing facility.
[35S]dATP-labeled reaction products were
run on 8% urea-acrylamide gels with TBA (40 mM Tris, 20 mM boric acid,
2 mM EDTA) buffer.
Statistics. The statistical significance of differences in disease latencies and lymphoma incidence were determined by Student's t test. The assignment of phenotypes of the B10 strains was confirmed statistically by the Wilcoxon rank sum test, a nonparametric substitution for the t test. Analyses were performed with Medlog version 92.4a (Information Analysis Corporation) as previously described (23). The Wilcoxon rank sum test showed that the ratio of type I provirus-containing lymphomas to total lymphomas for the B10 strain (NS) was statistically different from this ratio for the congenic strains which expressed the TI phenotype. P values were 0.001 for comparison of B10.Br to B10, 0.001 for comparison of B10.D2 to B10, and 0.003 for comparison of B10.Q to B10.
| |
RESULTS |
|---|
|
|
|---|
The SL3-3NB virus induces T-cell lymphomas in B10 and B10 H-2 congenic mice. To determine the recombinant virus-forming phenotype of B10 mice and four related H-2 congenic strains, neonatal animals were injected with the SL3-3NB ecotropic MuLV. SL3-3NB is derived from a modified AKR SL3-3 MuLV provirus in which 200 bp of the gag gene is derived from the Moloney MuLV (36). This confers NB tropism and negates the suppressive effects of the B10 Fv-1b allele on viral replication and leukemogenecity (20, 36). SL3-3NB rapidly induced lymphoma in each of the H-2 congenic strains, and the majority of animals developed both thymic and splenic tumors. As shown in Table 1, the incidence of lymphoma varied from 80 to 100% and latencies ranged from 4.6 to 6.4 months. Analysis of selected tumors by histopathology revealed lymphoblastic lymphomas, which is compatible with thymic or nonthymic T-cell lymphomas. Southern blot analysis confirmed that the tumors were of T-cell origin, as all tested tumors contained rearrangements of the T-cell receptor beta chain, with or without rearranged immunoglobulin heavy-chain genes (data not shown).
|
|
|
B10 recombinant virus contains endogenous polytropic envelope gene sequences. Given the novel phenotype of the B10 mice, it was important to confirm that the structure of the envelope genes of the B10 recombinants was similar to that found in recombinants recovered from other mouse strains. A portion of the envelope gene of a type I-like recombinant virus from B10 tumor E9 was amplified by PCR and cloned into a plasmid vector for subsequent DNA sequence analysis. In Fig. 4, the sequence of the E9-TA9 PCR fragment is compared to sequences of envelope genes of endogenous and other recombinant MuLVs. The nonecotropic sequences found in the envelope gene of the B10 E9-TA9 virus were highly homologous to those found in the HRS/J endogenous polytropic virus and recombinant viruses from other strains. This observation argues that the SL3-3-induced recombinant viruses in B10 mice acquire endogenous polytropic virus sequences by a process that is identical or highly similar to that utilized by recombinants from the other strains. Thus, it is unlikely that a unique recombination process or envelope gene donor in B10 mice confers the NS phenotype.
|
The NS phenotype of B10 mice is linked to H-2Ab. To map the region within H-2 that regulates the NS or TI phenotype, we studied SL3-3NB-induced tumors recovered from B10 H-2 congenic strains that carry hybrid H-2 regions and tumors from selected F1 crosses. The results of the Southern blot analysis are summarized in Table 2. The B10A(4R) strain exhibited a TI phenotype, which indicated that the NS phenotype was not conferred by the H-2Eb or H-2Db locus or adjacent genes. A role for H-2Kb was also excluded since B10.MBR mice had a TI phenotype. However, B10.A(5R) mice appeared to be an NS strain since only 3 of 10 tumors contained type I recombinants. This result strongly suggests that the NS phenotype is regulated by H-2Ab or an adjacent sequence, such as an LMP or TAP gene.
|
| |
DISCUSSION |
|---|
|
|
|---|
The major finding of this study is that a host gene(s) that maps to the H-2Ab region influenced the envelope gene structure of tumor-associated recombinant MuLVs. Also, the H-2b strain B10 exhibited a novel phenotype in which about 30% of the SL3-3NB-induced tumors contained type I recombinant MuLVs. At least a portion of the other tumors appeared to contain type II recombinants. The B10 phenotype, designated NS for nonselective, was distinct from the TI phenotype of other mouse strains in which type I recombinants are found in almost all tumors and the TII phenotype in which type II recombinants can be detected but type I recombinants are absent (6, 32). Based on the analysis of the H-2 recombinant strains, B10.A(4R), B10A.(5R), and B10.MBR, the sequences that confer the NS phenotype were located within or near H-2Ab. The NS phenotype of both B10 and B10.A(5R) mice proved to be dominant in crosses with the TI strains, B10.Br and B10.MBR, and the TII strain, CWD.
Whether the NS gene is allelic to the TI and TII genes is not clear. As discussed earlier, there are data to suggest that the TI gene is also located within H-2. For instance, the TI phenotypes of HRS/J and CBA/J mice are linked to polymorphisms located within the H-2A region (6). Also, all H-2k strains that have been tested, including HRS/J, CBA/J, and B10.Br, exhibit the TI phenotype, whereas B10 mice and another H-2b strain, C57L/J, appear to share the NS phenotype (5a). On the other hand, the H-2Ad region alone does not appear to confer the TI phenotype to the CWD strain. As determined by genetic markers, CWD mice appear to carry H-2Ad sequences yet have a TII phenotype (26a).
How did the H-2Ab genes confer the NS phenotype to B10 and B10.A(5R) mice? We propose that the NS gene, like the TI gene, acts at a step that is subsequent to the generation of the recombinant viruses (34). This hypothesis is supported by the analysis of the gp70 and p15E gene sequences of the B10 recombinant E9. The results suggest that the process of recombination between the parental SL3-3NB and endogenous polytropic viruses in B10 mice is similar or identical to that seen in other strains that generate either type I or type II recombinants. Moreover, the known candidates for the NS gene, H-2A, LMP-2, LMP-7, TAP-1, and TAP-2, all encode products that are involved in antigen processing, transport, or presentation (1, 25, 38). This implies that the presence or absence of type-specific antiviral immune responses is responsible for the different phenotypes. The H-2 region is known to influence the oncogenicity and disease latency of exogenous or endogenous MuLVs in other systems. In some cases, the effects of the H-2 genes may be mediated by antiviral immune responses directed against the envelope proteins (16, 19, 26, 30, 40-42, 46, 47). T-cell epitopes have been found in the p15E proteins of the Friend and AKV MuLVs, although these are found outside the type-specific domain (6, 7, 24, 34). Whether any of these reported immune responses to the envelope proteins would be capable of mediating the selection of specific types of recombinant viruses is not known.
One explanation for the results shown here is that the H-2 genes regulate type-specific immune responses. The p15E proteins of type I and type II recombinants differ from one another by 10 amino acids which are clustered in the amino-terminal portion of the molecule and thus are likely to be immunologically distinct (Fig. 1; references 6 and 34). Also, H-2Ab and LMP-2b encode proteins that are involved in antigen processing or presentation. These two loci appear to be the best candidates for the NS gene, since the cognate proteins have the greatest degree of nonhomology compared to the analogous non-H2b proteins (38, 44, 45). It is tempting to speculate that the NS phenotype is related to the failure of H-2Ab of the NS strains to mount antiviral responses directed against type I- or type II-specific p15E antigens, whereas the non-b H-2A molecules from TI strains are capable of presenting type II but not type I-specific peptides leading to the selection of type I recombinants. The problem with this simple model is that it does not explain the fact that NS is dominant with respect to TI. The model would predict that F1 animals that coexpress b and non-b H-2A molecules will mount anti-type II virus immune responses and thus exhibit a TI phenotype.
Dominance of NS, however, is compatible with a model in which the viruses induce ineffectual immune responses that paradoxically promote leukemogenesis. The ineffective responses could stimulate the proliferation and increase in number of pre-T cells that serve as targets for viral replication and subsequent transformation. This effect would be similar to that proposed to explain how antiviral host responses augment lymphomagenesis by the Moloney MuLV (19). Thus, one possibility is that the H-2b NS protein of B10 mice induces ineffectual immune responses against both type I and type II viruses, in essence stimulating both types similarly and allowing other subtle factors, such as replicative advantage, to come into play. In contrast, the analogous non-b H-2 proteins expressed in other strains might elicit responses only to type I recombinants overcoming the less significant forces. In the case of CWD mice, a unique lack of response might allow the selection of exclusively type II viruses via another mechanism. Thus, the NS phenotype would be dominant in F1 crosses with TI animals due to the expression of the H-2b proteins and stimulation of both viral types. The TI phenotype, in turn, would be dominant to CWD since a response favorable to the selection of type I viruses would be produced.
Conversely, the dominance of the NS genes could be explained by the induction of tolerance to the envelope proteins of both type I and type II viruses. One possibility is that the NS gene product mediates the deletion of T-cell clones that react with type-specific envelope sequences. A similar mechanism is thought to explain why the expression of H-2E enhances rather than suppresses the growth of leukemia cells in Friend MuLV-infected mice (24). Less likely, immune tolerance may result from a specific interaction between the allele-specific domain of the NS gene product and p15E that blocks the processing, transport, or presentation of viral antigens. If this is so, perhaps the functions of the corresponding non-b H-2 protein would be blocked by the p15E proteins of type I but not type II viruses, resulting in the selection of the former. This postulated effect of p15E on antigen presentation is analogous to that reported for the ICP47 protein of herpes simplex virus (14). However, to explain the dominance of NS, the NS protein-p15E interaction must act as a dominant negative in tissues of (NS × TI)F1 mice, which seems unlikely.
Finally, our data do not exclude the possibility that the NS gene functions by a nonimmune mechanism. The efficiency of virus replication may be increased or inhibited by a direct interaction between the allele-specific region of the NS gene product with the type-specific domain of pI5E. This could influence maturation or processing of viral envelope proteins, virion assembly or release, or the early stages of entry of viruses into cells. The effect may be similar to that of variants of the human protein CKR5 which interact with the human immunodeficiency virus envelope protein and influence the efficiency of viral replication in vitro and in vivo (8, 9, 11). Certainly, a first step in elucidating how the H-2Ab gene(s) confers the NS phenotype in B10 mice will be to determine if the mechanism is immune or nonimmune. Regardless, the generation and selection of recombinant MuLVs in H-2 congenic strains of B10 mice provides a new model system to study how the major histocompatibility complex influences the genetic evolution of pathogenic retroviruses in vivo.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported in part by a grant from the American Cancer Society (MV489) and the Mayo Clinic Foundation to C.Y.T. and DHHS training grant (5-T32-CA09109-15) to J.D.N. while the latter was at the University of Virginia.
| |
FOOTNOTES |
|---|
*
Corresponding author. Mailing address: Division
Hematology/Oncology, Mayo Clinic
Jacksonville, 4500 San Pablo Rd.,
Jacksonville, FL 32224. Phone: (904) 953-7293. Fax: (904) 953-7117. E-mail: thomc6{at}mayo.edu.
| |
REFERENCES |
|---|
|
|
|---|
| 1. | Attaya, M., S. Jameson, C. K. Martinez, E. Hermel, C. Aldrich, J. Forman, K. F. Lindahl, M. J. Bevan, and J. J. Monaco. 1992. Ham-2 corrects the class I antigen-processing defect in RMA-S cells. Nature 355:647-649[Medline]. |
| 2. | Chattopadhyay, S. K., M. W. Cloyd, D. L. Linemeyer, M. R. Lander, E. Rands, and D. R. Lowy. 1982. Cellular origin and role of mink cell focus-forming viruses in murine thymic lymphomas. Nature 295:25-31[Medline]. |
| 3. |
Cloyd, M. D.,
J. W. Hartley, and W. P. Rowe.
1980.
Lymphomagenicity of recombinant mink cell focus-inducing murine leukemia virus.
J. Exp. Med.
151:542-549 |
| 4. | Coffin, J. M. 1992. Genetic diversity and evolution of retroviruses. Curr. Top. Microbiol. Immunol. 176:143-164[Medline]. (Review.) |
| 5. | Coffin, J. M., J. P. Stoye, and W. N. Frankel. 1989. Genetics of endogenous murine leukemia viruses. Ann. N. Y. Acad. Sci. 567:39-49[Medline]. |
| 5a. | Coppola, M., and C. Thomas. Unpublished data. |
| 6. |
Coppola, M. A., and C. Y. Thomas.
1990.
A host gene regulates the structure of the transmembrane envelope protein of murine leukemia viruses.
J. Exp. Med.
171:1739-1752 |
| 7. |
Coppola, M. A.,
T. M. Lam,
R. R. Strawbridge, and W. R. Green.
1995.
Recognition of endogenous ecotropic murine leukemia viruses by anti-AKR/Gross virus cytotoxic T lymphocytes (CTL).
J. Gen. Virol.
76:635-641 |
| 8. |
Dean, M.,
M. Carrington,
C. Winkler,
G. A. Huttley,
M. W. Smith,
R. Allikmets,
J. J. Goedert,
S. P. Buchbinder,
E. Vittinghoff,
E. Gomperts,
S. Donfield,
D. Vlahov,
R. Kaslow,
A. Saah,
C. Rinaldo, and R. Detels.
1996.
Genetic restriction of hiv-1 infection and progression to aids by a deletion allele of the ckr5 structural gene.
Science
273:1856-1862 |
| 9. | Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, I. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[Medline]. |
| 10. |
DiFronzo, N. L., and C. A. Holland.
1993.
A direct demonstration of recombination between an injected virus and endogenous viral sequences, resulting in the generation of mink cell focus-inducing viruses in AKR mice.
J. Virol.
67:3763-3770 |
| 11. | Dragic, T., V. Litwin, G. P. Allaway, S. P. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and P. J. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667-673[Medline]. |
| 12. |
Famulari, N. G.,
D. L. Buchhagen,
H. D. Klenk, and E. Fleissner.
1976.
Presence of murine leukemia virus envelope proteins gp70 and p15(E) in a common polyprotein of infected cells.
J. Virol.
20:501-508 |
| 13. | Famulari, N. G. 1983. Murine leukemia viruses with recombinant env genes: a discussion of their role in leukemogenesis. Curr. Top. Microbiol. Immunol. 103:75-108[Medline]. |
| 14. | Fruh, K., K. Ahn, H. Djaballah, P. Sempe, P. M. van Endert, R. Tampe, P. A. Peterson, and Y. Yang. 1995. A viral inhibitor of peptide transporters for antigen presentation. Nature 375:415-418[Medline]. |
| 15. |
Green, N.,
H. Hiai,
J. H. Elder,
R. S. Schwartz,
R. H. Khiroya,
C. Y. Thomas,
P. N. Tsichlis, and J. M. Coffin.
1980.
Expression of leukemogenic recombinant viruses associated with a recessive gene in HRS/J mice.
J. Exp. Med.
152:249-264 |
| 16. | Green, W. R. 1986. Expression of CTL-defined, AKR/Gross retrovirus-associated tumor antigens by normal spleen cells: control by Fv-1, H-2, and proviral genes and effect on antiviral CTL generation. J. Immunol. 136:308-312[Abstract]. |
| 17. |
Hartley, J. W.,
N. K. Wolford,
L. J. Old, and W. P. Rowe.
1977.
A new class of murine leukemia virus associated with development of spontaneous lymphomas.
Proc. Natl. Acad. Sci. USA
74:789-792 |
| 18. |
Herr, W., and W. Gilbert.
1983.
Somatically acquired recombinant murine leukemia proviruses in thymic leukemias of AKR/J mice.
J. Virol.
46:70-82 |
| 19. |
Ihle, J. N.,
J. J. Domotor, Jr., and K. M. Bengali.
1976.
Characterization of the type and group specificities of the immune response in mice to murine leukemia viruses.
J. Virol.
18:124-131 |
| 20. | Jolicoeur, P. 1979. The Fv-1 gene of the mouse and its control of murine leukemia virus replication. Curr. Top. Microbiol. Immunol. 86:67-122[Medline]. (Review.) |
| 21. |
Lawrenz-Smith, S. C.,
A. C. Massey,
D. J. Innes, and C. Y. Thomas.
1994.
Pathogenic determinants in the U3 region of recombinant murine leukemia viruses isolated from CWD and HRS/J mice.
J. Virol.
68:5174-5183 |
| 22. |
Li, J. P., and D. Baltimore.
1991.
Mechanism of leukemogenesis induced by mink cell focus-forming murine leukemia viruses.
J. Virol.
65:2408-2414 |
| 23. |
Lung, M. L.,
J. W. Hartley,
W. P. Rowe, and N. H. Hopkins.
1983.
Large RNase T1-resistant oligonucleotides encoding p15E and the U3 region of the long terminal repeat distinguish two biological classes of mink cell focus-forming type C viruses of inbred mice.
J. Virol.
45:275-290 |
| 24. | Miyazawa, M., J. Nishio, K. Wehrly, and B. Chesebro. 1992. Influence of MHC genes on spontaneous recovery from Friend retrovirus-induced leukemia. J. Immunol. 148:644-647[Abstract]. |
| 25. |
Monaco, J. J.,
S. Cho, and M. Attaya.
1990.
Transport protein genes in the murine MHC: possible implications for antigen processing.
Science
250:1723-1726 |
| 26. | Nowinski, R. C., M. G. Brown, T. Doyle, and R. L. Prentice. 1979. Genetic and viral factors influencing the development of spontaneous leukemia in AKR mice. Virology 96:186-204[Medline]. |
| 26a. | Nuckols, J. D., and C. Y. Thomas. Unpublished data. |
| 27. |
Rommelaere, J.,
D. V. Faller, and N. Hopkins.
1978.
Characterization and mapping of RNase T1-resistant oligonucleotides derived from the genomes of Akv and MCF murine leukemia viruses.
Proc. Natl. Acad. Sci. USA
75:495 |
| 28. |
Stoye, J. P., and J. M. Coffin.
1987.
The four classes of endogenous murine leukemia viruses; structural relationships and potential for recombination.
J. Virol.
61:2659-2669 |
| 29. | Teich, N. 1982. Taxonomy of retroviruses, p. 25-208. In R. Weiss, H. Teich, H. Varmus, and J. Coffin (ed.), RNA tumor viruses. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. |
| 30. |
Thiel, H. J.,
H. Schwarz,
P. Fischinger,
D. Bolognesi, and W. Scheafer.
1987.
Role of antibodies to murine leukemia virus p15E transmembrane protein in immunotherapy against AKR leukemia: a model for studies in human acquired immunodeficiency syndrome.
Proc. Natl. Acad. Sci. USA
84:5893-5897 |
| 31. |
Thomas, C. Y.
1986.
AKR ecotropic murine leukemia virus SL3-3 forms envelope gene recombinants in vivo.
J. Virol.
59:23-30 |
| 32. |
Thomas, C. Y.,
B. J. Boykin,
N. G. Famulari, and M. A. Coppola.
1986.
Association of recombinant murine leukemia viruses of the class II genotype with spontaneous lymphomas in CWD mice.
J. Virol.
58:314-323 |
| 33. | Thomas, C. Y., M. A. Coppola, C. A. Holland, and A. C. Massey. 1990. Oncogenicity and U3 region sequences of class II recombinant MuLVs of CWD mice. Virology 176:166-177[Medline]. |
| 34. |
Thomas, C. Y.,
M. A. Coppola,
J. D. Nuckols,
S. C. Lawrenz-Smith, and A. C. Massey.
1993.
An increase in disease latency is associated with a host-dependent selection for recombinant MuLVs with substitutions in the P15E (TM) gene.
J. Virol.
67:294-304 |
| 35. |
Thomas, C. Y.,
R. Khiroya,
R. S. Schwartz, and J. M. Coffin.
1984.
Role of recombinant ecotropic and polytropic viruses in the development of spontaneous thymic lymphomas in HRS/J mice.
J. Virol.
50:397-407 |
| 36. | Thomas, C. Y., J. D. Nuckols, C. F. Murphy, and D. J. Innes. 1993. Generation and pathogenicity of an NB-tropic SL3-3 murine leukemia virus. Virology 193:1013-1017[Medline]. |
| 37. |
Thomas, C. Y.,
J. S. Roberts, and V. K. Buxton.
1988.
Mechanism of selection of class II recombinant murine leukemia viruses in the highly leukemic strain CWD.
J. Virol.
62:1158-1166 |
| 38. | Trowsdale, J. 1993. Genomic structure and function in the MHC. Trends Genet. 9:117-122[Medline]. |
| 39. | Tsichlis, P. N., and P. A. Lazo. 1991. Virus-host interactions and the pathogenesis of murine and human oncogenic retroviruses. Curr. Top. Microbiol. Immunol. 171:95-171[Medline]. |
| 40. |
Vasmel, W. L.,
E. J. Sijts,
C. J. Leupers,
E. A. Matthews, and C. J. Melief.
1989.
Primary virus-induced lymphomas evade T-cell immunity by failure to express viral antigens.
J. Exp. Med.
169:1233-1254 |
| 41. |
Vasmel, W. L.,
M. Zijlstra,
T. Radaszkiewicz,
C. J. Leupers,
R. E. de Goede, and C. J. Melief.
1988.
Major histocompatibility complex class II-regulated immunity to murine leukemia virus protects against early T- but not late B-cell lymphomas.
J. Virol.
62:3156-3166 |
| 42. | Vlug, A., C. J. Melief, C. de Bruyne, H. Schoenmakers, and J. L. Molenaar. 1980. Naturally occurring leukemia viruses in H-2 congenic C57BL mice. II. Antibody response to viral envelope antigens. J. Natl. Cancer Inst. 64:1191-1198. |
| 43. |
Zaane, D. V.,
A. L. Gielkens,
W. G. Hesselink, and H. P. Bloemers.
1977.
Identification of Rauscher murine leukemia virus-specific mRNAs for the synthesis of gag- and env-gene products.
Proc. Natl. Acad. Sci. USA
74:1855 |
| 44. |
Zhou, P.,
H. Cao,
M. Smart, and C. David.
1993.
Molecular basis of genetic polymorphism in major histocompatibility complex-linked proteasome gene (LMP-2).
Proc. Natl. Acad. Sci. USA
90:2681-2684 |
| 45. | Zhou, X. Z., R. Glas, T. M. Liu, H. G. Ljunggren, and M. Jondal. 1993. Antigen-processing mutant T2 cells present viral-antigen restricted through H-2Kb. Eur. J. Immunol. 23:1802-1808[Medline]. |
| 46. | Zijlstra, M., and C. J. M. Melief. 1986. Virology, genetics and immunology of murine lymphomagenesis. Biochim. Biophys. Acta 865:197-231[Medline]. |
| 47. | Zijlstra, M., R. E. Y. De Goede, H. Schoenmakers, T. Radaszkeiwicz, and C. J. M. Melief. 1984. Ecotropic and dualtropic mink cell focus-inducing murine leukemia viruses can induce a wide spectrum of H-2 controlled lymphoma types. Virology 138:198-211[Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»