Previous Article | Next Article 
J Virol, May 1998, p. 3827-3836, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Hepatitis C Virus Structural Proteins Assemble
into Viruslike Particles in Insect Cells
Thomas F.
Baumert,1
Susumu
Ito,2
David T.
Wong,3 and
T. Jake
Liang1,*
Liver Diseases Section, National Institute of
Diabetes and Digestive and Kidney Diseases, National Institutes of
Health, Bethesda, Maryland 208921;
Department of Neurobiology and Department of Cell Biology,
Harvard Medical School, Boston, Massachusetts
021152; and
Division of
Gastroenterology, Department of Medicine, Stanford University
School of Medicine, Palo Alto, California 943043
Received 30 December 1997/Accepted 20 January 1998
 |
ABSTRACT |
Hepatitis C virus (HCV) is a leading cause of chronic hepatitis in
the world. The study of HCV has been hampered by the low level of viral
particles in infected individuals, the inability to propagate
efficiently the virus in cultured cells, and the lack of a convenient
animal model. Due to these obstacles, neither the structure of the
virus nor the prerequisites for its assembly have been clearly defined.
In this report, we describe a model for the production and purification
of HCV-like particles in insect cells using a recombinant baculovirus
containing the cDNA of the HCV structural proteins. In insect cells,
expressed HCV structural proteins assembled into enveloped viruslike
particles (40 to 60 nm in diameter) in large cytoplasmic cisternae,
presumably derived from the endoplasmic reticulum. Biophysical
characterization of viruslike particles by CsCl and sucrose gradient
centrifugation revealed biophysical properties similar to those of
putative virions isolated from infected humans. The results suggested
that HCV core and envelope proteins without p7 were sufficient for
viral particle formation. Analysis of particle-associated nucleic acids demonstrated that HCV RNAs were selectively incorporated into the
particles over non-HCV transcripts. The synthesis of HCV-like particles
in insect cells may provide an important tool to determine the
structural requirements for HCV particle assembly as well as to study
viral genome encapsidation and virus-host interactions. The described
system may also represent a potential approach toward vaccine
development.
 |
INTRODUCTION |
Hepatitis C virus (HCV) is a major
causative agent of posttransfusion and community-acquired hepatitis in
the world (2, 23, 26). The majority of HCV-infected
individuals develop chronic hepatitis progressing eventually to liver
cirrhosis and hepatocellular carcinoma (48). Neither an
effective treatment for chronic HCV infection nor a vaccine to prevent
HCV infection is available at the present time (19, 28).
HCV is a member of the Flaviviridae family (44).
The virion contains a positive-stranded RNA genome of 9.5 kb. The
genome consists of a highly conserved 5' noncoding region
(35) followed by a long open reading frame of 9,030 to 9,099 nucleotides (nt) that is translated into a single polyprotein of 3,010 to 3,030 amino acids (16, 35). Initiation of translation
occurs by a mechanism of internal ribosomal entry requiring the 5'
untranslated region (UTR) and a short stretch of HCV coding sequences
(43). Processing of the polyprotein occurs with a
combination of host and viral proteases. The HCV structural proteins
comprise the nucleocapsid or core protein (C) and the two envelope
glycoproteins, E1 and E2 (for a review, see reference
39). The cleavage of structural proteins from the
polyprotein is catalyzed by a host signal peptidase (16,
30), whereas polyprotein cleavage in the nonstructural region
requires HCV-encoded proteases (11). An additional cleavage
product in the coding region of the structural proteins was recently
identified as p7 (30, 41). Although the characterization of
the viral genome organization has been described in detail
(35), analysis of the structural features of HCV has been
hampered by the inability to propagate the virus efficiently in
cultured cells. The levels of viral particles present in infected
patient plasma or liver tissues are very low, making it difficult to
visualize the virus. In analogy to other members of the
Flaviviridae, the genome organization of HCV suggests a viral structure consisting of a nucleocapsid or core protein and a
viral genome coated by a lipid envelope containing envelope glycoproteins E1 and E2. Transmission studies with chimpanzees, the
only reliable animal model for HCV, have provided evidence that HCV is
inactivated by chloroform, indicating that it contains lipids and
therefore is probably enveloped (9). Filtration studies have
estimated the virion particle size at a diameter of 30 to 60 nm
(15).
The baculovirus-insect cell expression system has been applied
successfully for the synthesis of viral capsids for viruses of various
families (10, 24, 49) but not for the enveloped RNA viruses
of the Flaviviridae family. The baculovirus-insect cell
expression system has two features which make it attractive for HCV
protein expression. First, eukaryotic insect cells are known to carry
out a number of co- or posttranslational modifications, including fatty
acid acetylation and glycosylation, similar to mammalian cells
(33). Second, in contrast to many mammalian cell expression
systems, the baculovirus expression system allows high-level synthesis
of heterologous proteins (33). We therefore rationalized
that the baculovirus system may be able to direct the synthesis of
HCV-like particles in insect cells.
(This work was presented in part at the 47th Annual Meeting of the
American Association for the Study of Liver Diseases, 8 to 12 November
1996, Chicago, Ill., and the 4th International Meeting on Hepatitis C
Virus and Related Viruses, 6 to 10 March 1997, Kyoto, Japan.)
 |
MATERIALS AND METHODS |
Baculovirus constructs and insect cell cultures.
For the
construction of recombinant baculoviruses, a recently described
baculovirus expression system was applied (Bac-to-Bac; Gibco BRL,
Gaithersburg, Md.) (32). The cDNA for the HCV structural proteins, cloned from a Japanese patient with chronic hepatitis (HCV-J
strain, genotype 1b), was used to generate the recombinant baculovirus
BVHCV.S. pFastBacHCV.S was generated by subcloning an
EcoRI-Tth111I fragment (nt 259 to 2819) of
pCMV980 (23) into the EcoRI and SpeI
sites of pFastBac. The Tth111I and SpeI sites were blunt ended with the Klenow fragment before ligation. An in-frame
stop codon is present in the vector sequence close to the 3' end of the
subcloned cDNA. pFastBacHCV.Sp7
was generated by PCR with the
following primers: 5' GAGACAGACGTGCCTGCTACTTAG CAACACGCG 3' (sense
nt 1918 to 1951) and 5' TCGAAAGCTTAGGCCT CAGCCTGGGCTATCAGC 3'
(antisense nt 2567 to 2543). A stop codon and a HindIII
site were introduced at the 3' end of the p7 protein coding region. The
NotI-HindIII digestion product of the PCR
fragment was subcloned into NotI-HindIII site
(multiple cloning site) of pFastBacHCV.S. pFastBacHIVgp160 containing
the cDNA for the human immunodeficiency virus (HIV) glycoprotein
precursor gp160 was generated by subcloning a
HindIII-NotI fragment (nt 1 to 2481) of
pSyngp160 (kindly provided by Brian Seed, Department of Genetics,
Massachusetts General Hospital, Boston) into the StuI and
NotI sites of pFast Bac. The HindIII site was blunt ended with the Klenow fragment before ligation. The
correct sequences of the pFastBacHCV.S, pFastBacHCV.Sp7
, and
pFast BacHIVgp160 constructs were confirmed by restriction enzyme
digestions and DNA sequencing. pFastBacGUS (Gibco BRL) containing the
coding sequence of the enzyme
-glucuronidase (GUS) was used to
generate the control baculovirus BVGUS.
Recombinant baculoviruses were generated as described previously
(32), identified by immunofluorescence and immunoblotting of
transfected Spodoptera frugiperda Sf9 insect cells with
specific antibodies, and amplified by subsequent rounds of Sf9 cell
infection until a final titer of 5 × 107 PFU/ml was
achieved. Sf9 insect cells were maintained in spinner or monolayer
cultures at 28°C in Sf-900 II serum-free medium (Gibco BRL). For all
protein expression experiments, Sf9 cells in mid-log growth in
monolayer cultures were infected with a multiplicity of infection (MOI)
of 1 to 10. Infection of insect cells with BVGUS served as a negative
control in all experiments.
Anti-HCV antibodies.
The monoclonal anti-core, anti-E1, and
anti-E2(G/H) mouse antibodies (7) as well as the polyclonal
anti-E2(9284) rabbit antibody (29, 42) were described
previously. Additional monoclonal anti-E1 and anti-E2 antibodies were
obtained from Johnson Lau (University of Florida, Gainesville). Human
serum containing antibodies against HCV was obtained from two patients
with chronic hepatitis C and high-titer anti-HCV antibodies. The
patients were serologically negative for hepatitis B virus (HBV),
hepatitis A virus, and HIV.
Immunofluorescence of HCV proteins.
At 96 h
postinfection, BVHCV.S- and BVGUS-infected Sf9 cells were fixed in 7%
paraformaldehyde (fixative B, described below), dehydrated, embedded,
and sectioned as described below (electron microscopy). Semithin
sections (0.5 to 1 µm) were incubated with anti-HCV (serum from
HCV-infected individuals as described above; diluted 1:200 in 1%
bovine serum albumin [BSA]-phosphate-buffered saline [PBS]),
anti-core (diluted 1:200 in 1% BSA-PBS), anti-E1 (diluted 1:100 in
1% BSA-PBS), or anti-E2(9284) (diluted 1:200 in 1% BSA-PBS)
antibody or 1% BSA in PBS followed by fluorescein isothiocyanate-conjugated anti-human (for serum), anti-mouse (for anti-core and anti-E1), or anti-rabbit (for anti-E2) antibody (all from
Jackson Laboratories, West Grove, Pa; diluted 1:500 in 1% BSA-PBS)
each for 30 min at room temperature. Between steps, plates were rinsed
three times with PBS.
Immunoblotting and immunoprecipitation of HCV proteins.
For
immunoblot analysis, Sf9 cells infected with BVHCV.S, BVHCV.Sp7
, and
BVGUS were lysed with a buffer containing 1% sodium deoxycholate,
0.1% sodium dodecyl sulfate (SDS), 1% Triton X-100, 10 mM Tris, and
140 mM NaCl (pH 8.0), whereas for immunoprecipitation analysis, the
lysis buffer consisted of 0.1% Nonidet P-40 (NP-40), 50 mM Tris, 50 mM
NaCl, and 5 mM EDTA (pH 7.5). All lysis buffers contained 1 mM
phenylmethylsulfonyl fluoride (PMSF), 2 µg of aprotinin per ml, and 2 µg of leupeptin per ml. The cell lysate was cleared of cell debris
and nuclei by low-speed centrifugation (15 min at 15,000 × g and 4°C). For immunoblotting, a fraction of the supernatant (containing 50 µg of protein) was subjected to 12% polyacrylamide gel electrophoresis (PAGE). For immunoprecipitation, 400 µl of the cleared supernatant of either BVHCV.S- or BVGUS-infected cells was incubated with 1 µl of anti-E2(9284) antibody for 16 h
at 4°C and then with 50 µl of protein A-Sepharose 4B-Cl beads (Pharmacia Biotech Inc., San Francisco, Calif.) for 1 h at room temperature with mixing. The beads were washed repeatedly, and the
bound proteins were released and denatured by heating for 5 min at
95°C in SDS sample buffer (13). The immunoprecipitated proteins were analyzed by electrophoresis on a 12% polyacrylamide gel.
After gel transfer to polyvinylidene difluoride membranes (Westran;
Schleicher & Schuell, Keene, N.H.), the blots were probed with
anti-core (diluted 1:2,000), anti-E1 (diluted 1:2,000), or anti-E2(G/H)
(diluted 1:1,000) antibody followed by horseradish peroxidase-conjugated anti-mouse immunoglobulin G antibody (diluted 1:4,000; Amersham Corp., Arlington Heights, Ill.), with subsequent chemiluminescence detection (ECL; Amersham). For analysis of the expression of the HCV structural proteins in mammalian cells, BSC-1
cells (grown in a monolayer in modified Eagle medium-2% fetal calf
serum) were infected at an MOI of 10 with wild-type vaccinia or a
vaccinia virus (vvHCV.S) containing the same HCV structural cDNA as the
baculovirus BVHCV.S (provided by E. V. Schmidt, Massachusetts
General Hospital, Boston). At 8 h postinfection, expression of the
HCV structural proteins was analyzed as described above.
Electron microscopy.
Sf9 cells infected with BVHCV.S,
BVHCV.Sp7
, and BVGUS were washed with PBS and fixed in various
solutions. For morphological studies, the fixative buffer consisted of
1.25% paraformaldehyde, 2.5% glutaraldehyde in 0.03% picric acid,
and 0.05 M cacodylate buffer at pH 7.4 (fixative A) (21).
For immunodecoration, the cells were fixed in 7%
paraformaldehyde-0.25 M sucrose in 0.03% picric acid-0.05 M
cacodylate buffer at pH 7.4 (fixative B). The cells were scraped from
the cell culture dishes with a razor blade, pelleted in an Eppendorf
desktop centrifuge for 10 min at 18,000 × g, and
postfixed with 1% osmium tetroxide in 0.05 M cacodylate buffer for 15 min. The pellets were washed in 0.1 M maleate buffer (pH 5.0), treated
with 1% uranyl acetate (pH 5.0) for 30 min, washed with maleate
buffer, dehydrated in a graded series of ethanol solutions followed by
propylene oxide, embedded in a mixture of Epon 812 and Araldite, and
polymerized at 40°C for 3 days. Thin sections were stained with
saturated uranyl acetate diluted to 50% with acetone and then with
lead citrate for electron microscopy examination. Prior to immunogold
labeling of thin sections, plastic-embedded cells in semithin sections
(0.5 to 1 µm) were mounted on glass slides and stained with
anti-HCV-positive human serum, anti-E1, or anti-E2(9284) antibody as
described above. For immunogold labeling, ultrathin sections collected
on nickel grids were etched with saturated NaIO4. After
being washed with PBS, the grids were incubated with 3% BSA in PBS for
30 min. The grids were then incubated for 1 h with either anti-HCV
(HCV patient serum; diluted 1:100 in 1% BSA-PBS), anti-E1 (diluted
1:50 in 1% BSA-PBS), or anti-E2 ([polyclonal anti-E2(9284) rabbit;
diluted 1:50 in 1% BSA-PBS] antibody or 1% BSA-PBS only. After
five washes with PBS, samples were incubated with protein A coupled to
10-nm gold particles (Jan Schlott Laboratories, Utrecht, The
Netherlands) in PBS (dilution 1:200) and rinsed five times with PBS.
After counterstaining with uranyl acetate and lead citrate, samples
were examined with a transmission electron microscope (JEOL 1200 EX)
operated at 80 kV. For electron microscopy of partially purified
viruslike particles, sucrose gradient fractions were pooled, diluted
1:10 with PBS, and subjected to ultracentrifugation (Beckman SW55
rotor; 40,000 rpm, 2 h, 4°C). The pellet was fixed in fixative A
or B and subjected to the same processing as that described above.
Purification of HCV-like particles.
At 96 h
postinfection, insect cells infected with BVHCV.S or BVHCV.Sp7
(approximately 5 × 107 cells, grown in suspension)
were lysed in 50 mM Tris-50 mM NaCl-0.5 mM EDTA (pH 7.5) with 1 mM
PMSF, 2 µg of aprotinin per ml, and 2 µg of leupeptin per ml. In
some experiments, 0.1% NP-40 was added to the lysis buffer, and
sonication of the lysate was performed. The lysate was homogenized and
subjected to low-speed centrifugation (15 min at 4°C and 15,000 × g), and the supernatant was pelleted over a 30% (wt/vol)
sucrose (in 20 mM Tris-150 mM NaCl [pH 7.4]) cushion (6 h at 4°C
and 150,000 × g). The pellet, containing the HCV-like
particles, was resuspended in 50 mM Tris-100 mM NaCl (pH 7.4) or PBS,
homogenized, and subjected to a second sucrose or CsCl equilibrium
gradient centrifugation. For sucrose equilibrium gradient
centrifugation, the resuspended pellet was layered onto a 20 to 60%
(wt/wt) sucrose (in 50 mM Tris-100 mM NaCl [pH 7.4]) gradient and
centrifuged for 22 h at 4°C and 150,000 × g
(17). Ten 0.5-ml fractions were collected from the top and
analyzed by SDS-12% PAGE. For CsCl equilibrium gradient
centrifugation, 0.5 ml of the resuspended pellet was mixed with 4.5 ml
of PBS containing 0.5 mM PMSF and 1.67 g of CsCl (33% [wt/wt]
in PBS) and centrifuged for 72 h at 4°C and 300,000 × g (14). After centrifugation, 10 0.5-ml fractions
were collected from the top, extensively dialyzed against PBS at 4°C,
and analyzed by SDS-12% PAGE. After gel transfer, the blots were
probed with anti-core, anti-E1, or anti-E2(G/H) antibody and
horseradish peroxidase-labeled anti-mouse antibody as described above.
For sucrose sedimentation velocity centrifugation, insect cell lysates
were layered onto a 10 to 60% (wt/wt) sucrose (in 50 mM Tris-100 mM
NaCl [pH 7.4]) gradient and centrifuged for 2.5 h at 4°C and
200,000 × g. Ten fractions were collected from the top
and analyzed for HCV structural proteins as described above. Empty HBV
surface particles and HBV core particles were subjected to the same
sucrose gradient velocity centrifugation and used as sedimentation
markers.
HBV surface and core particles were isolated from the cell culture
medium and cytosol of hepatoma cell lines transfected with
a
replication-competent HBV DNA construct (
1,
3,
14).
Sedimentation of empty HBV surface particles was analyzed by hepatitis
B surface antigen detection in sucrose gradient fractions with
a
hepatitis B surface antigen-specific radioimmunoassay (Ausria
II;
Abbott Laboratories, Abbott Park, Ill.). Sedimentation of
HBV core
particles was analyzed by immunoblotting of sucrose gradient
fractions
with an anti-HBV core-specific antibody (Dako Corp.,
Carpinteria,
Calif.).
Analysis of HCV-like particle-associated nucleic acids.
Insect cells grown in monolayers (5 × 106 cells) were
infected with various combinations of BVGUS, BVHCV.S, and BVHIVgp160. At 96 h postinfection, total RNA was purified by the guanidium isothiocyanate-acid-phenol method (5), and a total of 20 µg of RNA was subjected to Northern blot analysis as described below. To analyze HCV particle-incorporated RNA, HCV-like particles were isolated either by immunoprecipitation with a polyclonal rabbit anti-E2(9284) antibody or by pelleting of insect cell lysates over a
30% sucrose cushion and subsequent immunoprecipitation of the
resuspended pellet with a polyclonal rabbit anti-E2(9284) antibody
(immunoprecipitation buffer: 50 mM Tris, 100 mM NaCl, 0.5% digitonin
[pH 7.4]) as described above. After digestion of the precipitated
particles with Staphylococcus aureus nuclease (Boehringer
Mannheim Biochemicals, Indianapolis, Ind.) at a concentration of 24 µg/ml and RNase A (Sigma, St. Louis, Mo.) at a concentration of 50 µg/ml for 2 h at 37°C (in 20 mM Tris [pH 8.8], 5 mM
CaCl2, 2 mM NaCl) to eliminate any nonincorporated nucleic
acids (3, 14), particle-associated RNA was isolated by the
guanidium isothiocyanate-acid-phenol method (5) and
subjected to Northern blot analysis with
[
-32P]dCTP-labeled HCV (nt 259 to 2819)-, GUS-, or HIV
gp160-specific cDNA probes (equal cDNA counts per minute per nanogram
in each probe).
 |
RESULTS |
Expression and interaction of HCV structural proteins in insect
cells.
Recombinant baculovirus BVHCV.S, containing the coding
sequences for the core, E1, E2, and p7 proteins and 21 amino acids of
the NS2 protein (HCV nt 259 to 2819; Fig.
1), directed the production of HCV
structural proteins in insect cells, as demonstrated by
immunofluorescence analysis of infected insect cells with anti-HCV antibodies (Fig. 2) and immunoblotting of
insect cell lysates (Fig. 3).
Immunofluorescence analysis of semithin sections of BVHCV.S-infected
insect cells with anti-HCV antibodies demonstrated that the expression
of HCV structural proteins was confined to the cytoplasm (Fig. 2A to
C). Cytoplasmic staining with clusters of immunoreactivity was observed
with serum from an HCV-infected individual with high-titer anti-HCV
antibodies (Fig. 2A) and specific antibodies against E1 (Fig. 2B), E2
(Fig. 2C), or the core (data not shown). The anti-HCV antibodies used
in this study did not display any cross-reactivity against insect cell
or baculovirus proteins (Fig. 2D).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 1.
Map depicting segments of the HCV genome in the
recombinant baculoviruses expressing HCV structural proteins. The
BVHCV.S construct contains a short stretch of the 5' UTR as well as the
coding sequences for the core, E1, E2, and p7 proteins and 21 amino
acids of the NS2 protein. The polyprotein open reading frame begins at
nt 330, and the junction of E2-p7 and NS2 is at nt 2756. BVHCV.Sp7
contains the same 5' UTR, core, E1, and E2 coding sequences as BVHCV.S
but not p7 and the amino-terminal part of the NS2 protein. pPolh,
baculovirus polyhedrin promoter; SV40, simian virus 40.
|
|

View larger version (105K):
[in this window]
[in a new window]
|
FIG. 2.
Immunofluorescence of HCV structural proteins expressed
in insect cells. (A, B, and C) Insect cells were infected with the
recombinant baculovirus BVHCV.S containing the cDNA for the HCV
structural proteins at an MOI of 10. At 96 h postinfection, the
cells were fixed and processed as described in Materials and Methods.
Protein expression was analyzed with serum obtained from an
HCV-infected human (A), anti-E1 antibody (B), or anti-E2 antibody (C)
as described in Materials and Methods. The insets show a higher
magnification of the stained insect cells. Immunostaining was confined
to the cytosol, whereas the nucleus (N) remained unstained. (D) Insect
cells infected with the control baculovirus BVGUS containing the cDNA
for GUS were subjected to staining with a mixture of the same serum and
antibodies as those shown in panels A, B, and C.
|
|

View larger version (41K):
[in this window]
[in a new window]
|
FIG. 3.
(A) Expression of HCV structural proteins in insect and
mammalian cells. Sf9 insect cells were infected either with control
baculovirus BVGUS (lane 3) or with the HCV expression baculoviruses
BVHCV.S (lane 4) and BVHCV.Sp7 (lane 5). At 96 h postinfection,
the cells were lysed as described in Materials and Methods. To compare
the expression of HCV structural proteins between insect and mammalian
cells, BSC-1 cells were infected with a wild-type vaccinia virus (vvWT)
(lane 1) or a vaccinia virus (vvHCV.S) containing the same cDNA for the
HCV structural proteins as baculovirus BVHCV.S (lane 2). At 8 h
postinfection, the cells were lysed as described in Materials and
Methods. Sf9 and BSC-1 cell lysates were then subjected to SDS-PAGE and
immunoblotting (IB) with anti-core (left panel), anti-E1 (middle
panel), or anti-E2 (right panel) antibodies. Molecular masses (in
kilodaltons) of protein molecular weight (MW) markers are indicated on
the left; HCV-specific proteins are indicated on the right. (B)
Coimmunoprecipitation of HCV structural proteins in insect cells.
Insect cells were infected with BVGUS (lane 6) or BVHCV.S (lane 7). At
96 h postinfection, the cells were lysed and subjected to
immunoprecipitation (IP) with an anti-E2 antibody or nonimmune serum as
indicated. The immunoprecipitated proteins were subjected to SDS-PAGE
and immunoblotting (IB) with anti-core (C), anti-E1, or anti-E2
antibodies as indicated; the control immunoprecipitate with nonimmune
serum was probed with a mixture of antibodies to core, E1, and E2
proteins. The exposure times for the probed blot were adjusted to
visualize the proteins and do not represent a quantitation of the
precipitated proteins.
|
|
Analysis of insect cell lysates by SDS-PAGE and immunoblotting with
monoclonal antibodies against the core, E1, and E2 proteins
revealed
appropriate posttranslational processing of the HCV structural
proteins. As shown in Fig.
3A, the core protein had an apparent
molecular mass of 22 kDa, the E1 protein was present in various
glycosylated forms and had a molecular mass of 30 to 35 kDa, and
the E2
protein had a molecular mass of approximately 66 kDa. The
size of the
core protein was identical to that of the core protein
expressed in a
mammalian tissue culture system (Fig.
3A), whereas
the sizes of the E1
and E2 proteins were similar to the sizes
of envelope proteins
expressed in mammalian cells (E1, 34 to 36
kDa; E2, 68 kDa; Fig.
3A).
These data suggested similar posttranslational
processing of HCV
structural proteins in insect and mammalian
expression systems
(
39). The variations in the sizes of the
envelope proteins
probably reflected differences in glycosylation
between the two protein
expression systems. This finding has been
noted by other investigators
(
34) and is not unexpected, since
glycosylation in insect
and mammalian cells has been shown to
be distinctly different
(
33). The difference in glycosylation
may have resulted in
different signal intensities on the immunoblot,
thereby explaining the
apparently higher levels of E1 and E2 relative
to the core in mammalian
cells than in insect cells (Fig.
3A).
On the other hand, it is possible
that aberrant translational
termination or accelerated degradation of a
particular protein
species may have been responsible for this
difference between
mammalian and insect cells. As shown in Fig.
3B, the
E2 protein
was coimmunoprecipitated with the E1 and core proteins. The
interaction
of the E2 protein with the E1 and core proteins was also
confirmed
by metabolic labeling and coimmunoprecipitation (data not
shown).
These results extend the findings of recent studies which
demonstrated
interactions of the E1 and E2 proteins (
7) as
well as the core
and E1 proteins (
31).
HCV-like particle assembly occurs in cytoplasmic vesicles.
Transmission electron microscopy of BVHCV.S-infected cells revealed
abundant viruslike particles in cytoplasmic vesicles or vacuoles,
presumably derived from the endoplasmic reticulum (ER) of the insect
cells (Fig. 4B, C, and E). These particles, 40 to 60 nm in diameter,
were polymorphic in appearance and had an envelope consisting of a
membrane (Fig. 4B, C, and E); many of
them had unevenly distributed electron-dense structures suggestive of
possible nucleocapsids. Visualization of these particles was only
possible after osmium treatment, which stains membranes. These features resemble the previously described structure and morphology of pestiviruses in infected cells (4, 12, 44). The particles formed predominantly in cytoplasmic vesicles, giving the appearance of
virion transport through the ER secretory pathway of the cells. These
particle-containing structures were not observed in insect cells
infected with a control baculovirus expressing GUS (BVGUS; Fig. 4A) or
uninfected insect cells (data not shown), suggesting that they were not
related to baculovirus protein expression and replication. In addition
to these vesicles containing viruslike particles, floccular membranous
materials with irregular structures of 20 to 100 nm were clustered in
large vacuoles in the cytoplasm (Fig. 4B). These diversely polymorphic
structures also contained membranous envelopes, but most of them
demonstrated no viruslike structures.

View larger version (170K):
[in this window]
[in a new window]
|
FIG. 4.
Electron microscopy of HCV-like particles in insect
cells infected with BVHCV.S or BVHCV.Sp7 . Insect cells in monolayer
cultures were infected with BVGUS, BVHCV.S, or BVHCV.Sp7 . At
96 h postinfection, the cells were fixed and processed for
electron microscopy as described in Materials and Methods. (A) Insect
cells infected with the control baculovirus BVGUS. Electron microscopy
demonstrates abundant replicative forms of baculovirus (open arrows) in
the nucleus (N). No HCV-like particles can be seen in the cytoplasm.
Bar, 120 nm. (B) Insect cells infected with BVHCV.S. Electron
microscopy demonstrates numerous enveloped, viruslike particles 40 to
60 nm in diameter (closed arrows) in vacuoles. In addition, the
synthesis of baculovirus is visualized (open arrow). Bar, 120 nm. (C)
Higher magnification of viruslike particles (closed arrows) seen in
BVHCV.S-infected cells. Bar, 40 nm. (D) Insect cells infected
with BVHCV.Sp7 . Electron microscopy demonstrates viruslike particle
formation in a large cytoplasmic vacuole similar to that seen in
BVHCV.S-infected cells (solid arrows). Baculovirus particles (open
arrows) can be distinguished easily from the HCV-like particles in both
panels C and D. Bar, 100 nm. (E) Immunogold labeling of viruslike
particles (arrows) similar to those seen in panels B, C, and D with
serum from an HCV-infected individual. Immunostaining was confined to
the cytoplasmic cisternae and ER, whereas the N remained unstained.
Bar, 120 nm. The inset shows a higher magnification of the viruslike
particles labeled with an anti-E2 antibody. Bar, 50 nm. (F) Electron
microscopy of viruslike particles (arrows) partially purified by
sucrose gradient centrifugation. Bar, 50 nm. The inset shows labeling
of partially purified particles with an anti-E2 antibody. Bar, 50 nm.
|
|
The viruslike particles were immunostained specifically with human
anti-HCV (Fig.
4E), anti-E2 (Fig.
4E, inset), and anti-E1
(data not
shown) antibodies, suggesting that the viruslike particles
were derived
from HCV structural proteins. In addition to strong
immunostaining of
the particles, labeling of the ER and the vesicular
membranous
complexes mentioned above was also present. No nuclear
staining was
observed with any of the antibodies. The immunolabeling
was highly
specific for the indicated structures. No labeling
of any cellular or
baculovirus structures was seen in BVGUS-infected
(Fig.
4A) or
noninfected insect cells, and staining was not present
in samples not
incubated with primary antibodies (data not shown).
Since examination
of the spent medium at various times was negative
for HCV-like
particles but abundantly positive for baculoviruses,
the viruslike
particles appeared not to be released or secreted
into the culture
medium.
Purification of HCV-like particles by sucrose and CsCl gradient
centrifugation.
In order to purify the viruslike particles,
lysates of baculovirus-infected insect cells were subjected to sucrose
or CsCl equilibrium gradient centrifugation. In both sucrose and CsCl equilibrium gradients, the HCV-like particles banded in specific fractions (Fig. 5A), confirming the
assembly of viruslike particles. The densities of the fractions
demonstrating immunoreactivity for HCV-like particles were 1.14 to 1.18 g/cm3 in sucrose equilibrium gradients (fractions 6 to 8 in
Fig. 5A) and 1.14 to 1.16 g/cm3 in CsCl equilibrium
gradients (fraction 6 in Fig. 5A). Colocalization of the HCV structural
proteins in specific sucrose fractions was confirmed by
coimmunoprecipitation of the HCV structural proteins. To confirm that
the colocalization of the HCV structural proteins in the gradient
fractions did not represent randomly assembled protein aggregates,
sucrose gradient fractions showing immunoreactivity for HCV structural
proteins were examined with transmission electron microscopy. Like the
structures seen within the BVHCV.S-infected insect cells, 40- to 60-nm
enveloped viruslike particles were present (Fig. 4F) and were labeled
specifically with an anti-E2 antibody (Fig. 4F, inset).

View larger version (53K):
[in this window]
[in a new window]
|
FIG. 5.
Purification of HCV-like particles by sucrose and CsCl
gradient centrifugation. (A) Sucrose and CsCl equilibrium
centrifugation. At 96 h postinfection, insect cells infected with
BVHCV.S were lysed and subjected to low-speed centrifugation, and the
supernatant was pelleted over a 30% sucrose cushion. The pellet
containing the viruslike particles was resuspended and subjected to a
second sucrose or CsCl equilibrium gradient centrifugation as described
in Materials and Methods. Ten fractions were collected from the top and
analyzed by SDS-PAGE and immunoblotting with anti-core (C), anti-E1, or
anti-E2 antibodies. Molecular masses (in kilodaltons) of protein
molecular weight (MW) markers are indicated on the left; HCV-specific
proteins are indicated on the right. (B) Sucrose sedimentation velocity
centrifugation. Lysates of insect cells infected with BVHCV.S and
BVHCV.Sp7 were layered onto a 10 to 60% sucrose gradient and
centrifuged for 2.5 h at 4°C and 200,000 × g.
Ten fractions were collected from the top and analyzed for HCV
structural proteins as described above.
|
|
To further analyze the biophysical properties of the viruslike
particles, insect cell lysates were subjected to sucrose sedimentation
velocity centrifugation (Fig.
5B). Immunoblotting of the sucrose
fractions revealed colocalization of the HCV structural proteins
in
high-sedimentation fractions (fractions 4 to 6), indicating
the
presence of viruslike particles. Fractions 2 and 3 contained
E1 and E2
only, probably representing E1 and E2 complexes as assembly
intermediates prior to interaction with the core. To estimate
the
sedimentation coefficient of the HCV-like particles, we determined
the
percentage of sucrose in the particle-containing sucrose gradient
fractions and applied the approximation tables of McEwen
(
37).
The sedimentation coefficient S
20,
can
be approximated by
the Svedberg equation, including the parameters of
the applied
angular velocity

, centrifugation time and temperature,
percentage
or density of sucrose in which the particle is sedimenting,
and
the density of the sedimenting particle (
37). The
validity of
this approximation under the experimental conditions was
confirmed
by sedimentation analysis of HBV surface and core particles
as
standards. Empty HBV surface particles with a sedimentation
coefficient
of 39S to 54S and a particle density of 1.16 g/cm
3 (
18) sedimented to fraction 3 of the
sucrose velocity gradient,
and HBV core particles with a sedimentation
coefficient of 124S
and a particle density of 1.30 g/cm
3
(
18) sedimented to fractions 5 and 6 of the sucrose velocity
gradient. Using the approximation of McEwen (
37) and an
assumed
HCV-like particle density of 1.14 to 1.18 g/cm
3
(from sucrose and CsCl equilibrium gradients; Fig.
5A), we estimated
the sedimentation coefficient S
20,w of HCV-like
particles
to be between 100S and 230S (peak at approximately 160S). The
sedimentation coefficient S
20,w of HCV-like
particles
was different from that of similarly sedimenting HBV core
particles
because of the difference in particle densities. The S value
for
HCV-like particles is within the range of reported sedimentation
coefficients for other members of the
Flaviviridae family
(
44).
Since the visualized viral particles were present predominantly in
membrane-enclosed cytoplasmic vesicles, various cell lysis
conditions
were studied to increase the yield of partially purified
particles.
Although the qualitative findings did not change, the
quantity of
purified particles was enhanced significantly by the
addition of a low
concentration of a mild nonionic detergent (0.1%
NP-40 or 0.5%
digitonin) to the lysis buffer. The well-known detergent
effect of the
de-envelopment of viruses has been shown to be a
time- and
concentration-dependent process. Since the majority
of the detergent in
the cell lysate was bound in micellar aggregates
with cellular proteins
and lipids, the effective detergent concentration,
being much lower
than the original concentration, resulted in
the release of viruslike
particles from the cytoplasmic vesicles
without affecting its envelope.
In contrast, higher concentrations
of detergent in the lysis buffer
(>0.5% NP-40) resulted in the
disruption of the core-envelope
interactions, as indicated by
a lack of their coimmunoprecipitation
(data not shown). On the
other hand, the sucrose gradient-purified
particles were highly
sensitive to detergent treatment: incubation of
partially purified
particles with 0.1% NP-40 disrupted the
cosedimentation of HCV
structural proteins in the sucrose gradient and
eliminated particular
viruslike structures, as seen by electron
microscopy in Fig.
4F.
HCV protein p7 is not required for viral assembly in insect
cells.
In order to study whether HCV protein p7 is required for
viral assembly, a recombinant baculovirus containing a deletion of the
p7 protein (BVHCV.Sp7
) was generated. This construct contained the
same 5' UTR, core, E1, and E2 coding sequences as BVHCV.S but not
p7 (Fig. 1). Infection of insect cells with BVHCV.Sp7
resulted in
levels of core and E1 protein expression similar to those seen in
BVHCV.S-infected cells. In contrast, the molecular mass of the E2
protein was approximately 7 kDa lower in insect cells infected
with the construct BVHCV.Sp7
than in insect cells infected with the
construct BVHCV.S (Fig. 3A). These data indicate that p7 is not
cleaved efficiently from the E2-p7 polyprotein in BVHCV.S-infected
insect cells and are consistent with observations in mammalian
expression systems (30, 41). Electron microscopy of insect
cells infected with BVHCV.Sp7
demonstrated particle assembly (Fig.
4D) similar to that seen in insect cells infected with BVHCV.S (Fig. 4B
and C). We next studied the effect of the p7 deletion on the
sedimentation profile of putative HCV-like particles in sucrose
gradients. In both sucrose velocity centrifugation (Fig. 5B) and
sucrose equilibrium centrifugation (data not shown), viruslike
particles derived from BVHCV.Sp7
demonstrated a sedimentation pattern
similar to that of BVHCV.S-derived viruslike particles. These data
suggest that the HCV p7 protein is not required for the assembly of
HCV-like particles in insect cells, although we cannot rule out the
possibility that p7 may affect particle assembly in a subtle way.
HCV-like particles incorporate HCV RNAs.
Since the HCV-like
particles sedimented at a density typical of nucleic acid-containing
particles, we reasoned that these particles might contain nucleic
acids. Although the HCV cDNA used in our study contained only a partial
genome expressing the structural proteins, it is conceivable that RNA
transcribed from this partial genome could have been incorporated into
the HCV-like particles. To analyze whether the viruslike particles
contained nucleic acids, HCV-like particles were purified by
immunoprecipitation with an anti-E2 antibody (Fig.
6B) or by sucrose gradient centrifugation followed by immunoprecipitation (Fig. 6C). After extensive digestion with S. aureus nuclease and RNase A, nuclease-resistant
nucleic acids were purified from the immunopurified viral particles and subjected to Northern blot analysis. The HCV-like particles
incorporated short HCV transcripts, as indicated by hybridization of
the RNA with an HCV-specific probe (Fig. 6B and C). The signal was
specific for RNA because treatment of the purified nucleic acids from
the viruslike particles with RNase eliminated all of the signal,
whereas DNase treatment had no effect. The incorporated HCV RNA
appeared to be of degraded forms, as evidenced by the smear of RNA
species at the low molecular size, whereas the cDNA transcript of
BVHCV.S was about 2.8 kb (Fig. 6A). In order to distinguish between
preferential encapsidation and random, nonspecific incorporation of HCV
RNA by the viruslike particles, insect cells were coinfected with BVHCV.S and BVGUS (containing the cDNA for GUS) or BVHIV (containing the cDNA for the HIV glycoprotein precursor gp160). Northern blot analysis of total cellular RNA demonstrated similar levels of HCV, GUS,
and HIV gp160 transcripts (Fig. 6A). Analysis of RNA encapsidated into
the HCV-like particles of the coinfected insect cells revealed the
absence of GUS or HIV gp160 transcripts (Fig. 6B and C), suggesting
preferential incorporation into the HCV-like particles of HCV
transcripts over non-HCV transcripts.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 6.
(A) Analysis of total RNA of insect cells infected with
BVHCV.S, BVGUS, or a baculovirus containing the cDNA for the HIV
glycoprotein precursor gp160 (BVHIV). At 96 h postinfection, total
RNA was isolated as described in Materials and Methods and subjected to
Northern blot analysis with an HCV (lane 1)-, GUS (lane 2)-, or HIV
gp160 (lane 3)-specific cDNA probe. Ethidium bromide staining of the
18S RNA was used as a control for RNA loading. (B and C) Encapsidation
of HCV RNA into HCV-like particles. In order to distinguish between
preferential encapsidation and random, nonspecific incorporation of HCV
RNA by the viruslike particles, insect cells were coinfected with
BVHCV.S, BVGUS, and BVHIV. HCV-like particles were isolated by
immunoprecipitation (IP) (B) or sucrose gradient centrifugation
followed by immunoprecipitation (IP) (C) as described in Materials and
Methods. Particle-associated RNA was purified as described in Materials
and Methods and analyzed by Northern blotting with an HCV-specific cDNA
probe (HCV nt 259 to 2819; upper blots) or a GUS- and HIV
gp160-specific cDNA probe (lower blots). IgG, immunoglobulin G.
|
|
 |
DISCUSSION |
In this study, we presented several lines of evidence that HCV
structural proteins expressed in recombinant baculovirus-infected insect cells appeared to assemble into viruslike structures with a
lipid bilayer envelope. First, viruslike particles were visualized specifically in insect cells infected with BVHCV.S, and their morphology was similar to that of the putative HCV particles detected in cytoplasmic vesicles of an HCV-infected chimpanzee liver
(45), an HCV-infected human B-cell line (45), and
HCV cDNA-transfected HeLa cells (40). Second, the envelope
of the particles, presumably containing properly assembled E1 and E2,
was labeled specifically by anti-E1, anti-E2, and anti-HCV-infected
human serum containing high titers of anti-HCV antibodies. The same
anti-E2 antibody has been shown to bind HCV virions isolated from human
serum (42). Third, biophysical characterization of purified
HCV-like particles by CsCl and sucrose gradient centrifugation revealed
densities similar to those of putative HCV virions visualized by
electron microscopy (1.14 to 1.16 g/cm3
[22]) or demonstrated by detection of HCV genomes
(1.03 to 1.20 g/cm3 [47], 1.10 to 1.16 g/cm3 [46], or 1.08 g/cm3
[38]) by sucrose equilibrium centrifugation of
HCV-infected human plasma. Fourth, the particles could be partially
purified and exhibited morphology and immunoreactivity to anti-HCV
antibodies similar to those of the particles observed within cells.
Fifth, the partially purified particles contained HCV-specific RNA.
Although the current knowledge of HCV virion morphology is limited and
the biophysical characterization of putative virions is highly variable
in different systems, our data suggest that the morphology and
biophysical properties of HCV-like particles synthesized in insect
cells are similar to the features described for putative virions
isolated from HCV-infected humans. The lack of an efficient tissue
culture system for HCV propagation and the difficulty of HCV virion
detection in infected humans or chimpanzees other than by PCR precluded
a direct side-by-side comparison of the HCV-like particles with
authentic virions at the present time.
Prior studies demonstrated the expression of HCV structural proteins in
a baculovirus-insect cell system but did not report HCV-like particle
assembly (20, 27, 34, 36). The system used in the present
study differed from those used in the other studies in that our
expression construct contained part of the 5' UTR and the HCV cDNA was
obtained from a different patient source (23). It is
possible but unlikely that the 5' UTR included in the expression
construct may be required for appropriate initiation of protein
translation and polyprotein processing as a prerequisite for viral
assembly (43). Since a recent study (25)
elegantly demonstrated that only a minority of circulating viral
genomes represent infectious genomes, it is possible that the cDNA
sequences used in other baculovirus expression studies were unable to
form viral particles due to mutations in domains critical for viral assembly. Furthermore, we found that the optimal processing of infected
cells for electron microscopy was crucial for visualization of the
viruslike particles. Preservation of cellular and viral structures with
an optimal initial fixative buffer and a short period of osmium
treatment were important parameters for visualization of the viruslike
particles.
The described system may allow the determination of structural
requirements for HCV particle assembly. As a first step toward that
goal, we demonstrated that HCV protein p7 is not required for particle
assembly in insect cells. The function of protein p7, which is
conserved among the pestiviruses and HCV, is unknown. Its genomic
localization between the structural and nonstructural proteins of the
pestiviruses and HCV and the presence of two species of E2 proteins,
with and without p7, have led to the suggestion that p7 may play a role
in glycoprotein maturation or virus morphogenesis (8, 30,
41). However, no functional data have been presented so far to
support this hypothesis. For pestiviruses, it has been shown that the
p7 protein is not a major structural component of the virion
(8). Our functional analysis demonstrates that the p7
protein does not seem to be necessary for viral assembly in insect
cells, although we cannot completely exclude the possibility of p7
affecting viral assembly at the ultrastructural level.
Analysis of particle-associated nucleic acids demonstrated that
HCV-like particles contained short HCV RNAs and that these RNAs were
selectively incorporated into the particles over non-HCV transcripts.
The HCV RNA transcripts generated in this study may contain sufficient
cis-acting information (encapsidation signal) interacting
specifically with viral structural proteins for encapsidation. However,
since the incorporated transcripts were substantially degraded compared
to the 2.8-kb transcript of the HCV cDNA, the incorporation more likely
represents a cis-dominant, nonspecific effect of the
transcripts interacting with the structural proteins; i.e., the
physical proximity of the transcripts with their translated proteins
conferred a preferential interaction. During such a process, cytosolic
RNases may have access to the transcripts, resulting in partial
degradation. Further studies are under way to elucidate the mechanism
of the observed RNA encapsidation.
The synthesis of HCV-like particles in insect cells is potentially an
important tool for studying viral assembly and virus-cell interactions
and for the development of an HCV vaccine. In the latter case, efforts
to generate recombinant HCV subunit vaccines have been directed at the
expression of portions of individual structural proteins in soluble
form (6). This approach has met with marginal success,
partly as a result of the nonnative forms of the expressed viral
proteins. In contrast to the proteins in recombinant subunit vaccines,
the HCV proteins in HCV-like particles presumably are presented in a
native, virionlike conformation and may therefore be superior in
eliciting protective humoral and cellular immune responses. Since
HCV-like particles synthesized in insect cells are derived from partial
viral genomes without the nonstructural genes required for viral
replication, they are noninfectious and therefore represent excellent
candidates for an HCV vaccine. Studies are under way to determine the
immunogenicity of the HCV-like particles as a potential vaccine.
 |
ACKNOWLEDGMENTS |
We thank Kunitada Shimotohno for generously providing construct
pCVM980, Brian Seed for kindly providing plasmid pSyngp160, Richard
Lesniewski for the gift of polyclonal rabbit anti-E2(9284) antibody, Johnson Lau for monoclonal mouse anti-E1 and anti-E2 antibodies, Emmett V. Schmidt for providing recombinant vaccinia virus
vvHCV.S, and Bernard Moss for the gift of wild-type vaccinia virus
vvWT. We also thank Harry B. Greenberg, Stephen M. Feinstone, and Jay
H. Hoofnagle for helpful discussions. Excellent technical assistance by
Hucheng Bei, John Vergalla, Louise Trakimus, and Maria Ericsson is
gratefully appreciated.
This work was supported in part by a postdoctoral fellowship grant from
the Deutsche Forschungsgemeinschaft (Ba 1417/1-1) to T.F.B. and by
grants from the National Institutes of Health to T.F.B. (VF-DK-14361)
and T.J.L. (DK-01952 and CA-54525). S.I. was supported by the Harvard
Digestive Disease Center. D.T.W. was a recipient of a Glaxo Institute
for Digestive Health scientific research award and was supported by NIH
grants T30DK38707 and AI95-012.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Liver Diseases
Section, NIDDK, National Institutes of Health, 10 Center Dr., Rm. 9B16, Bethesda, MD 20892-1800. Phone: (301) 496-1721. Fax: (301) 402-0491. E-mail: JLiang{at}nih.gov.
 |
REFERENCES |
| 1.
|
Acs, G.,
M. A. Sells,
R. H. Purcell,
P. Price,
R. Engle,
M. Shapiro, and H. Popper.
1987.
Hepatitis B virus produced by transfected HepG2 cells causes hepatitis in chimpanzees.
Proc. Natl. Acad. Sci. USA
84:4641-4644[Abstract/Free Full Text].
|
| 2.
|
Alter, H. J.,
R. H. Purcell,
J. W. Shih,
J. C. Melpolder,
M. Houghton,
Q.-L. Choo, and G. Kuo.
1989.
Detection of antibody to hepatitis C virus in prospectively followed transfusion recipients with acute and chronic non-A, non-B hepatitis.
N. Engl. J. Med.
321:1494-1500[Abstract].
|
| 3.
|
Baumert, T. F.,
S. A. Rogers,
K. Hasegawa, and T. J. Liang.
1996.
Two core promoter mutations identified in a hepatitis B virus strain associated with fulminant hepatitis result in enhanced viral replication.
J. Clin. Invest.
98:2268-2276[Medline].
|
| 4.
|
Bielefeldt Ohmann, H., and B. Bloch.
1981.
Electron microscopic studies of bovine viral diarrhea virus in tissues of diseased calves and in cell cultures.
Arch. Virol.
71:57-74.
|
| 5.
|
Chomczynski, P. N., and N. Sacchi.
1987.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal. Biochem.
162:156-159[Medline].
|
| 6.
|
Choo, Q.-L.,
G. Kuo,
R. Ralston,
A. J. Weiner,
D. Chien,
G. Van Nest,
J. Han,
K. Berger,
K. Thudium,
C. Kuo,
J. Kansopon,
J. McFarland,
A. Tabrizi,
K. Ching,
B. Moss,
L. B. Cummins,
M. Houghton, and E. Muchmore.
1994.
Vaccination of chimpanzees against infection by the hepatitis C virus.
Proc. Natl. Acad. Sci. USA
91:1294-1298[Abstract/Free Full Text].
|
| 7.
|
Dubuisson, J.,
H. H. Hsu,
R. C. Cheung,
H. B. Greenberg,
D. R. Russell, and C. M. Rice.
1994.
Formation and intracellular localization of hepatitis C virus envelope glycoprotein complexes expressed by recombinant vaccinia and sindbis viruses.
J. Virol.
68:6147-6160[Abstract/Free Full Text].
|
| 8.
|
Elbers, K.,
N. Tautz,
P. Becher,
D. Stoll,
T. Rümenapf, and H.-J. Thiel.
1996.
Processing of the pestivirus E2-NS2 region: identification of proteins p7 and E2p7.
J. Virol.
70:4131-4135[Abstract].
|
| 9.
|
Feinstone, S. M.,
K. B. Mihalik,
T. Kamimura,
H. J. Alter,
W. T. London, and R. H. Purcell.
1983.
Inactivation of hepatitis B viruses and non-A, non-B hepatitis by chloroform.
Infect. Immun.
41:816-821[Abstract/Free Full Text].
|
| 10.
|
Gheysen, D.,
E. Jacobs,
F. De Foresta,
C. Thiriart,
M. Francotte,
D. Thines, and M. De Wilde.
1989.
Assembly and release of HIV-1 precursor pr55gag virus-like particles from recombinant baculovirus-infected insect cells.
Cell
59:103-112[Medline].
|
| 11.
|
Grakoui, A.,
C. Wychowski,
C. Lin,
S. M. Feinstone, and C. M. Rice.
1993.
Expression and identification of hepatitis C virus polyprotein cleavage products.
J. Virol.
67:1385-1395[Abstract/Free Full Text].
|
| 12.
|
Gray, E. W., and P. F. Nettleton.
1987.
The ultrastructure of cell cultures infected with border disease and bovine virus diarrhoea viruses.
J. Gen. Virol.
68:2339-2346[Abstract/Free Full Text].
|
| 13.
|
Harlow, E., and D. Lane.
1988.
In
Antibodies. A laboratory manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 14.
|
Hasegawa, K.,
J. Huang,
S. A. Rogers,
H. E. Blum, and T. J. Liang.
1994.
Enhanced replication of a hepatitis B virus mutant associated with an epidemic of fulminant hepatitis.
J. Virol.
68:1651-1659[Abstract/Free Full Text].
|
| 15.
|
He, L. E.,
D. Alling,
D. Popkin,
M. Shapiro,
H. J. Alter, and R. H. Purcell.
1987.
Determining the size of non-A, non-B hepatitis virus by filtration.
J. Infect. Dis.
156:636-640[Medline].
|
| 16.
|
Hijikata, M.,
N. Kato,
Y. Ootsuyama,
M. Nakagawa, and K. Shimotohno.
1991.
Gene mapping of the putative structural region of the hepatitis C virus genome by in vitro processing analysis.
Proc. Natl. Acad. Sci. USA
88:5547-5551[Abstract/Free Full Text].
|
| 17.
|
Hijikata, M.,
Y. K. Shimuzu,
H. Kato,
A. Iwamoto,
J. W. Shih,
H. J. Alter,
R. H. Purcell, and H. Yoshikura.
1993.
Equilibrium centrifugation studies of hepatitis C virus: evidence for circulating immune complexes.
J. Virol.
67:1953-1958[Abstract/Free Full Text].
|
| 18.
|
Hollinger, F. B.
1996.
Hepatitis B virus, p. 2738-2808.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa.
|
| 19.
|
Hoofnagle, J. H., and A. M. Di Bisceglie.
1997.
The treatment of chronic viral hepatitis.
N. Engl. J. Med.
336:347-356[Free Full Text].
|
| 20.
|
Hsu, H.,
M. Donets,
H. B. Greenberg, and S. M. Feinstone.
1993.
Characterization of hepatitis C virus structural proteins with a recombinant baculovirus expression system.
Hepatology
17:763-771[Medline].
|
| 21.
|
Ito, S., and M. J. Karnovsky.
1968.
Formaldehyde-glutaraldehyde fixatives containing trinitro compounds.
J. Cell Biol.
39:168A.
|
| 22.
|
Kaito, M.,
S. Watanabe,
K. Tsukiyama-Kohara,
K. Yamaguchi,
Y. Kobayashi,
M. Konishi,
M. Yokoi,
S. Ishida,
S. Suzuki, and M. Kohara.
1994.
Hepatitis C virus particle detected by immunoelectron microscopic study.
J. Gen. Virol.
75:1755-1760[Abstract/Free Full Text].
|
| 23.
|
Kato, N.,
M. Hijikata,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi,
T. Sugimura, and K. Shimotohno.
1990.
Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis.
Proc. Natl. Acad. Sci. USA
87:9524-9528[Abstract/Free Full Text].
|
| 24.
|
Kirnbauer, R.,
F. Booy,
N. Cheng,
D. R. Lowy, and J. T. Schiller.
1992.
Papillomavirus L1 major capsid protein self-assembles into virus-like particles that are highly immunogenic.
Proc. Natl. Acad. Sci. USA
89:12180-12184[Abstract/Free Full Text].
|
| 25.
|
Kolykhalov, A. A.,
E. V. Agapov,
K. J. Blight,
K. Mihalik,
S. M. Feinstone, and C. M. Rice.
1997.
Transmission of hepatitis C by intrahepatic inoculation with transcribed RNA.
Science
277:570-574[Abstract/Free Full Text].
|
| 26.
|
Kuo, G.,
Q.-L. Choo,
H. J. Alter,
G. L. Gitnick,
A. G. Redeker,
R. H. Purcell,
T. Miyamura,
J. L. Dienstag,
M. J. Alter,
C. E. Stevens,
G. E. Tegtmeier,
F. Bonino,
M. Colombo,
W.-S. Lee,
C. Kuo,
K. Berger,
R. J. Shuster,
L. R. Overby,
D. W. Bradley, and M. Houghton.
1989.
An assay for circulating antibodies to a major etiologic virus of human non-A, non-B hepatitis.
Science
244:362-364[Abstract/Free Full Text].
|
| 27.
|
Lanford, R. E.,
L. Notvall,
D. Chavez,
R. White,
G. Frenzel,
C. Simonsen, and J. Kim.
1993.
Analysis of hepatitis C virus capsid, E1, and E2/NS1 proteins expressed in insect cells.
Virology
197:225-235[Medline].
|
| 28.
|
Lemon, S. M., and D. L. Thomas.
1997.
Vaccines to prevent viral hepatitis.
N. Engl. J. Med.
336:197-203.
|
| 29.
|
Lesniewski, R.,
G. Okasinski,
R. Carrick,
C. Van Sant,
S. Desai,
R. Johnson,
J. Scheffel,
B. Moore, and I. Mushahwar.
1995.
Antibody to hepatitis C virus second envelope (HCV-E2) glycoprotein: a new marker of HCV infection closely associated with viremia.
J. Med. Virol.
45:415-422[Medline].
|
| 30.
|
Lin, C.,
B. D. Lindenbach,
B. Pragai,
D. W. McCourt, and C. M. Rice.
1994.
Processing of the hepatitis C E2-NS2 region: identification of p7 and two distinct E2-specific products with different C termini.
J. Virol.
68:5063-5073[Abstract/Free Full Text].
|
| 31.
|
Lo, S.-Y.,
M. S. Selby, and J.-H. Ou.
1996.
Interaction between hepatitis C virus core protein and E1 envelope protein.
J. Virol.
70:5177-5182[Abstract/Free Full Text].
|
| 32.
|
Luckow, V. A.,
S. C. Lee,
G. F. Barry, and P. O. Olins.
1993.
Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertions of foreign genes into a baculovirus genome propagated in Escherichia coli.
J. Virol.
67:4566-4579[Abstract/Free Full Text].
|
| 33.
|
Luckow, V. A., and M. D. Summers.
1988.
Trends in the development of baculovirus expression vectors.
Bio/Technology
6:47-55.
|
| 34.
|
Matsuura, Y.,
S. Harada,
R. Susuki,
Y. Watanabe,
Y. Inoue,
I. Saito, and T. Miyamura.
1992.
Expression of processed envelope protein of hepatitis C virus in mammalian and insect cells.
J. Virol.
66:1425-1431[Abstract/Free Full Text].
|
| 35.
|
Matsuura, Y., and T. Miyamura.
1993.
The molecular biology of hepatitis C virus.
Semin. Virol.
4:297-304.
|
| 36.
|
Matsuura, Y.,
T. Suzuki,
R. Suzuki,
M. Sato,
H. Aizaki,
I. Saito, and T. Miyamura.
1994.
Processing of E1 and E2 glycoproteins of hepatitis C virus expressed in mammalian and insect cells.
Virology
205:141-150[Medline].
|
| 37.
|
McEwen, C. R.
1967.
Tables for estimating sedimentation through linear concentration gradients of sucrose solution.
Anal. Biochem.
20:114-149[Medline].
|
| 38.
|
Miyamoto, H.,
H. Okamoto,
K. Sato,
T. Tanaka, and S. Mishiro.
1992.
Extraordinarily low density of hepatitis C virus estimated by sucrose gradient centrifugation and the polymerase chain reaction.
J. Gen. Virol.
73:715-718[Abstract/Free Full Text].
|
| 39.
|
Miyamura, T., and Y. Matsuura.
1993.
Structural proteins of hepatitis C virus.
Trends Microbiol.
1:229-231[Medline].
|
| 40.
|
Mizuno, M.,
G. Yamada,
T. Tanaka,
K. Shimotohno,
M. Takatani, and T. Tsuji.
1995.
Virion-like structures in HeLa G cells transfected with the full-length sequence of the hepatitis C virus genome.
Gastroenterology
109:1933-1940[Medline].
|
| 41.
|
Mizushima, H.,
M. Hijikata,
S.-I. Asabe,
M. Hirota,
K. Kimura, and K. Shimotohno.
1994.
Two hepatitis C virus glycoprotein E2 products with different C termini.
J. Virol.
68:6215-6222[Abstract/Free Full Text].
|
| 42.
|
Prince, A. M.,
T. Huima-Byron,
T. S. Parker, and D. M. Levine.
1996.
Visualization of hepatitis C virions and putative defective interfering particles isolated from low-density lipoproteins.
J. Viral Hepatitis
3:11-17[Medline].
|
| 43.
|
Reynolds, J. E.,
A. Kaminski,
H. J. Kettinen,
K. Grace,
B. E. Clarke,
A. R. Carrol,
D. J. Rowlands, and R. J. Jackson.
1995.
Unique features of internal initation of hepatitis C virus RNA translation.
EMBO J.
14:6010-6020[Medline].
|
| 44.
|
Rice, C. M.
1996.
Flaviviridae: the viruses and their replication, p. 931-959.
In
B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, 3rd ed. Lippincott-Raven, Philadelphia, Pa.
|
| 45.
|
Shimuzu, Y. K.,
S. M. Feinstone,
M. Kohara,
R. Purcell, and H. Yoshikura.
1996.
Hepatitis C virus: detection of intracellular virus particles by electron microscopy.
Hepatology
23:205-209[Medline].
|
| 46.
|
Shindo, M.,
A. M. Di Bisceglie,
T. Akatsuka,
T.-L. Fong,
L. Scaglione,
M. Donets,
J. H. Hoofnagle, and S. M. Feinstone.
1994.
The physical state of the negative strand of hepatitis C virus RNA in serum of patients with chronic hepatitis C.
Proc. Natl. Acad. Sci. USA
91:8719-8723[Abstract/Free Full Text].
|
| 47.
|
Thomssen, R.,
S. Bonk,
C. Propfe,
K.-H. Heermann,
H. G. Koechel, and A. Uy.
1992.
Association of hepatitis C virus in human sera with beta-lipoprotein.
Med. Microbiol. Immunol.
181:293-300[Medline].
|
| 48.
|
Tong, M. J.,
N. S. El-Farra,
A. R. Reikes, and R. L. Co.
1995.
Clinical outcomes after transfusion-associated hepatitis C.
N. Engl. J. Med.
332:1463-1466[Abstract/Free Full Text].
|
| 49.
|
Zeng, C. Q.-Y.,
M. J. Wentz,
J. Cohen,
M. K. Estes, and R. F. Ramig.
1996.
Characterization and replicase activity of double-layered and single-layered rotavirus-like particles expressed from baculovirus recombinants.
J. Virol.
70:2736-2742[Abstract].
|
J Virol, May 1998, p. 3827-3836, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Burlone, M. E., Budkowska, A.
(2009). Hepatitis C virus cell entry: role of lipoproteins and cellular receptors. J. Gen. Virol.
90: 1055-1070
[Abstract]
[Full Text]
-
Barth, H., Schnober, E. K., Neumann-Haefelin, C., Thumann, C., Zeisel, M. B., Diepolder, H. M., Hu, Z., Liang, T. J., Blum, H. E., Thimme, R., Lambotin, M., Baumert, T. F.
(2008). Scavenger Receptor Class B Is Required for Hepatitis C Virus Uptake and Cross-Presentation by Human Dendritic Cells. J. Virol.
82: 3466-3479
[Abstract]
[Full Text]
-
Gastaminza, P., Cheng, G., Wieland, S., Zhong, J., Liao, W., Chisari, F. V.
(2008). Cellular Determinants of Hepatitis C Virus Assembly, Maturation, Degradation, and Secretion. J. Virol.
82: 2120-2129
[Abstract]
[Full Text]
-
Murray, C. L., Jones, C. T., Tassello, J., Rice, C. M.
(2007). Alanine Scanning of the Hepatitis C Virus Core Protein Reveals Numerous Residues Essential for Production of Infectious Virus. J. Virol.
81: 10220-10231
[Abstract]
[Full Text]
-
Tani, H., Komoda, Y., Matsuo, E., Suzuki, K., Hamamoto, I., Yamashita, T., Moriishi, K., Fujiyama, K., Kanto, T., Hayashi, N., Owsianka, A., Patel, A. H., Whitt, M. A., Matsuura, Y.
(2007). Replication-Competent Recombinant Vesicular Stomatitis Virus Encoding Hepatitis C Virus Envelope Proteins. J. Virol.
81: 8601-8612
[Abstract]
[Full Text]
-
Elmowalid, G. A., Qiao, M., Jeong, S.-H., Borg, B. B., Baumert, T. F., Sapp, R. K., Hu, Z., Murthy, K., Liang, T. J.
(2007). Immunization with hepatitis C virus-like particles results in control of hepatitis C virus infection in chimpanzees. Proc. Natl. Acad. Sci. USA
104: 8427-8432
[Abstract]
[Full Text]
-
Gastaminza, P., Kapadia, S. B., Chisari, F. V.
(2006). Differential Biophysical Properties of Infectious Intracellular and Secreted Hepatitis C Virus Particles. J. Virol.
80: 11074-11081
[Abstract]
[Full Text]
-
Barth, H., Schnober, E. K., Zhang, F., Linhardt, R. J., Depla, E., Boson, B., Cosset, F.-L., Patel, A. H., Blum, H. E., Baumert, T. F.
(2006). Viral and Cellular Determinants of the Hepatitis C Virus Envelope-Heparan Sulfate Interaction. J. Virol.
80: 10579-10590
[Abstract]
[Full Text]
-
Vauloup-Fellous, C., Pene, V., Garaud-Aunis, J., Harper, F., Bardin, S., Suire, Y., Pichard, E., Schmitt, A., Sogni, P., Pierron, G., Briand, P., Rosenberg, A. R.
(2006). Signal Peptide Peptidase-catalyzed Cleavage of Hepatitis C Virus Core Protein Is Dispensable for Virus Budding but Destabilizes the Viral Capsid. J. Biol. Chem.
281: 27679-27692
[Abstract]
[Full Text]
-
Dreux, M., Pietschmann, T., Granier, C., Voisset, C., Ricard-Blum, S., Mangeot, P.-E., Keck, Z., Foung, S., Vu-Dac, N., Dubuisson, J., Bartenschlager, R., Lavillette, D., Cosset, F.-L.
(2006). High Density Lipoprotein Inhibits Hepatitis C Virus-neutralizing Antibodies by Stimulating Cell Entry via Activation of the Scavenger Receptor BI. J. Biol. Chem.
281: 18285-18295
[Abstract]
[Full Text]
-
Cocquerel, L., Voisset, C., Dubuisson, J.
(2006). Hepatitis C virus entry: potential receptors and their biological functions.. J. Gen. Virol.
87: 1075-1084
[Abstract]
[Full Text]
-
Chapel, C., Garcia, C., Roingeard, P., Zitzmann, N., Dubuisson, J., Dwek, R. A., Trepo, C., Zoulim, F., Durantel, D.
(2006). Antiviral effect of {alpha}-glucosidase inhibitors on viral morphogenesis and binding properties of hepatitis C virus-like particles.. J. Gen. Virol.
87: 861-871
[Abstract]
[Full Text]
-
Eren, R., Landstein, D., Terkieltaub, D., Nussbaum, O., Zauberman, A., Ben-Porath, J., Gopher, J., Buchnick, R., Kovjazin, R., Rosenthal-Galili, Z., Aviel, S., Ilan, E., Shoshany, Y., Neville, L., Waisman, T., Ben-Moshe, O., Kischitsky, A., Foung, S. K. H., Keck, Z.-Y., Pappo, O., Eid, A., Jurim, O., Zamir, G., Galun, E., Dagan, S.
(2006). Preclinical Evaluation of Two Neutralizing Human Monoclonal Antibodies against Hepatitis C Virus (HCV): a Potential Treatment To Prevent HCV Reinfection in Liver Transplant Patients. J. Virol.
80: 2654-2664
[Abstract]
[Full Text]
-
Griffin, S., Clarke, D., McCormick, C., Rowlands, D., Harris, M.
(2005). Signal Peptide Cleavage and Internal Targeting Signals Direct the Hepatitis C Virus p7 Protein to Distinct Intracellular Membranes. J. Virol.
79: 15525-15536
[Abstract]
[Full Text]
-
Sandrin, V., Boulanger, P., Penin, F., Granier, C., Cosset, F.-L., Bartosch, B.
(2005). Assembly of functional hepatitis C virus glycoproteins on infectious pseudoparticles occurs intracellularly and requires concomitant incorporation of E1 and E2 glycoproteins. J. Gen. Virol.
86: 3189-3199
[Abstract]
[Full Text]
-
Balasubramanian, A., Munshi, N., Koziel, M. J., Hu, Z., Liang, T. J., Groopman, J. E., Ganju, R. K.
(2005). Structural proteins of Hepatitis C virus induce interleukin 8 production and apoptosis in human endothelial cells. J. Gen. Virol.
86: 3291-3301
[Abstract]
[Full Text]
-
Majeau, N., Gagne, V., Bolduc, M., Leclerc, D.
(2005). Signal peptide peptidase promotes the formation of hepatitis C virus non-enveloped particles and is captured on the viral membrane during assembly. J. Gen. Virol.
86: 3055-3064
[Abstract]
[Full Text]
-
Zhang, C., Cai, Z., Kim, Y.-C., Kumar, R., Yuan, F., Shi, P.-Y., Kao, C., Luo, G.
(2005). Stimulation of Hepatitis C Virus (HCV) Nonstructural Protein 3 (NS3) Helicase Activity by the NS3 Protease Domain and by HCV RNA-Dependent RNA Polymerase. J. Virol.
79: 8687-8697
[Abstract]
[Full Text]
-
Klein, K. C., Dellos, S. R., Lingappa, J. R.
(2005). Identification of Residues in the Hepatitis C Virus Core Protein That Are Critical for Capsid Assembly in a Cell-Free System. J. Virol.
79: 6814-6826
[Abstract]
[Full Text]
-
Barth, H., Cerino, R., Arcuri, M., Hoffmann, M., Schurmann, P., Adah, M. I., Gissler, B., Zhao, X., Ghisetti, V., Lavezzo, B., Blum, H. E., von Weizsacker, F., Vitelli, A., Scarselli, E., Baumert, T. F.
(2005). Scavenger Receptor Class B Type I and Hepatitis C Virus Infection of Primary Tupaia Hepatocytes. J. Virol.
79: 5774-5785
[Abstract]
[Full Text]
-
Barth, H., Ulsenheimer, A., Pape, G. R., Diepolder, H. M., Hoffmann, M., Neumann-Haefelin, C., Thimme, R., Henneke, P., Klein, R., Paranhos-Baccala, G., Depla, E., Liang, T. J., Blum, H. E., Baumert, T. F.
(2005). Uptake and presentation of hepatitis C virus-like particles by human dendritic cells. Blood
105: 3605-3614
[Abstract]
[Full Text]
-
Isherwood, B. J., Patel, A. H.
(2005). Analysis of the processing and transmembrane topology of the E2p7 protein of hepatitis C virus. J. Gen. Virol.
86: 667-676
[Abstract]
[Full Text]
-
Heller, T., Saito, S., Auerbach, J., Williams, T., Moreen, T. R., Jazwinski, A., Cruz, B., Jeurkar, N., Sapp, R., Luo, G., Liang, T. J.
(2005). An in vitro model of hepatitis C virion production. Proc. Natl. Acad. Sci. USA
102: 2579-2583
[Abstract]
[Full Text]
-
Girard, C., Ravallec, M., Mariller, M., Bossy, J.-P., Cahour, A., Lopez-Ferber, M., Devauchelle, G., Inchauspe, G., Duonor-Cerutti, M.
(2004). Effect of the 5' non-translated region on self-assembly of hepatitis C virus genotype 1a structural proteins produced in insect cells. J. Gen. Virol.
85: 3659-3670
[Abstract]
[Full Text]
-
Meyer, K., Beyene, A., Bowlin, T. L., Basu, A., Ray, R.
(2004). Coexpression of Hepatitis C Virus E1 and E2 Chimeric Envelope Glycoproteins Displays Separable Ligand Sensitivity and Increases Pseudotype Infectious Titer. J. Virol.
78: 12838-12847
[Abstract]
[Full Text]
-
Ogino, T., Fukuda, H., Imajoh-Ohmi, S., Kohara, M., Nomoto, A.
(2004). Membrane Binding Properties and Terminal Residues of the Mature Hepatitis C Virus Capsid Protein in Insect Cells. J. Virol.
78: 11766-11777
[Abstract]
[Full Text]
-
Ansari, I. H., Chen, L.-M., Liang, D., Gil, L. H., Zhong, W., Donis, R. O.
(2004). Involvement of a Bovine Viral Diarrhea Virus NS5B Locus in Virion Assembly. J. Virol.
78: 9612-9623
[Abstract]
[Full Text]
-
Steinmann, D., Barth, H., Gissler, B., Schurmann, P., Adah, M. I., Gerlach, J. T., Pape, G. R., Depla, E., Jacobs, D., Maertens, G., Patel, A. H., Inchauspe, G., Liang, T. J., Blum, H. E., Baumert, T. F.
(2004). Inhibition of Hepatitis C Virus-Like Particle Binding to Target Cells by Antiviral Antibodies in Acute and Chronic Hepatitis C. J. Virol.
78: 9030-9040
[Abstract]
[Full Text]
-
Klein, K. C., Polyak, S. J., Lingappa, J. R.
(2004). Unique Features of Hepatitis C Virus Capsid Formation Revealed by De Novo Cell-Free Assembly. J. Virol.
78: 9257-9269
[Abstract]
[Full Text]
-
McKeating, J. A., Zhang, L. Q., Logvinoff, C., Flint, M., Zhang, J., Yu, J., Butera, D., Ho, D. D., Dustin, L. B., Rice, C. M., Balfe, P.
(2004). Diverse Hepatitis C Virus Glycoproteins Mediate Viral Infection in a CD81-Dependent Manner. J. Virol.
78: 8496-8505
[Abstract]
[Full Text]
-
Jeong, S.-H., Qiao, M., Nascimbeni, M., Hu, Z., Rehermann, B., Murthy, K., Liang, T. J.
(2004). Immunization with Hepatitis C Virus-Like Particles Induces Humoral and Cellular Immune Responses in Nonhuman Primates. J. Virol.
78: 6995-7003
[Abstract]
[Full Text]
-
Keck, Z.-Y., Sung, V. M. H., Perkins, S., Rowe, J., Paul, S., Liang, T. J., Lai, M. M. C., Foung, S. K. H.
(2004). Human Monoclonal Antibody to Hepatitis C Virus E1 Glycoprotein That Blocks Virus Attachment and Viral Infectivity. J. Virol.
78: 7257-7263
[Abstract]
[Full Text]
-
Ghibaudo, D., Cohen, L., Penin, F., Martin, A.
(2004). Characterization of GB Virus B Polyprotein Processing Reveals the Existence of a Novel 13-kDa Protein with Partial Homology to Hepatitis C Virus p7 Protein. J. Biol. Chem.
279: 24965-24975
[Abstract]
[Full Text]
-
Cristofari, G., Ivanyi-Nagy, R., Gabus, C., Boulant, S., Lavergne, J.-P., Penin, F., Darlix, J.-L.
(2004). The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro. Nucleic Acids Res
32: 2623-2631
[Abstract]
[Full Text]
-
Basu, A., Beyene, A., Meyer, K., Ray, R.
(2004). The Hypervariable Region 1 of the E2 Glycoprotein of Hepatitis C Virus Binds to Glycosaminoglycans, but This Binding Does Not Lead to Infection in a Pseudotype System. J. Virol.
78: 4478-4486
[Abstract]
[Full Text]
-
Majeau, N., Gagne, V., Boivin, A., Bolduc, M., Majeau, J.-A., Ouellet, D., Leclerc, D.
(2004). The N-terminal half of the core protein of hepatitis C virus is sufficient for nucleocapsid formation. J. Gen. Virol.
85: 971-981
[Abstract]
[Full Text]
-
Zhang, J., Randall, G., Higginbottom, A., Monk, P., Rice, C. M., McKeating, J. A.
(2004). CD81 Is Required for Hepatitis C Virus Glycoprotein-Mediated Viral Infection. J. Virol.
78: 1448-1455
[Abstract]
[Full Text]
-
Maillard, P., Lavergne, J.-P., Siberil, S., Faure, G., Roohvand, F., Petres, S., Teillaud, J. L., Budkowska, A.
(2004). Fc{gamma} Receptor-like Activity of Hepatitis C Virus Core Protein. J. Biol. Chem.
279: 2430-2437
[Abstract]
[Full Text]
-
Bartosch, B., Vitelli, A., Granier, C., Goujon, C., Dubuisson, J., Pascale, S., Scarselli, E., Cortese, R., Nicosia, A., Cosset, F.-L.
(2003). Cell Entry of Hepatitis C Virus Requires a Set of Co-receptors That Include the CD81 Tetraspanin and the SR-B1 Scavenger Receptor. J. Biol. Chem.
278: 41624-41630
[Abstract]
[Full Text]
-
Barth, H., Schafer, C., Adah, M. I., Zhang, F., Linhardt, R. J., Toyoda, H., Kinoshita-Toyoda, A., Toida, T., van Kuppevelt, T. H., Depla, E., von Weizsacker, F., Blum, H. E., Baumert, T. F.
(2003). Cellular Binding of Hepatitis C Virus Envelope Glycoprotein E2 Requires Cell Surface Heparan Sulfate. J. Biol. Chem.
278: 41003-41012
[Abstract]
[Full Text]
-
Murata, K., Lechmann, M., Qiao, M., Gunji, T., Alter, H. J., Liang, T. J.
(2003). Immunization with hepatitis C virus-like particles protects mice from recombinant hepatitis C virus-vaccinia infection. Proc. Natl. Acad. Sci. USA
100: 6753-6758
[Abstract]
[Full Text]
-
Lozach, P.-Y., Lortat-Jacob, H., De Lacroix De Lavalette, A., Staropoli, I., Foung, S., Amara, A., Houles, C., Fieschi, F., Schwartz, O., Virelizier, J.-L., Arenzana-Seisdedos, F., Altmeyer, R.
(2003). DC-SIGN and L-SIGN Are High Affinity Binding Receptors for Hepatitis C Virus Glycoprotein E2. J. Biol. Chem.
278: 20358-20366
[Abstract]
[Full Text]
-
Pohlmann, S., Zhang, J., Baribaud, F., Chen, Z., Leslie, G. J., Lin, G., Granelli-Piperno, A., Doms, R. W., Rice, C. M., McKeating, J. A.
(2003). Hepatitis C Virus Glycoproteins Interact with DC-SIGN and DC-SIGNR. J. Virol.
77: 4070-4080
[Abstract]
[Full Text]
-
Blanchard, E., Brand, D., Roingeard, P., Ezelle, H. J., Markovic, D., Barber, G. N.
(2003). Endogenous Virus and Hepatitis C Virus-Like Particle Budding in BHK-21 Cells. J. Virol.
77: 3888-3889
[Full Text]
-
Bartosch, B., Dubuisson, J., Cosset, F.-L.
(2003). Infectious Hepatitis C Virus Pseudo-particles Containing Functional E1-E2 Envelope Protein Complexes. JEM
197: 633-642
[Abstract]
[Full Text]
-
Molenkamp, R., Kooi, E. A., Lucassen, M. A., Greve, S., Thijssen, J. C. P., Spaan, W. J. M., Bredenbeek, P. J.
(2002). Yellow Fever Virus Replicons as an Expression System for Hepatitis C Virus Structural Proteins. J. Virol.
77: 1644-1648
[Abstract]
[Full Text]
-
Saunier, B., Triyatni, M., Ulianich, L., Maruvada, P., Yen, P., Kohn, L. D.
(2002). Role of the Asialoglycoprotein Receptor in Binding and Entry of Hepatitis C Virus Structural Proteins in Cultured Human Hepatocytes. J. Virol.
77: 546-559
[Abstract]
[Full Text]
-
Ma, H.-C., Ke, C.-H., Hsieh, T.-Y., Lo, S.-Y.
(2002). The first hydrophobic domain of the hepatitis C virus E1 protein is important for interaction with the capsid protein. J. Gen. Virol.
83: 3085-3092
[Abstract]
[Full Text]
-
Ezelle, H. J., Markovic, D., Barber, G. N.
(2002). Generation of Hepatitis C Virus-Like Particles by Use of a Recombinant Vesicular Stomatitis Virus Vector. J. Virol.
76: 12325-12334
[Abstract]
[Full Text]
-
Labonte, P., Axelrod, V., Agarwal, A., Aulabaugh, A., Amin, A., Mak, P.
(2002). Modulation of Hepatitis C Virus RNA-dependent RNA Polymerase Activity by Structure-based Site-directed Mutagenesis. J. Biol. Chem.
277: 38838-38846
[Abstract]
[Full Text]
-
Triyatni, M., Saunier, B., Maruvada, P., Davis, A. R., Ulianich, L., Heller, T., Patel, A., Kohn, L. D., Liang, T. J.
(2002). Interaction of Hepatitis C Virus-Like Particles and Cells: a Model System for Studying Viral Binding and Entry. J. Virol.
76: 9335-9344
[Abstract]
[Full Text]
-
Clayton, R. F., Owsianka, A., Aitken, J., Graham, S., Bhella, D., Patel, A. H.
(2002). Analysis of Antigenicity and Topology of E2 Glycoprotein Present on Recombinant Hepatitis C Virus-Like Particles. J. Virol.
76: 7672-7682
[Abstract]
[Full Text]
-
Bichr, S., Rende-Fournier, R., Vona, G., Yamamoto, A.-M., Depla, E., Maertens, G., Brechot, C.
(2002). Detection of neutralizing antibodies to hepatitis C virus using a biliary cell infection model. J. Gen. Virol.
83: 1673-1678
[Abstract]
[Full Text]
-
Lambot, M., Fretier, S., De Beeck, A. O., Quatannens, B., Lestavel, S., Clavey, V., Dubuisson, J.
(2002). Reconstitution of Hepatitis C Virus Envelope Glycoproteins into Liposomes as a Surrogate Model to Study Virus Attachment. J. Biol. Chem.
277: 20625-20630
[Abstract]
[Full Text]
-
Pietschmann, T., Lohmann, V., Kaul, A., Krieger, N., Rinck, G., Rutter, G., Strand, D., Bartenschlager, R.
(2002). Persistent and Transient Replication of Full-Length Hepatitis C Virus Genomes in Cell Culture. J. Virol.
76: 4008-4021
[Abstract]
[Full Text]
-
Blanchard, E., Brand, D., Trassard, S., Goudeau, A., Roingeard, P.
(2002). Hepatitis C Virus-Like Particle Morphogenesis. J. Virol.
76: 4073-4079
[Abstract]
[Full Text]
-
Wellnitz, S., Klumpp, B., Barth, H., Ito, S., Depla, E., Dubuisson, J., Blum, H. E., Baumert, T. F.
(2002). Binding of Hepatitis C Virus-Like Particles Derived from Infectious Clone H77C to Defined Human Cell Lines. J. Virol.
76: 1181-1193
[Abstract]
[Full Text]
-
Hope, R. G., Murphy, D. J., McLauchlan, J.
(2002). The Domains Required to Direct Core Proteins of Hepatitis C Virus and GB Virus-B to Lipid Droplets Share Common Features with Plant Oleosin Proteins. J. Biol. Chem.
277: 4261-4270
[Abstract]
[Full Text]
-
Fournillier, A., Wychowski, C., Boucreux, D., Baumert, T. F., Meunier, J.-C., Jacobs, D., Muguet, S., Depla, E., Inchauspe, G.
(2001). Induction of Hepatitis C Virus E1 Envelope Protein-Specific Immune Response Can Be Enhanced by Mutation of N-Glycosylation Sites. J. Virol.
75: 12088-12097
[Abstract]
[Full Text]
-
Lu, W., Strohecker, A., Ou, J.-h.
(2001). Post-translational Modification of the Hepatitis C Virus Core Protein by Tissue Transglutaminase. J. Biol. Chem.
276: 47993-47999
[Abstract]
[Full Text]
-
Cerino, A., Meola, A., Segagni, L., Furione, M., Marciano, S., Triyatni, M., Liang, T. J., Nicosia, A., Mondelli, M. U.
(2001). Monoclonal Antibodies with Broad Specificity for Hepatitis C Virus Hypervariable Region 1 Variants Can Recognize Viral Particles. J. Immunol.
167: 3878-3886
[Abstract]
[Full Text]
-
Maillard, P., Krawczynski, K., Nitkiewicz, J., Bronnert, C., Sidorkiewicz, M., Gounon, P., Dubuisson, J., Faure, G., Crainic, R., Budkowska, A.
(2001). Nonenveloped Nucleocapsids of Hepatitis C Virus in the Serum of Infected Patients. J. Virol.
75: 8240-8250
[Abstract]
[Full Text]
-
Owsianka, A., Clayton, R. F., Loomis-Price, L. D., McKeating, J. A., Patel, A. H.
(2001). Functional analysis of hepatitis C virus E2 glycoproteins and virus-like particles reveals structural dissimilarities between different forms of E2. J. Gen. Virol.
82: 1877-1883
[Abstract]
[Full Text]
-
Kunkel, M., Lorinczi, M., Rijnbrand, R., Lemon, S. M., Watowich, S. J.
(2001). Self-Assembly of Nucleocapsid-Like Particles from Recombinant Hepatitis C Virus Core Protein. J. Virol.
75: 2119-2129
[Abstract]
[Full Text]
-
Bartenschlager, R., Lohmann, V.
(2000). Replication of hepatitis C virus. J. Gen. Virol.
81: 1631-1648
[Full Text]
-
Shimoike, T., Mimori, S., Tani, H., Matsuura, Y., Miyamura, T.
(1999). Interaction of Hepatitis C Virus Core Protein with Viral Sense RNA and Suppression of Its Translation. J. Virol.
73: 9718-9725
[Abstract]
[Full Text]
-
Lim, K. P., Liu, D. X.
(2001). The Missing Link in Coronavirus Assembly. RETENTION OF THE AVIAN CORONAVIRUS INFECTIOUS BRONCHITIS VIRUS ENVELOPE PROTEIN IN THE PRE-GOLGI COMPARTMENTS AND PHYSICAL INTERACTION BETWEEN THE ENVELOPE AND MEMBRANE PROTEINS. J. Biol. Chem.
276: 17515-17523
[Abstract]
[Full Text]