Previous Article | Next Article 
J Virol, May 1998, p. 3958-3964, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Cloning of Novel Isoforms of the Human Gli2
Oncogene and Their Activities To Enhance Tax-Dependent
Transcription of the Human T-Cell Leukemia Virus Type 1 Genome
Akira
Tanimura,
Shingo
Dan, and
Mitsuaki
Yoshida*
Department of Cellular and Molecular Biology,
Institute of Medical Science, University of Tokyo, Minato-ku, Tokyo
108, Japan
Received 27 October 1997/Accepted 3 February 1998
 |
ABSTRACT |
The expression of human T-cell leukemia virus type 1 (HTLV-1) is
activated by interaction of a viral transactivator protein, Tax, and
cellular transcription factor, CREB (cyclic AMP response element
binding protein), which bind to a 21-bp enhancer in the long terminal
repeats (LTR). THP (Tax-helping protein) was previously determined to
enhance the transactivation by Tax protein. Here we report novel forms
of the human homolog of a member of the Gli oncogene family, Gli2 (also
termed Gli2/THP), an extended form of a zinc finger protein, THP, which
was described previously. Four possible isoforms (hGli2 
, 
, 
,
and 
) are formed by combinations of two independent alternative
splicings, and all the isoforms could bind to a DNA motif, TRE2S, in
the LTR. The longer isoforms, and , were abundantly expressed in
various cell lines including HTLV-1-infected T-cell lines. Fusion
proteins of the hGli2 isoforms with the DNA-binding domain of Gal4
activated transcription when the reporter contained a Gal4-binding site
and one copy of the 21-bp sequence, to which CREB binds. This
activation was observed only in the presence of Tax. The 21-bp sequence
in the reporter was also essential for the activation. These results
suggest that simultaneous binding of hGli2 and CREB to the respective
sites in the reporter seems to be critical for Tax protein to activate transcription. Consequently, it is probable that the LTR can be regulated by two independent signals through hGli2 and CREB, since the
LTR contains the 21-bp and TRE2S sequences in the vicinity.
| |
INTRODUCTION |
Human T-cell leukemia virus type 1 (HTLV-1) (11, 21, 31) is the etiologic agent of adult T-cell
leukemia (11, 32) and HTLV-1-associated myelopathy/tropical
spastic paraparesis (10, 20). The expression of the HTLV-1
genome is strongly enhanced by its own product Tax through activation
of transcription (2, 4, 6, 28). Tax binds directly to
unphosphorylated cyclic AMP response element binding protein (CREB)
(29, 34, 35) or CREM (29) and also binds to
another transcription factor, CREB binding protein (CBP), forming
CREB-Tax-CBP (19). In uninfected cells, the CREB-CBP complex
is formed only when CBP is phosphorylated (3, 18). The
CREB-Tax-CBP complex binds to the 21-bp sequence, which is repeated
three times in the long terminal repeat (LTR) (24, 25) and
activates transcription without any external signals (19).
At least two copies of the 21-bp sequence are required for efficient
activation by Tax; thus, transactivation of the LTR has been thought to
be fully explained by the 21-bp sequence (7, 27).
One copy of the 21-bp enhancer, on the other hand, has been found to be
insufficient for efficient activation (8, 27). However, we
and others (1, 7) previously noted that some deletion
mutants with mutations of the LTR that had only one copy of the 21-bp
sequence were fully activated by Tax. These mutants had an additional
DNA motif termed TRE2S adjacent to the 3'-proximal 21-bp sequence, and
deletion of the sequence drastically diminished the activity in
response to Tax activation (1, 30). Therefore, it was
suggested that TRE2S binding protein is involved in Tax-mediated activation of transcription. We previously identified the zinc finger
proteins THP-1 and THP-2, which bind to the TRE2S sequence (30).
The THP protein (30) has five zinc finger motifs at the
N-terminal region, and the motifs are highly homologous to the Gli oncogene family, Gli1 and Gli3 (8, 22, 23). However, other structural features including the size were rather different from those
of the other Gli family proteins. Therefore, we tried to isolate other
possible clones that encode TRE2S binding protein. We report here four
novel isoforms of the cDNAs, which are formed by a combination of two
independent splicings. These clones contain sequences identical to two
partial exon sequences of human Gli2 (hGli2) (22), but they
show only 48 and 55% homology to hGli1 (16) and hGli3
(23), respectively. Furthermore, the longest cDNA can encode
a protein with 80% homology to the mouse Gli2 (mGli2) oncogene product
(14). Thus, we concluded that these isoforms are hGli2
isoforms, and we have called them hGli2 , , , and . These
isoforms encode 133-, 131-, 88-, and 86-kDa proteins, respectively.
They can bind to the TRE2S DNA sequence, and their Gal4 fusion proteins
strongly activate Tax-dependent transcription when the reporter
contains the Gal4 binding site and one copy of the 21-bp sequence.
These observations suggest that simultaneous binding of hGli2 and CREB
to the respective binding sites in the reporter enhances Tax-mediated
transactivation.
| |
MATERIALS AND METHODS |
Cells, plasmids, and antibodies.
An HTLV-1-infected T-cell
line, Hut102, was maintained in RPMI 1640 with 10% fetal calf serum.
Cells of the human embryonic kidney cell line, 293T, and the human
amnion cell line, FL, and HeLa cells were maintained in Dulbecco's
modified Eagle's medium supplemented with 10% fetal calf serum.
A cDNA library of HTLV-1-infected Hut102 cells (33), a cDNA
clone of THP (30), and the Tax expression vector pCG-Tax
(9) was previously described. The entire coding sequence of
each hGli2 isoform was inserted into pCG vector (30) under
the control of the promoter of the cytomegalovirus early genes to
construct pCG-hGli2 isoforms. Similarly, the same coding sequences were also inserted into the pCG-Gal4 cassette by using the sites for XbaI and BamHI or HindIII to
express fusion proteins of hGli2 isoforms with the Gal4 DNA binding
domain (positions 1 to 147).
Antiserum against Tax was raised against the C-terminal peptide as
described previously (
29). Antibodies against hGli2 were
raised by inoculating a bacterially produced fragment of hGli2
(amino acids 1 to 506), which was fused to a six-histidine track
and
purified with a nickel column as described elsewhere (
12,
29).
Isolation and sequencing of hGli2 cDNA clones.
A 
gt11
cDNA library containing 2 × 106 phages, which was
prepared from Hut102 (33), was screened with the coding
sequence of THP-1 (30) as a probe. The cDNA inserts of
positive clones were subcloned into Bluescript KS+ and
sequenced by the dideoxy method (33). By using the 3'
fragment of the longest cDNA, the original library was further screened to isolate the cDNAs downstream of the mRNA. By overlapping these sequences, four possible full-sized cDNAs were constructed.
Reverse transcriptase PCR (RT-PCR) of cellular RNA.
cDNA was
synthesized from the total cytoplasmic RNA isolated from Hut102 cells.
The specific sequence was amplified by 30 cycles of PCR at 72°C for 2 min, 98°C for 0.5 min, and 55°C for 1 min, and the primers were
a (positions 130 to 154 [with the ATG as +1]) and
b (positions 284 to 308) to detect the first alternative splicing site and c (positions 2267 to 2291) and
d (positions 3729 to 3753) to detect the second alternative
splicing site. The products were analyzed by agarose gel
electrophoresis.
Gel retardation assay.
The reaction mixture was incubated
for 20 min at 25°C and then subjected to electrophoresis in 4%
nondenaturing polyacrylamide gel as previously described
(30). The 10-µl mixture contained nuclear extract (5 µg
of protein), radiolabeled oligonucleotide probe (5 × 104 cpm; 1 ng), poly(dI-dC) (2.5 µg), 12 mM HEPES (pH
7.5), 0.6 mM EDTA, 0.6 mM dithiothreitol, 60 mM KCl, and 12% glycerol.
CAT assay.
Expression vectors for hGli2 or the fusion
protein of Gal4-hGli2 (0.025, 0.1, or 1 µg) were cotransfected with
either reporter plasmid, pTRE2S-21bp-CAT or pGal4-21bp-CAT, into FL
cells by the calcium phosphate procedure (6). The Tax
expression vector pCG-Tax (0.05 µg) was also included when specified.
After culture for 40 h, the cells were harvested and subjected to
a chloramphenicol acetyltransferase (CAT) assay as described previously
(6). Under the conditions used, the activity was linearly
proportional to the incubation time and the protein concentration. The
CAT activity was expressed as the percent acetylation of
chloramphenicol per 100 µg of protein in 30 min at 37°C or as the
ratio to that with the reporter alone.
DNA affinity precipitation assay.
Cells were harvested,
lysed in lysis buffer containing Nonidet P-40, and centrifuged at 1,000 rpm for 10 min. The pellet was washed with lysis buffer twice and used
as the nuclear fraction. The nuclear proteins were extracted with 0.4 M
sodium chloride as described previously (17). DNA probes
with the TRE2S sequence were prepared by PCR with biotinylated primers.
The nuclear extract and DNA probe were incubated at 25°C for 20 min,
and DNA-protein complexes were isolated with strepavidin beads. The
complexes were then directly analyzed by Western blotting (13,
29) with anti-Tax or anti-hGli2 antibodies.
Nucleotide sequence accession numbers.
The accession numbers
for the sequences of the four isoforms are AB007295, AB007296,
AB007297, and AB007298.
| |
RESULTS |
Structure of cDNA isoforms of hGli2.
Previously, we reported a
THP protein that binds to a Tax-responsive element (TRE2S) in the LTR
(30). To isolate more cDNA clones related to THP, we further
surveyed a cDNA library of Hut102 cells with THP-1 cDNA as a probe. The
sequences of some positive clones, for example clones 2 and 3, revealed
the presence of further extended sequence at the 3' end of the
overlapping sequence with THP (Fig. 1).
However, none of them had a poly(A) stretch reflecting the poly(A)
sequence at the 3' end of the mRNA. To isolate clones with the sequence
downstream, we used the 3' fragment of clone 3 as a probe and isolated
clones 4, 5, and 6, two of which had an A stretch at the 3' end. By
overlapping the sequences of these clones with the others, four
possible cDNA isoforms were constructed. The clones thus constructed
could be categorized into four subtypes (, , , and ), which
were generated by combinations of two independent splicings (summarized
in Fig. 1). The sequence of the longest isoform is shown in Fig.
2A.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of full-sized cDNAs of the hGli2 isoforms.
Thick lines represent cDNA sequences, and boxes represent open reading
frames. Solid and shaded regions in the boxes are the zinc finger
motifs and amino acid sequences alternatively translated from different
frames, respectively. Full-sized cDNA isoforms of hGli2 were derived
from overlapping sequences of THP-1 and -2 previously reported
(30) and clones 2 to 6 isolated in the present study.
|
|
View larger version (64K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Nucleotide and amino acid sequence of hGli2. The
sequence between the solid triangles is deleted in and isoforms
by alternative splicing, and that between the open triangles is deleted
in the and isoforms. (B) The second splicing induced a
frameshift in translation, and the altered amino acid sequence is
shown. The underline indicates five zinc finger motifs, and arrows with
a, b, c, and d indicate the
primers for RT-PCR.
|
|
The longest clone consists of 4,961 bp and encodes 1,258 amino acids.
Alternative splicings were detected at two sites: a
51-base deletion at
the 5' region of the coding frame in the
and
isoforms, and a
1,231-base deletion at the 3' region in
the
and
isoforms (Fig.
1). The sites for the first splicing
correspond to the identical
sequences of CAGG; therefore, the
site of the splicing could not be
assigned accurately. The termini
of the sequence between the splicing
sites do not contain any
sequence to follow the GT/AG rule for the
intron, suggesting that
the sequence may be an alternative exon in the
and
forms (Fig.
3, top). The
sites for the second splicing also correspond to
repeated sequences;
however, the splicing sites can be predicted
so that GT/AG can be
allocated at the termini (Fig.
3, bottom).
Therefore, the sequence
between the second splicing sites is probably
an intron in the genome.
By the second splicing, the reading frame
is shifted into an
alternative one, resulting in a different amino
acid sequence in the C
termini of the
and
isoforms. The altered
amino acid sequence is
shown in Fig.
2B.
View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
Sequence comparison of hGli2 with mGli2. Sequences
around possible splicing sites are compared. The numbers with the
arrowheads indicate the positions in hGli2 and mGli2
(14), respectively, and * indicates identical nucleotides.
The sequence between the arrows in the top panel was deleted in the
hGli2 and isoforms, and that in the lower panel was deleted in
the hGli2 and isoforms.
|
|
The nucleotide sequences of these isoforms contained sequences
identical to two genomic fragments of hGli2 (
22), indicating
that these isoforms are the hGli2. On the other hand, the amino
acid
sequence encoded by the
isoform is 80% homologous to mGli2
(
14). Furthermore, the nucleotide sequence of the zinc
finger
motifs was identical to that of mGli2 except for 1 of 159 bases
(
14). The amino acid sequence of the
form, on the other
hand,
showed 48 and 55% homology to hGli1 (
16) and hGli3
(
23), respectively,
although the nucleotide sequence of the
zinc fingers showed 86
and 93% homology to hGli1 and hGli3,
respectively (
16,
23)
(Fig.
3). Therefore, it was concluded
that these novel isoforms
correspond to hGli2.
Comparison of these novel forms of hGli2 and mGli2 indicates that
mGli2, previously published by Hughs et al. (
14), might
correspond to a
form of mGli2 (Fig.
3). On the other hand, the
5'
half of hGli2 was identical to the previously described THP
(
30), except for two deletions at position 1277 and 1294. Careful
analysis of the sequence of THP clones showed that the clone
originally
sequenced had deletions at two sites described above; thus,
the
sequence previously described (
30) was an artifact at
these
two sites. The corrected sequence allowed extension of the
translation
further downstream. The Gli oncogene family was originally
identified
as an oncogene amplified in human glioblastoma cells
(
16) and
characterized as a transcription factor that binds
to DNA through
zinc finger motifs (
14,
15).
DNA binding of hGli2 isoforms.
To confirm the DNA binding
activity of hGli2, expression vectors for and isoforms were
transfected into 293T cells and the nuclear extracts were examined by a
DNA affinity precipitation assay. In a parallel experiment, a nuclear
extract of Hut102 cells was similarly assayed to determine which
isoform is the major species in DNA binding in HTLV-1-infected T
cells. The double-stranded DNA probe for these assays was TRE2S
containing biotinylated nucleotides at both 5' termini. Each nuclear
extract was incubated with the DNA probe, and the DNA-protein complexes
were isolated with streptavidin beads. The isolated complexes were
analyzed by Western blotting with antibodies against hGli2 (Fig.
4). Both hGli2 and hGli2 were shown
to bind to TRE2S DNA (lanes 2 and 3) but not to a mutant probe (lanes 5 and 6), clearly demonstrating that the hGli2 isoforms are proteins that
bind to a specific DNA sequence. A faster-migrating band detected in
lane 3 might be a degraded fragment of hGli2 containing the zinc
finger motifs, which is thought to be the DNA binding domain of hGli2.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
Binding of the hGli2 isoforms to the TRE2S DNA sequence
and of the endogenous proteins in HTLV-1-infected cells. Expression
vectors, pCG-hGli2 (lanes 2 and 5) and (lanes 3 and 6), were
separately transfected into 293T cells, and the nuclear extracts were
incubated with TRE2S DNA (lanes 1 to 3) or TRE2M, an inactive mutant
(lanes 4 to 6), which were labeled with biotin. The DNA-protein
complexes were isolated with avidin beads and analyzed by Western
blotting with antiserum against hGli2. A nuclear extract from Hut102
cells, an HTLV-1-infected T-cell line, was also analyzed similarly
(lanes 1 and 4). TRE2S, CCGGGAAGCCACCGGGAACCACCCA;
TRE2M, CCGGGAAGCCACCGGGAACAAATTA.
|
|
In these assays, we included a Tax expression plasmid, pCG-Tax, to
examine whether Tax protein can bind to the hGli2-TRE2S
complex.
However, we could not see a significant binding of Tax
to the
hGli2-TRE2S complex, although we detected a very weak binding
only when
a large excess of pCG-Tax was used (data not shown).
Therefore, Tax
does not bind effectively to hGli2 protein on the
TRE2S DNA sequence.
A similar assay with a nuclear extract of HTLV-1-infected Hut102 cells
gave a single band migrating with the same mobility
as hGli2 isoform
(Fig.
4, lane 1). Therefore, it is concluded
that the endogenous
Gli2
and
isoforms are the major components
of hGli2 to bind to
TRE2S in vivo.
Expression of hGli2 isoforms in cell lines.
The sequences of
the hGli2 isoforms predicted the sizes of mRNA as 5.1 kb for the and isoforms and 3.9 kb for the and isoforms, including
poly(A). To examine which species are expressed in cell lines, Northern
blot analysis was carried out. As shown in Fig.
5A, a major band of 5.1 kb was detected
in Hut102 cells, a T-cell line infected with HTLV-1 (lane 1), FL cells,
a human amnion cell line (lane 2), and HeLa cells, a human epithelial cell line (lane 3). A faint band just below the major band was also
detected in all the cell lines (Fig. 5A). These observations may
indicate that hGli2 and/or was the major species expressed in
various types of cell lines and that the and/or isoforms were
minor.
View larger version (24K):
[in this window]
[in a new window]
|
FIG. 5.
Expression of hGli2 isoforms at the mRNA and protein
levels. (A) Northern blot of poly(A)+ RNA from Hut102 (lane
1), FL (lane 2), and HeLa (lane 3) cells with the coding sequence of
hGli2 as a probe. A HindIII digest of phage DNA
is shown as a molecular size marker (lane 4). (B) Detection of the
endogenous Gli2 isoforms expressed in Hut102 cells. Total RNA of Hut102
cells was used as the template for reverse transcription with random
primers, and the cDNA sequences obtained were amplified with two sets
of primers, A and B (lane 1) or C and D (lane 4), which encompass each
splicing site (Fig. 1 and 2). As the standards, hGli2 (lanes 2 and
5), (lane 3) and (lane 6) were also amplified with the same
primers. Fragments of 179 and 128 bp are from RNA without and with
splicing at the first site, respectively, and fragments of 1,487 and
256 bp are those from RNA without and with splicing at the second site,
respectively. (C) Identification of protein isoforms of hGli2 in Hut102
cells by Western blot analysis. Lanes: 1 and 2, whole-cell extract; 3, nuclear fraction; 4, cytoplasmic fraction; 5, hGli2 ; 6, hGli2 .
Antiserum against hGli2 was used for lanes 1 and 3 to 6, and preimmune
serum was used for lane 2.
|
|
To distinguish the
and
or the
and
isoforms, we carried
out reverse RT-PCR. RNA isolated from Hut102, an HTLV-1-infected
T-cell
line, was converted into cDNA with RT and the cDNA was
amplified with
primers
a and
b or
c and
d
as indicated in Fig.
1 and
2. The sequence amplified with primers
a and
b encompasses
the first splicing site, and
the
and
and the
and
isoforms
would produce 179- and
128-bp DNA fragments, respectively. These
fragments, amplified with
primers
c and
d, encompass the second
splicing
site, and the
and
and the
and
isoforms would
produce
1,487- and 256-bp DNA fragments, respectively (Fig.
1).
The results
shown in Fig.
5B demonstrate that primers
a and
b gave two bands expected from the
and
isoforms with almost
equal
intensity (lane 1), clearly indicating an equal expression
of the
and
and the
and
isoforms. On the other hand, primers
c and
d gave a very dominant band of 1,487-bp DNA
(lane 4) but
extremely low levels of the 256-bp DNA band, demonstrating
that
the vast majority of hGli2 mRNA expressed in Hut102 cells is made
up of
and
isoforms and that there is only a very minor fraction
of
and
isoforms. A similar assay was also performed with RNA
from another HTLV-1-infected cell line, MT2, and almost identical
results were obtained (data not shown), suggesting that a dominant
expression of the
and
isoforms of hGli2 might be a general
feature in HTLV-1-infected T-cell lines.
The expression of hGli2 isoform in Hut102 cells was also confirmed at
the protein level (Fig.
5C). Western blot analysis detected
a major
band with a molecular mass of 155 kDa with antibodies
against the
N-terminal region (amino acids 1 to 506), but not
with a preimmune
serum (Fig.
5C, lanes 1 and 2). The size of the
band was similar to
that of the
isoform (lane 5). When the nuclear
and cytoplasmic
fractions were separated by brief centrifugation,
the band was detected
only in the pellet defined as a nuclear
fraction (lanes 3 and 4). In
the pellet, severe contamination
of undisrupted cells was excluded by
microscopic examination.
Therefore, the
and
isoforms of hGli2
are expressed almost
exclusively in the nucleus.
Enhancement of Tax-dependent transactivation by hGli2.
The
TRE2S sequence was identified in the LTR as a cis element to
enhance Tax-dependent transactivation (30). To examine whether the TRE2S binding protein hGli2 is able to enhance
Tax-dependent transactivation, the expression vector for hGli2 and
a reporter plasmid were transfected into FL cells in the presence or
absence of the Tax-expressing vector. We used FL cells for these assays simply because these cells took up DNA efficiently in our transfection assay. The reporter gene CAT was under the control of one copy each of
TRE2S and the 21-bp sequence. However, the reporter plasmid alone was
almost fully activated by Tax as previously described (30).
Overexpression of hGli2 by exogenous plasmid induced significant
suppression of CAT expression (Table 1).
To avoid the effects of endogenous Gli2
and
, we used a fusion
protein of hGli2
with the DNA binding domain of Gal4 protein
(Table
1). The reporter CAT construct contained five copies of
the Gal4
binding site instead of TRE2S and one copy of the 21-bp
sequence. In
the presence of Tax, the Gal4-hGli2
fusion protein
activated CAT
expression very efficiently; however, in the absence
of Tax, it did not
affect CAT expression significantly (Table
1). Tax alone induced a six-
to eightfold enhancement of CAT
expression but was not sufficient for
full activation. Furthermore,
the activation by Gal4-hGli2
was dose
dependent, as shown in
Fig.
6. When a
reporter did not contain the Gal4-binding site,
no such activation was
observed (Table
1). From these observations,
it was concluded that DNA
binding of the hGli2
fusion protein
through the Gal4 binding site
enhanced Tax-dependent transactivation.
All the other isoforms of hGli2
also showed similar enhancement
of Tax-dependent activation (Table
1).
View larger version (14K):
[in this window]
[in a new window]
|
FIG. 6.
Dose-dependent activation of CAT expression by
pCG-Gal4-hGli2 . The reporter plasmid, pGal4-21bp-CAT, contained the
Gal4 binding site and one copy of the 21-bp sequence. The assay was
carried out similarly to that described for Table 1.
|
|
| |
DISCUSSION |
In this study, we identified four novel isoforms of hGli2 ,
, , and , that bind to a Tax response element, TRE2S, in the LTR of HTLV-1. The novel isoforms had the same sequence at the 5'
region as THP previously described (30), except for two
deletions, which allowed further extension of the translation. Careful
reexamination indicated that the sequence of the previous THP was a
cloning artifact. hGli2 showed 80% homology of amino acid sequence
to mGli2 (14). The isoforms were formed by combinations of
two independent alternative splicings in the coding sequence, and the
larger isoforms, and , were abundantly expressed in
HTLV-1-infected T-cell lines and also in other cell lines so far
tested. All these isoforms were found to bind to TRE2S with
conservation of the zinc finger motifs. Comparing the sequence of mGli2
reported by Hughes et al. (14) with the isoforms of hGli2
described in this paper, mGli2 appeared to correspond to the form.
It underwent splicing at the first site but not at the second site,
although the site showed very high homology, as shown in Fig. 3.
Fusion proteins of hGli2 with the DNA binding domain of Gal4 enhanced
the Tax-dependent activation of gene expression when the reporter
contained the Gal4 binding site and the 21-bp sequence. From these
observations, we concluded that binding of hGli2 to the TRE2S sequence
enhanced Tax-dependent transactivation of transcription. However, the
free form of hGli2 did not enhance but, instead, rather efficiently
inhibited Tax-dependent transcription, probably because the endogenous
Gli2 gene is abundantly expressed in the cell line used and the
expression of the reporter gene had been activated by Tax alone at the
maximum level. The mechanism of this inhibition is not well understood,
but two possibilities can be assumed: (i) overexpressed hGli2 is
squelching Tax-mediated transactivation, or (ii) it should be modified
to be active, but, it might not be sufficiently modified in transfected
cells.
A unique property of the enhancement was that binding of hGli2 alone to
TRE2S had almost no effect on transcription. Two additional factors
were required for the enhancement; these were the 21-bp sequence as a
cis element and Tax protein as a trans-acting
factor. These requirements for transcriptional activation suggest that hGli2 might function through a unique mechanism, although the mechanism
is not well understood. A possible mechanism, however, could be as
follows: hGli2 and CREB bind to each cis element in the
vicinity and interact with each other on the DNA. Such an interaction
could be enhanced by the Tax protein, since Tax binds to CREB to
activate the enhancer activity of the 21-bp repeats (29,
35). A putative interaction of hGli2 and CREB might be supported
by the previous observations on YY1, a human Gli-Kruppel-related protein (26). YY1 interacts with CREB/ATF and exerts
repression of specific transcription (36). Furthermore, the
repression exerted by YY1 is relieved by adenovirus E1A
(26). Another factor, UCRBP, a zinc finger protein of the
Gli family, bound to the upstream conserved region of the murine
leukemia virus LTR and down-regulated the MuLV promoter activity
(5). These observations on other factors related to Gli
proteins allow speculation that hGli2 is a transcriptional repressor
and that HTLV-1 Tax can prevent the repression. However, this mechanism
seems unlikely, because hGli2 did not show any inhibitory activity on
transcription in the absence of Tax.
Whatever the mechanism, the presence of the TRE2S sequence adjacent to
the 3' proximal 21-bp sequence in the LTR (1, 30) and our
observations reported in this paper suggest that the binding of hGli2
and CREB to TRE2S and 21-bp sequences, respectively, in the LTR would
be an alternative pathway to augment the capacity of Tax to
transactivate viral gene expression.
| |
ACKNOWLEDGMENT |
This work was supported in part by a special grant for Advanced
Research on Cancer from the Ministry of Education, Culture and Science
of Japan.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Cellular and Molecular Biology, Institute of Medical Science,
University of Tokyo, 4-6-1 Shirokanedai, Minato-ku, Tokyo 108, Japan.
Phone: 81-3-5449-5275. Fax: 81-3-5449-5421. E-mail:
myoshi{at}ims.u-tokyo.ac.jp.
| |
REFERENCES |
| 1.
|
Brady, J. N.,
K.-T. Jeang,
J. Duvall, and G. Khoury.
1987.
Identification of p40x-responsive regulatory sequences within the human T-cell leukemia virus type I long terminal repeat.
J. Virol.
61:2175-2181[Abstract/Free Full Text].
|
| 2.
|
Chen, I. S. Y.,
A. J. Cann,
N. P. Shah, and R. B. Gaynor.
1985.
Functional relation between HTLV-2 x and adenovirus I1A proteins in transcriptional activation.
Science
230:570-573[Abstract/Free Full Text].
|
| 3.
|
Chrivia, J. C.,
R. P. Kwok,
N. Lamb,
M. Hagiwara,
M. R. Montminy, and R. H. Goodman.
1993.
Phosphorylated CREB binds specifically to the nuclear protein CBP.
Nature
365:855-859[Medline].
|
| 4.
|
Felber, B. K.,
H. Paskalis,
D. Kleinman-Ewing,
F. Wong-Staal, and G. N. Pavlakis.
1985.
The pX protein of HTLV-1 is a transcriptional activator of its long terminal repeats.
Science
229:675-679[Abstract/Free Full Text].
|
| 5.
|
Flanagan, J. R.,
K. G. Becker,
D. L. Ennist,
S. L. Gleason,
P. H. Driggers,
B.-Z. Levi,
E. Appella, and K. Ozato.
1992.
Cloning of a negative transcription factor that binds to the upstream conserved region of Moloney murine leukemia virus.
Mol. Cell. Biol.
12:38-44[Abstract/Free Full Text].
|
| 6.
|
Fujisawa, J.,
M. Seiki,
T. Kiyokawa, and M. Yoshida.
1985.
Functional activation of long terminal repeat of human T-cell leukemia virus type I by trans-activator.
Proc. Natl. Acad. Sci. USA
82:2277-2281[Abstract/Free Full Text].
|
| 7.
|
Fujisawa, J.,
M. Seiki,
M. Sato, and M. Yoshida.
1986.
A transcriptional sequence of HTLV-1 is responsible for trans-activation mediated by p40x of HTLV-1.
EMBO J.
5:713-718[Medline].
|
| 8.
|
Fujisawa, J.,
M. Toita, and M. Yoshida.
1989.
A unique sequence element for the trans-activator (p40tax) of human T-cell leukemia virus type I from cyclic AMP- and TPA-responsive elements.
J. Virol.
63:3234-3239[Abstract/Free Full Text].
|
| 9.
|
Fujisawa, J.,
M. Toita,
T. Yoshimura, and M. Yoshida.
1991.
The indirect association of human T-cell leukemia virus tax fusion protein with DNA results in transcriptional activation.
J. Virol.
65:4525-4528[Abstract/Free Full Text].
|
| 10.
|
Gessain, A.,
F. Barin,
J. C. Vernant,
O. Gout,
L. Maurs,
A. Calender, and G. de The.
1985.
Antibodies to human T lymphotropic virus type 1 in patients with tropical spastic paraparesis.
Lancet
ii:407-410.
|
| 11.
|
Hinuma, Y.,
K. Nagata,
M. Misaka,
M. Nakai,
T. Matsumoto,
K. Kinoshita,
S. Shirakawa, and I. Miyoshi.
1981.
Adult T cell leukemia: antigen in an ATL cell line and detection of antibodies to the antigen in human sera.
Proc. Natl. Acad. Sci. USA
78:6476-6480[Abstract/Free Full Text].
|
| 12.
|
Hirai, H.,
T. Suzuki,
J. Fujisawa,
J. Inoue, and M. Yoshida.
1994.
Tax protein of human T-cell leukemia virus type I binds to the ankyrin motifs of inhibitory factor kappa B and induces nuclear translocation of transcription factor NF- B proteins for transcriptional activation.
Proc. Natl. Acad. Sci. USA
91:3584-3588[Abstract/Free Full Text].
|
| 13.
|
Hirai, H.,
J. Fujisawa,
T. Suzuki,
K. Ueda,
M. Muramatsu,
A. Tsuboi,
N. Arai, and M. Yoshida.
1992.
Trans-activator Tax of HTLV-1 binds to the NF-B precursor p105.
Oncogene
7:1737-1742[Medline].
|
| 14.
|
Hughes, D. C.,
J. Allen,
G. Morley,
K. Sutherland,
W. Ahmed,
J. Prosser,
L. Lettice,
G. Allen,
M.-G. Mattei,
M. Farrall, and R. E. Hill.
1997.
Cloning and sequencing of the mouse Gli2 gene: localization to the dominant hemimelia critical region.
Genomics
39:205-215[Medline].
|
| 15.
|
Kinzler, K. W., and B. Vogelstein.
1990.
The GLI gene encodes a nuclear protein which binds specific sequences in the human genome.
Mol. Cell. Biol.
10:634-642[Abstract/Free Full Text].
|
| 16.
|
Kinzler, K. W.,
J. M. Ruppert,
S. H. Bigner, and B. Vogelstein.
1988.
The GLI gene is a member of the Kruppel family of zinc finger proteins.
Nature
332:371-374[Medline].
|
| 17.
|
Kiyokawa, T.,
M. Seiki,
S. Iwashita,
K. Imagawa,
F. Shimizu, and M. Yoshida.
1985.
P27x-III and p21x-III, proteins encoded by the pX sequence of human T-cell leukemia virus type I.
Proc. Natl. Acad. Sci. USA
82:8359-8363[Abstract/Free Full Text].
|
| 18.
|
Kwok, R. P. S.,
J. R. Lundblad,
J. C. Chrivia,
J. P. Richard,
H. P. Bächinger,
R. G. Brennan,
S. G. E. Roberts,
M. Green, and R. H. Goodman.
1994.
Nuclear protein CBP is a coactivator for the transcription factor CREB.
Nature
370:223-226[Medline].
|
| 19.
|
Kwok, R. P. S.,
M. E. Laurence,
J. R. Lundblad,
P. S. Goldman,
H. Shih,
L. M. Connor,
S. J. Marriott, and R. H. Goodman.
1996.
Control of cAMP-regulated enhancers by the viral transactivator Tax through CREB and the co-activator CBP.
Nature
380:642-646[Medline].
|
| 20.
|
Osame, M.,
K. Usuku,
S. Izumo,
N. Ijichi,
H. Amitani,
A. Igata,
M. Matsumoto, and M. Tara.
1986.
HTLV-1 associated myelopathy, a new clinical entity.
Lancet
i:1031-1032.
|
| 21.
|
Poiesz, B. J.,
R. W. Ruscetti,
A. F. Gazdar,
P. A. Bunn,
J. D. Minna, and R. C. Gallo.
1980.
Detection and isolation of type C retrovirus particles from fresh and cultured lymphocytes of a patient with cutaneous T-cell lymphoma.
Proc. Natl. Acad. Sci. USA
77:7415-7419[Abstract/Free Full Text].
|
| 22.
|
Ruppert, J. M.,
K. W. Kinzler,
A. J. Wong,
S. H. Bingner,
F.-T. Kao,
M. L. Law,
H. N. Seuanes,
S. J. O'Brien, and B. Vogelstein.
1988.
The GLI-Kruppel family of human genes.
Mol. Cell. Biol.
8:3104-3113[Abstract/Free Full Text].
|
| 23.
|
Ruppert, J. M.,
B. Vogelstein,
K. Arheden, and K. W. Kinzler.
1990.
GLI3 encodes a 190-kilodalton protein with multiple regions of GLI similarity.
Mol. Cell. Biol.
10:5408-5415[Abstract/Free Full Text].
|
| 24.
|
Seiki, M.,
S. Hattori,
Y. Hirayama, and M. Yoshida.
1983.
Human adult T cell leukemia virus: complete nucleotide sequence of the provirus genome integrated in leukemia cell DNA.
Proc. Natl. Acad. Sci. USA
80:3618-3622[Abstract/Free Full Text].
|
| 25.
|
Seiki, M.,
S. Hattori, and M. Yoshida.
1982.
Human adult T-cell leukemia virus: Molecular cloning of the provirus DNA and the unique terminal structure.
Proc. Natl. Acad. Sci. USA
79:6899-6902[Abstract/Free Full Text].
|
| 26.
|
Shi, Y.,
E. Seto,
L.-S. Chang, and T. Shenk.
1991.
Transcriptional repression by YY1, a human GLI-Krüppel-related protein, and relief of repression by adenovirus E1A protein.
Cell
67:377-388[Medline].
|
| 27.
|
Shimotohno, K.,
M. Takano,
T. Teruuchi, and M. Miwa.
1986.
Requirement of multiple copies of a 21-nucleotide sequence in the U3 regions of human T-cell leukemia virus type I and type II long terminal repeats for trans-acting activation of transcription.
Proc. Natl. Acad. Sci. USA
83:8112-8116[Abstract/Free Full Text].
|
| 28.
|
Sodroski, J. G.,
C. A. Rosen,
W. C. Goh, and W. A. Haseltine.
1984.
Trans-acting transcriptional activation of the long terminal repeat of human T lymphotropic viruses in infected cells.
Science
226:177-179[Abstract/Free Full Text].
|
| 29.
|
Suzuki, T.,
J. Fujisawa,
M. Toita, and M. Yoshida.
1993.
A trans-activator Tax of human T-cell leukemia virus type 1 (HTLV-1) interacts with AP-responsive element (CRE) binding and CRE modulator proteins that bind to the 21-base-pair sequence of HTLV-1.
Proc. Natl. Acad. Sci. USA
90:610-614[Abstract/Free Full Text].
|
| 30.
|
Tanimura, A.,
H. Teshima,
J. Fujisawa, and M. Yoshida.
1993.
A new regulatory element that augments the Tax-dependent sequence of human T-cell leukemia virus type 1 and cloning of cDNAs encoding its binding protein.
J. Virol.
67:5375-5382[Abstract/Free Full Text].
|
| 31.
|
Yoshida, M.,
I. Miyoshi, and Y. Hinuma.
1982.
Isolation and characterization of retrovirus from cell lines of human adult T cell leukemia and its implication in the disease.
Proc. Natl. Acad. Sci. USA
79:2031-2035[Abstract/Free Full Text].
|
| 32.
|
Yoshida, M.,
M. Seiki,
K. Yamaguchi, and K. Takatsuki.
1984.
Monoclonal integration of HTLV in all primary tumors of adult T-cell leukemia suggests causative role of HTLV in the disease.
Proc. Natl. Acad. Sci. USA
81:2534-2537[Abstract/Free Full Text].
|
| 33.
|
Yoshimura, T.,
J. Fujisawa, and M. Yoshida.
1990.
Multiple cDNA clones encoding nuclear proteins that bind to the Tax-dependent sequence of HTLV-1: all contain a leucine zipper structure and basic amino acid domain.
EMBO J.
9:2537-2542[Medline].
|
| 34.
|
Zhao, L., and C. Giam.
1991.
Interaction of the human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator Tax with cellular factors that bind specifically to the 21-base-pair repeats in the HTLV-1 enhancer.
Proc. Natl. Acad. Sci. USA
88:11445-11449[Abstract/Free Full Text].
|
| 35.
|
Zhao, L., and C. Giam.
1992.
Human T-cell lymphotropic virus type I (HTLV-I) transcriptional activator, Tax, enhances CREB binding to HTLV-I 21-base-pair repeats by protein-protein interaction.
Proc. Natl. Acad. Sci. USA
89:7070-7074[Abstract/Free Full Text].
|
| 36.
|
Zhou, Q.,
R. W. Gedrich, and D. A. Engel.
1995.
Transcriptional repression of the c-fos gene by YY1 is mediated by a direct interaction with ATF/CREB.
J. Virol.
69:4323-4330[Abstract].
|
J Virol, May 1998, p. 3958-3964, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Kasper, M., Schnidar, H., Neill, G. W., Hanneder, M., Klingler, S., Blaas, L., Schmid, C., Hauser-Kronberger, C., Regl, G., Philpott, M. P., Aberger, F.
(2006). Selective Modulation of Hedgehog/GLI Target Gene Expression by Epidermal Growth Factor Signaling in Human Keratinocytes.. Mol. Cell. Biol.
26: 6283-6298
[Abstract]
[Full Text]
-
Roessler, E., Ermilov, A. N., Grange, D. K., Wang, A., Grachtchouk, M., Dlugosz, A. A., Muenke, M.
(2005). A previously unidentified amino-terminal domain regulates transcriptional activity of wild-type and disease-associated human GLI2. Hum Mol Genet
14: 2181-2188
[Abstract]
[Full Text]
-
Roessler, E., Du, Y.-Z., Mullor, J. L., Casas, E., Allen, W. P., Gillessen-Kaesbach, G., Roeder, E. R., Ming, J. E., Altaba, A. R. i, Muenke, M.
(2003). Loss-of-function mutations in the human GLI2 gene are associated with pituitary anomalies and holoprosencephaly-like features. Proc. Natl. Acad. Sci. USA
100: 13424-13429
[Abstract]
[Full Text]
-
Hiraiwa, N., Yabuta, T., Yoritomi, K., Hiraiwa, M., Tanaka, Y., Suzuki, T., Yoshida, M., Kannagi, R.
(2003). Transactivation of the fucosyltransferase VII gene by human T-cell leukemia virus type 1 Tax through a variant cAMP-responsive element. Blood
101: 3615-3621
[Abstract]
[Full Text]
-
Dahmane, N., Sanchez, P., Gitton, Y., Palma, V., Sun, T., Beyna, M., Weiner, H., Ruiz i Altaba, A.
(2001). The Sonic Hedgehog-Gli pathway regulates dorsal brain growth and tumorigenesis. Development
128: 5201-5212
[Abstract]
[Full Text]
-
Smith, M. J., Gitlin, S. D., Browning, C. M., Lane, B. R., Clark, N. M., Shah, N., Rainier, S., Markovitz, D. M.
(2001). GLI-2 Modulates Retroviral Gene Expression. J. Virol.
75: 2301-2313
[Abstract]
[Full Text]
-
Browning, C. M., Smith, M. J., Clark, N. M., Lane, B. R., Parada, C., Montano, M., KewalRamani, V. N., Littman, D. R., Essex, M., Roeder, R. G., Markovitz, D. M.
(2001). Human GLI-2 Is a Tat Activation Response Element-Independent Tat Cofactor. J. Virol.
75: 2314-2323
[Abstract]
[Full Text]
-
Dan, S., Tanimura, A., Yoshida, M.
(1999). Interaction of Gli2 with CREB Protein on DNA Elements in the Long Terminal Repeat of Human T-Cell Leukemia Virus Type 1 Is Responsible for Transcriptional Activation by Tax Protein. J. Virol.
73: 3258-3263
[Abstract]
[Full Text]
-
Ruiz i Altaba, A
(1999). Gli proteins encode context-dependent positive and negative functions: implications for development and disease. Development
126: 3205-3216
[Abstract]
Top
Abstract
Introduction
