Previous Article | Next Article 
J Virol, May 1998, p. 3673-3683, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Structured-Tree Topology and Adaptive Evolution of the Simian
Immunodeficiency Virus SIVsm Envelope during Serial Passage in
Rhesus Macaques According to Likelihood Mapping and Quartet
Puzzling
P. J.
Spencer Valli and
Jaap
Goudsmit*
Department of Human Retrovirology, Academic
Medical Centre, University of Amsterdam, Amsterdam, The Netherlands
Received 9 June 1997/Accepted 26 January 1998
 |
ABSTRACT |
Species-specific strains of simian immunodeficiency virus (SIV) are
nonpathogenic in African primates. The SIV strain most closely related
to human immunodeficiency virus type 2 (HIV-2) is SIVsm, the strain
specific to the sooty mangabey (Cercocebus atys). Infection
of Asian primates with SIV causes AIDS and allows the study of the
adaptive evolution of a lentivirus to replicate efficiently in a new
host, providing a useful animal model of HIV infection and AIDS in
humans. Serial passage of SIVsm from sooty mangabeys in rhesus macaques
drastically shortened the time of disease progression from 1.5 years to
1 month as the retrovirus adapted to these Asian hosts. In the present
study we analyzed the quasispecies nature of the SIVsm envelope gene
(env) during serial population passage in rhesus macaques.
We asked ourselves if phylogenetic evidence could be provided for the
structured topology of the SIVsm env tree and subsequently
for the adaptive evolution of SIVsm env. Likelihood mapping
showed that phylogenetic reconstruction of the passage was possible
because a high percentage of the sequence data had a "tree-like"
form. Subsequently, quartet puzzling was used and produced a phylogeny
with a structure parallel to the known infection history. The
adaptation of SIVsm to Asian rhesus macaques appears to be an ordered
process in which the env evolves in a tree-like manner,
particularly in its constant regions.
 |
INTRODUCTION |
Zoonotic transmission of some
lentiviruses causes AIDS. The two principal etiologic agents of AIDS in
humans are the human immunodeficiency viruses types 1 and 2 (HIV-1 and
HIV-2), whose probable ancestors are found in two species of feral
African primates (simian immunodeficiency virus SIVcpz and SIVsm)
(17). HIV-2 appears to be descended from the SIVsm lineage
(Fig. 1), as shown not only by sequence
homology but also by the geographically localized infections
(27) of humans and sooty mangabeys (Cercocebus
atys) with this virus. However, the issue of HIV origins remains
open to question (33a). The SIV strains do not induce
disease in their natural hosts. The relation between pathogenesis and
virus strain is not well understood but appears to be both host and
pathogen related. When Asian macaques are experimentally infected with SIVsm, SIVagm, SIVmac, or a related molecular clone, the disease course
mimics that seen in human AIDS (41) and thus provides a
useful model for vaccine testing.

View larger version (13K):
[in this window]
[in a new window]
|
FIG. 1.
Phylogeny of the African SIV and HIV-2 strains
commonly used in experimental infections. Known pathogenic and less
pathogenic SIVs are seen to cluster together (e.g., SIVH4 and SIVSMM9,
and SIVMM239 and SIVMM1A11) according to virus strain and not by
pathogenicity. The P1 and P6 sequences are more divergent than some of
the other clades. It is also noteworthy that the pathogenicity of the
P6A and P6B viruses is equal to that of PBJ14 but there is no tendency
for these two SIVSMM derived env sequences to cluster
together. The same results were achieved with different P1 and P6A or
P6B sequences as examples. This tree was constructed with PUZZLE 3.0 with the Tamura-Nei distance approximation and 1,000 tree-puzzling
steps and was rooted with the serial passage P1 sequence. The number at
each internal branch is the percentage of the 1,000 intermediate trees
having that branching pattern. The branch lengths are not important in
this cladogram; only the reliability values and branching pattern are
important.
|
|
Although the length of the asymptomatic period of SIV infection varies
greatly among individual Asian primates, the numerous SIVsm-derived
viruses show a wide spectrum of pathogenicity or virulence. The most
pathogenic SIVsm strain is the SIVsmPbJ14 (14, 20, 37), with
an average time to death of 14 days. SIVsmH4 and SIVMac239 are both
pathogenic during experimental infection but have a mean time to death
of 1 year (19, 21-24). The related clones SIVsmm9 and
SIV1A11 are relatively nonpathogenic, with times to death of several
years. The length of the asymptomatic period during experimental
infection with the many SIVsm-derived clones (11, 25, 28, 31, 37,
41, 42, 46) is presumably virus strain dependent, as shown by
repeated infections with the same clones.
Viral variation is known to occur within a single cycle of
intracellular replication (40), and the progeny virus from
an infected cell may vary genetically from the parental virus. This genetic flexibility enables the rapid development of new mutants (3) by means of subtle changes in the env surface
glycoprotein (3, 9, 12). The env genes of HIV-2
and SIVsm have the same functional layout, with five variable and
constant domains and discrete (over 98% nonsynonymous [35, 38,
55]) nucleotide changes within the variable regions (V1, V2,
V3, V4, and V5). The high nonsynonymous-substitution rate supports
positive selection for nonfounder or adapted mutant virus by outgrowth
of these new variants from the circulating virus population of founder
or primary inoculum genotypes (14, 33, 47). Thought to be
driven by the antigenic selection (14, 47) of new variants,
constant evolution of new genotypes and the coexistence of distinct
strains (54) during infection is believed to be sequence
variation dependent, due to the number of different genomic variants
that exist at any one time.
The goal of this study was to examine viral sequence variation during
adaptation of the V1 to V4 regions of the env gene of SIVsm
in the serum of immunodeficient rhesus macaques that were experimentally infected. The experiment was carried out by serial population passaging of a known SIVsm strain (SIVsmB670), accentuating the selection for adapted mutants in vivo (10), to elucidate the changes in the env gene that influence the marked
increases in pathogenicity and virulence of SIVsm infection in the
rhesus macaque model. Phylogenetic inference methods have been used to study the origins of HIV (33a, 34, 36) and the epidemiology of HIV infections (17) and to determine definitive
transmission patterns (27). The use of phylogeny
reconstruction methods with a known infection history has allowed the
study of the evolutionary pattern of SIVsm env adaptation
during serial passaging. We used likelihood mapping (49) to
display the amount of tree-like information contained in the SIVsm
env sequence set and to infer the phylogeny. The various
modes of nucleic acid evolution have led to the development of programs
that infer tree-like relationships (18, 51), net-like geometries (4), and start formations (49). The
likelihood mapping shows the phylogenetic content in a graphic form,
demonstrating whether the data are suitable for phylogenetic
reconstruction.
Likelihood mapping determines the best arrangement of the smallest
information-containing subset of a tree, the quartet (four taxa
[49]). Plotting all of the possible quartets as tree-, net-, or star-like relationships of the seven possible forms of a
quartet of sequences (16, 49) allows efficient visualization of the estimated phylogenetic content. Our application of this method
to the SIVsm passage alignment showed it to be highly informative compared to HIV alignments, and the reconstruction of the phylogeny was
tree-like. Construction of trees by quartet puzzling (QP) (48-50) produced a phylogeny that showed the adaptive
process to be highly structured, since the divergence increases with
passaging. The ordered divergence from the primary inoculum occurred in
the same time, at the same rate, as the shortening of the asymptomatic period or the increase in pathogenicity of the passaged SIVsm strain.
The adaptation of SIVsm to Asian rhesus macaques is thus a structured,
quickly occurring process in which the env gene evolves in a
tree-like manner.
 |
MATERIALS AND METHODS |
Virus.
Delta B670 (2, 5-7, 32, 35, 55) is an SIV
strain that was originally discovered in a sooty mangabey presenting
with a cutaneous lepromatous lesion. When tissue from this animal was used to inoculate rhesus macaques, it resulted in a syndrome that closely reproduced the effects of AIDS in humans (55). The
virus isolate was proven to be type D negative and was extensively
characterized (2, 5, 55).
Passage.
The passaging was carried out with seven
age-matched Asian rhesus macaques, all 2 years old. Their experimental
infection with an SIVsm strain was performed in six consecutive steps.
The first monkey was infected intravenously with 5 × 102 infectious doses of SIV Delta B670. The next five
monkeys were intravenously inoculated in a serial fashion with 2 × 106 peripheral blood mononuclear cells (PBMC) taken at
the symptomatic stage of disease from the preceding rhesus macaque. For
passage 5, PBMC of the passage 5 monkey (P5) were used to infect two
monkeys (P6A and P6B) because little blood was available from monkey P5 due to its rapid progression to AIDS and sudden death. The time to
death postinfection (tdpi) and moment of sampling for the reverse transcriptase PCR (RT-PCR) were as follows: P1, tdpi = 18 months, RT-PCR at 18 months; P2, tdpi = 12 months, RT-PCR at 3 and 7 months; P3, tdpi = 9 months, RT-PCR at 2 and 4.1 months; P4,
tdpi = 4 months, RT-PCR at 1 and 1.8 months; P5, tdpi = 2 months, RT-PCR not done since no sample was available; P6A, tdpi = 2 months, RT-PCR at 2 months; P6B, tdpi = 2 months, RT-PCR at 2 months. The animals were euthanized upon evidence of undue discomfort. PBMC used for serial passage were not cultured or cocultivated with any
other cells.
Viral RNA was harvested with silica in the presence of a chaotropic
agent (8) from the serum of the infected macaques for use as
a template in the RT-PCR. Viral RNA was isolated from 20 µl of sera
and resuspended in 20 µl of RNasin in H2O (1 U/µl) and used in a reverse transcription reaction (5 µl of viral
RNA, 250 µM each deoxynucleoside triphosphate, 2 ng of 3' RT-PCR
primer [SIV4Not1: TTATATGCGGCCGCCTACTTTGTGCCACGTGTTG]
per µl, 2.5 mM Mg2+, 1 U of RNasin [Promega] per
µl, 10 U of Super Script I [Gibco-BRL], and 1× reaction buffer
[45] in a 20-µl volume). The components were
assembled at 37°C and incubated at that temperature for 90 min. The
PCR mixture consisted of 250 µM each deoxynucleoside triphosphate, 2 ng of 3' and 5' (SIV1HIII: GTAGACAAGCTTGGGATAATACAGTCACAGAAC) PCR primers per µl, 1× reaction buffer, 2.25 mM
Mg2+, and 1.5 U of Taq polymerase (Perkin-Elmer
Cetus) in a final volume of 100 µl including 5 µl of the reverse
transcription reaction mixture. The PCR mixture was overlaid with
paraffin, heated to 95°C for 5 min, and subjected to 35 cycles of 1 min at 95°C, 1 min at 55°C, and 1 min at 72°C, ending with 10 min
at 72°C in a Perkin-Elmer Cetus DNA thermocycler. The reverse
transcription reaction and PCR were done in duplicate for each sample
to prevent mispriming and to ensure the fidelity of the virus genotypes
sampled. After PCR, the samples were combined and size selected on
0.8% agarose gels. The 1,151-bp band was excised and isolated from the
gel slice, digested with NotI and HindIII,
and again isolated from the agarose gel by silica particle
(8) fragment isolation. Size-selected, digested, purified
RT-PCR product was ligated overnight into plasmid pSP64 (Promega)
containing a NotI site. Ligated products were electroporated
into electrocompetent Escherichia coli C600, and
double-stranded plasmid DNA for sequencing was isolated on Qiagen
columns. Five clones per sampled time point were sequenced, except for
the primary inoculum (P1), for which 10 clones were sequenced. The
clones were named by the passage number (P), and by the infection
point, i.e., seroconversion (S) and death (D).
Sequencing and analysis.
The double-stranded plasmid DNA was
sequenced by using custom-labelled dye primers (Applied Biosystems
Inc.) with an automated sequencer (model 373A; Applied Biosystems) and
version 1.2.0 software. Clones were assembled and aligned with the
Sequence Navigator program (Applied Biosystems) or Clustal V
(18) and further optimized manually. Phylogenetic analysis
was conducted with MEGA (26), Clustal V (18),
PAUP 3.1.1 (52), and PUZZLE 3.0 (49).
Neighbor-joining, maximum-likelihood (ML), and puzzle-based trees were
produced by using the Tamura-Nei distance estimation with pairwise
comparison and then bootstrapped with 1,000 replications before tree
construction with and without preselected outgroups (P1 sequences). The
ML mapping and QP were carried out by using the Tamura-Nei distance estimation (49). Briefly, likelihood mapping is the
construction of all quartets of sequences possible (e.g., A, B, C, and
D, and then A, B, C, and E, etc., until all of the possible quartets of
sequences in the analysis have been compared) and calculation of the
relative weights of the probabilities for all three resolved tree
structures (1: A is like B but not C or D; 2: A is like C but not like
B or D; and 3: A is like D but not like B or C) (48-50) and
four unresolved structures (partially resolved 1: A is like B or C but
not D; partially resolved 2: A is like B or D but not C; partially
resolved 3: A is like C or D but not B; and unresolved: A is not like
B, C, or D). Thus, for the first four sequences analyzed by likelihood
mapping, the seven possible locations of the probability vectors
(49) include three with a completely resolved placement of
the four taxa, three with one taxon split between attraction to two
others and not like the fourth taxon (partially resolved), and one of
star-like form or no favored relation between the four taxa
(unresolved). These seven relations can be plotted in a triangle to
show the phylogenetic signal (see Fig. 3, 5, and 7). The corners
represent areas of completely resolved (tree-like) quartets (A
is most like one of B, C or D, resolved 1, 2, and 3); the sides
represent quartets with a split between equal attraction of one taxon
for two other taxa (A is like B and C, B and D, or C and D, partially
resolved); and the center of the triangle represents an area of equal
likelihood or distance between the four taxa (A is not like B,
C, or D, unresolved, giving a star-like formation). If each possible
quartet vector (resolved, partially resolved, and unresolved quartet
comparison) is plotted as a point in the triangle, it gives a rapid
visualization of the phylogenetic content of the alignment data
(robustness of the tree, or lack thereof). Tree construction
was carried out with the ML-based PUZZLE 3.0 (48). The ML
analysis is used for determination of a tree and its corresponding
branch lengths that have the greatest likelihood of reconstructing the
correct phylogeny. The numbers of possible topologies increases
exponentially as the number of taxa increases, making heuristic
searches very slow. Reconstructing a tree from all of the possible sets
of four taxa, or quartets, allows the heuristic search to proceed
efficiently in an ML procedure (50). QP reconstructs the ML
tree for all possible quartets. The total set of quartet trees is
subsequently combined to form a complete tree in the QP step. This
procedure was carried out 1,000 times. The QP tree is a majority-rule
consensus (30) of the set number of puzzling steps. There
are three main steps to the QP method; ML determination of all possible
quartet trees, combining all of the quartet trees 1,000 times to form a
complete tree (puzzling step), and the final majority-rule consensus computation of all intermediate trees (49). The HIV
sequences from 44 progressors and nonprogressors at seroconversion and
after 5 years of infection (29) are available upon request.
 |
RESULTS |
Construction of molecular phylogenetic trees.
Our study
included seven Asian rhesus macaques whose serial infection involved a
well-characterized viral isolate (SIVsm B670) (2, 5, 6, 35),
and known times of infection, seroconversion, and direction of
transmission. It thus relates a serial population passage and known
phylogeny of an SIV. The use of phylogenetic analysis on the
quasispecies sequences allows evaluation of the inference methods and
insight into the pattern of viral evolution. The inference of the
correct molecular phylogeny has important implications for our
understanding of transmission patterns and quasispecies evolution. We
used four different tree-building methods: neighbor-joining, ML,
maximum parsimony (MP), and QP. The results of the four methods were
similar only if the number of taxa used in the analysis was reduced.
The neighbor-joining, ML, and MP methods accommodated all 50 clones and
maintained a recognizable portrayal of the known phylogeny (Fig.
2), albeit with discrepant branch
placement. Inordinate amounts of time were needed with MP for branch
swapping to prevent the irreversible misplacement of branches early on
in the stepwise addition. The QP reconstruction produced the most true
phylogeny, with knowledge of the relation of the viruses present at the
time points sampled during the serial passage. The more closely related
sequences (less heterogeneity between the sampled time points; e.g.,
the genetic distance between P1 to P2S is more than from P3D to P4S)
after the third passage present a resolution problem for all of the
known methods. The P3S, P3D, and P4D sequences clustered consistently.
The discrepancy was the branching order of the P6A and P6B sequences,
which were closer to the founder P1 and P2 sequences than to their
precursor P3 and P4 sequences. This problem was not resolved by the use of other distance estimation methods or increased bootstrap
resamplings.

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 2.
SIVsmB670 passage full-length clone NJ tree constructed
with ClustalV, allowing for positions with gaps. The numbers on the
major branches are the bootstrap values (percentages) after 500 resamplings. The tree is rooted with the P1-1 clone. The tree had
similar topology to trees generated by MP. The scale bar is in the
bottom left-hand corner.
|
|
The problem with tree construction with a large number of taxa is the
inability to calculate all of the possible tree combinations. It is
further complicated by the long-standing problems in phylogenetic inference. The evolutionary history of retroviruses is difficult to
reconstruct because of recombination between similar but unlike RNA
strands, selection of progeny during rapid turnover of viral genomes,
differences in the rates of mutation among strains, unbalanced nucleotide frequencies, and differences in the individual substitution rates of the already skewed nucleotide concentrations. The use of
quartet analysis, with its focus on the smallest informative subtree
(27, 48-50), has been applied to an inference method that
takes advantage of the determination of all possible quartets, or
heuristic search, which is unavailable to the other methods, too
time-consuming, or available only as a statistical test of best fit
(27). PUZZLE 3.0 (48-50) incorporates a
first-step plot of all the possible four taxon quartets as a means of
weighting the best placement of them all within a phylogeny. With seven possible organizations for each quartet, calculation of all
possibilities is feasible. The ML of the grouping of a quartet can also
be plotted graphically to give an idea of the "tree likeness" of
the data known as likelihood mapping (49) (see Fig. 3, 5,
and 7). The four taxa are compared by grouping three and comparing the
fourth with them by placing it in one of the seven possible ML areas as
a dot: with taxon D most like taxon A, B, or C (the three corners: tree-like), split between A and B, A and C, or B and C (the three sides: unresolved between the two), and, lastly, unlike A, B, or C and
placed in the middle as a neutral attractor (star-like formation). The
centers of the ML triangles are inhabited by star-like phylogenies
lacking tree-like content, i.e., having no attraction to cluster with
the other taxa (Fig. 3 and
4). The percentages of the contents of
the complete set of quartets (
300,000 for 50 taxa) are displayed in
the numbered triangles. Each of the seven areas has a finite number of
the ML dots, with the total of the seven being 100%.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 3.
HIV-1B likelihood-mapping analysis for the 44 HIV-1
infected progressors and nonprogressors (29). The top
triangle shows the distribution pattern of the quartet analysis, and
the bottom triangles show the distribution of the data in the seven
basins of attraction or quartet possibilities. As shown, the majority
of the data clusters in the center of the triangle, where unresolved or
star-like trees with little phylogenetic content are found. The three
corners of the triangles, where completely resolved trees are found,
are virtually devoid of content.
|
|

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 4.
HIV-1B phylogenetic inference for the 88 sequences from
the 44 HIV-1-infected progressors and nonprogressors, 5 years apart,
(29) by ML determination (PUZZLE 3.0) with the Tamura-Nei
distance approximation and 1,000 tree-puzzling steps. The QP
percentages of the important branches are in bold numbers. The scale
bar is shown in the bottom left-hand corner. The topology of the HIV-1B
tree is star-like as predicted by likelihood mapping and shows little
relation between the sequences, except for the pairs of sequences from
individual patients, which group together.
|
|
The utility of likelihood mapping is shown by analysis of an extensive
set of HIV-1B sequences (Fig. 3) (29) from 44 infected progressors and nonprogressors sampled at seroconversion and 5 years
thereafter. The three corners contain 74% of the quartets, and fully
26% of the quartets are unresolved, with points in the center of the
triangle (16.3%) being neutral attractors or star forms. The phylogeny
of this alignment (Fig. 4) shows intrapatient sequence clustering and
no definition of evolution of the HIV-1 B env gene over
time. Evolution of HIV-1 during infection is not as structured as the
cross-species passage because several, or many, infections have already
taken place between the progenitor virus (presumably a relation of SIV
from chimpanzees) and the modern HIV-1. The lack of sequences from the
"original" founder of HIV-1 leaves a gap in the phylogeny. Without
the founder and early infection sequences, the variation is seen to be
nonstructured, since there is no directed evolution or divergence over
time.
Figure 5 shows the tree likeness of all
50 taxa of the SIVsm passage. The sequence alignment contains a very
high 96.5% of the phylogeny in the three corners, or "in" the
tree. There are 241 variable and 135 parsimonious sites of 1,119 nucleotides in this alignment. The split-between-partners quartets or
sides of the triangle include 3.1% that cluster between two other taxa and only 0.4% that are unresolved ("out" of the tree) in the
"star" area where HIV-1 phylogenies exist (Fig. 4).

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 5.
Likelihood-mapping analysis for the SIVsmB670 passage
complete clone alignment. The top triangle shows the distribution
pattern of the quartet analysis, and the bottom triangles show the
distribution of the data in the seven basins of attraction or quartet
possibilities. As shown, the majority of the data clusters in the three
corners, where completely resolved robust trees with large amounts of
phylogenetic content are found. The three corners of the triangles,
where completely resolved trees cluster, have almost the entire
content.
|
|
The phylogeny derived from generation of all possible quartets, QP
(Fig. 6), tells the complete story of the
serial passage in graphic form. As the infection history is known, the
tree is rooted in the P1-1 clone as the founder sequence. The
heterogeneity of the P1 sequences is evidenced by the long branches
that contain only pairs of taxa. The initial adaptative effect is seen
in the large differences in the lengths of the P1 branches, varying
from P1-6 to P1-8 and P1-9 (which are the same distance from P1-1). P2S
and P2D are not completely separate, with two clusters forming, but
four of the five P2-D taxa are distinctly divergent from the P2-S
cluster, and P2D-2 is a likely founder for the next passage, although
P2S-4 is actually closer to the P3 to P6 sequences. The branch lengths
and the clustering numbers place the P2 taxa between the P1 and the P3
to P6 taxa. This pattern follows the changes in pathogenicity during
passage and holds for the P1 to P2 clustering as well. The P3 to P6
taxa are placed on the same branch, with a clustering value of 64, since the P3 and P4 taxa do not carry much information that could
cluster them separately as distinct clades. The differences in branch
lengths are indistinct because of minimal sequence variation between
the P3 and P6 clones. There is an almost quantum-like effect, with the
branch lengths of the P3S-1 and seven other taxa all being equal. The
P4D-4 and six other clones also have equal branch lengths, seemingly
twice as long as those of the P3S-1 length. The tree continues to grow outward from the root, with the P6 sequences having longer branch length than those of the P3 and P4 sequences. The P6B sequences form a
distinct branch, except for the P6B-4 clone, which has seven amino acid
substitutions not found in the other P6B sequences.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 6.
SIVsmB670 passage complete clone phylogenetic inference
for the passage alignment. The tree was constructed by ML determination
(PUZZLE 3.0) with the Tamura-Nei distance approximation and 1,000 tree-puzzling steps. The QP percentages of the important branches are
shown by boldface numbers. The scale bar is in the lower left-hand
corner. The tree shows the pattern of evolution during adaptation of
SIVsm to a new species of nonhuman primate and the effect of the serial
passages upon env during the increases of pathogenicity.
|
|
ML mapping was used to display the amount of tree-like information held
by a separation of the sequences (P1 and P2 as one cluster and the P3
to P6A and P6B sequences as another). The robustness of the branching
separation of the two clusters (Fig. 7)
is seen as the absence of any shared quartets which would appear in the center of the triangles. The mapping shows the correlation of the
branching order and distinctly altered pathogenicities of these
quasispecies. The taxa were set in two distinct clusters, with 97.6%
of the phylogenetic information confirming the separation of these
subsets of the passage clones as evolutionarily distinct.

View larger version (14K):
[in this window]
[in a new window]
|
FIG. 7.
SIVsmB670 passage complete clone two-cluster
likelihood-mapping analysis. The sequences were split into two disjoint
groups: a (P1 to P2) and b (P3 to P6). The corners of the triangles are
labelled with the corresponding tree topologies. The top triangle shows
the distribution pattern of the quartet analysis, and the bottom
triangles show the distribution of the data in the seven basins of
attraction or quartet possibilities. The likelihood-mapping analysis
can also be applied to the testing of an internal edge of a tree. The
clusters chosen separate the early, less pathogenic env
clones of the virus from the later, more pathogenic env
clones.
|
|
We divided variable and constant regions into two separate phylogenies
to assess the pattern of evolution of these two functional types of
env domains during adaptation and increase in pathogenicity (Fig. 8 and
9). The variable-region phylogeny shows
the large heterogeneity within the P1 sequences that was observed
above. With 65% of the variable sites being found within the variable regions, the P1 sequences are split into three separate branches. Cluster definition decreases after seroconversion of passage 3 (P3S
clones), except for the P6B sequences. The heterogeneity appears to be
very large, but, as the distance bar shows, the distances are far
greater than those encountered in the constant regions. Misclustering
was found due to the enormous variation, and not the similarity, of the
sequences. In the variable regions, the average diversity was limited
after the P3D sequences.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 8.
Phylogenetic inference for the variable regions of the
SIVsmB670 passage alignment. The tree was constructed by ML
determination (PUZZLE 3.0) with the Tamura-Nei distance approximation
and 1,000 tree-puzzling steps. The QP percentages of the important
branches are shown by boldface numbers. The scale bar is in the lower
left-hand corner. The pattern of evolution of the variable regions is
less structured than that of the constant regions (Fig. 9). The P1 to
P6 sequences cluster together on one branch, except for the root (P1-1)
and four P1 clones (P1-2, P1-3, P1-6, and P1-10).
|
|

View larger version (15K):
[in this window]
[in a new window]
|
FIG. 9.
Phylogenetic inference for the constant regions of the
SIVsmB670 passage alignment. The tree was constructed by ML
determination (PUZZLE 3.0) with the Tamura-Nei distance approximation
and 1,000 tree-puzzling steps. The QP percentages of the important
branches are in bold numbers. The scale bar is in the lower left-hand
corner.
|
|
The constant-region tree structure places the different passages in
order (Fig. 9). The P1 heterogeneity is still large, but not large
enough to reduce the cluster definition of the whole tree, as in the
variable regions. The P3S sequences are the most clustered and mark the
greatest increase in pathogenicity, with viral diversity increasing as
the passage progresses toward the P6 sequences.
 |
DISCUSSION |
Serial passage of SIVsmB670 from sooty mangabeys in rhesus
macaques has drastically shortened the time of disease progression from
1.5 years to 1 month during adaptation of the retrovirus to the Asian
rhesus macaque hosts. The increase in pathogenicity has been correlated
with higher antigen levels in plasma, persistent plasma antigenemia,
and a more rapid loss of T-helper/memory cells (53a). The
more rapid disease progression of the P6 inoculum produces clinical
symptoms similar to those due to the slower progressing P1 inoculum.
The SIVsm-related strain PBJ14 (Fig. 1) is pathogenic within 2 weeks in
pig-tailed, cynomolgus, and some rhesus macaques (43) but
does not produce the immunodeficiency seen in HIV-1 infections. It
caused massive T-cell proliferation, increased cytokine release, and
mucoid diarrhea, and its env glycoprotein has some
superantigen-like properties (44). The P6 inoculum reproduced the relevant immunodeficiency symptoms to model AIDS in
humans, except for lack of seroconversion.
The present study was used to analyze the genetic adaptation of the
SIVsm env gene during serial population passage in rhesus macaques. The clones sequenced were all unique, with decreased heterogeneity or viral diversity in the P6 sequences compared to those
of P1. The heterogeneity or divergence seen may not be representative
of genotypes present in tissue, but, for the purpose of identifying the
evolutionary path during the adaptation of the env gene
between the P1 and P6 sequences, this single compartment sampling
suffices. The major areas of variability were observed in the V1 and
V4, as is the norm in SIV infections (10, 19, 39), but
mutations were seen also within the V2 and V3 regions and the C3 region
just C-terminal to the V3 loop.
Phylogenetic inference methods were used to analyze the evolution of
the env gene of SIVsm during adaptation in rhesus macaques. The QP method was used to allow the rendering of phylogenetic content
of the data set and for the two-cluster mapping of the variable versus
the constant domains of the env. Four-taxon trees may, in
some purposely selected cases, be difficult to resolve (18a), but a one-tree example is not a defining study
(54). Sequence length is always a crucial factor in tree
building, but the simultaneous analysis of many lineages tends to
improve phylogenetic estimation considerably (18b). Quartets
can be hard, but extra information helps. If all that is available
consists of data on species A, B, C, and D, it might be relatively
difficult to find the correct tree for them. However, if additional
data are available (species E, F, G, ...) and an attempt is made to
find a tree for all the species, that part of the tree relating A, B,
C, and D will be expected to be more accurate than if just the data for A, B, C, and D were available. There are many examples of subsets of
four species which in themselves might be hard to resolve correctly but
which are correctly resolved thanks to additional data (e.g., inordinately long sequences or many lineages). PUZZLE 3.0 gains advantage from extra data in the same way. Its "understanding" or
resolution of the quartet A, B, C, and D may be incorrect, but the
information on the relationships of A, B, C, and D implicit in its
treatment of A, B, C, and E, of A, B, D, and E, of A, C, D, and E, of
B, C, D, and E, of A, B, C, and F, of A, B, D, and F, of A, C, D, and
F, of B, C, D, and F, of A, B, C, and G, etc., should overcome this
problem (17a). Using this quartet-based heuristic search
algorithm (50) for the best tree fit and 50 sequences of
1,119 bp each, we found that the sampled sequences diverged from that
of the primary inoculum in a time-dependent fashion, following the path
of the serial passage. The topology of the tree placed the
env sequences in clusters roughly according to the
pathogenicity of the virus and the history of the passage infections.
The relationship between infection history, pathogenicity, and the
hierarchy of the inferred trees indicates that env plays a
role in the progression to AIDS during SIV infection. The sequence divergence and its correlation with enhanced virulence suggest that our
recorded amino acid substitutions are important to the shortening of
the asymptomatic period of progression to AIDS in the Asian rhesus
macaques.
Viral diversity decreased during passaging (Fig. 6, 8, and 9)
(53), in particular in the constant regions, following the initial adaptation to the new host. The phenomenon of viral diversity is pivotal to the production of vaccines. We have shown here that this
diversity is related to the level of adaptation of the virus to its new
environment and that, after several infections, an equilibrium is
reached in amino acid substitution (unpublished data),
Ks/Ka ratio (53), and
branch length variation at which the virus is optimally tailored to the
surrounding conditions. Variation in the amino acids of the
env product was greatest in the V1 and V4 regions followed
by V2 and V3. The difference in receptor sequence between the CD4 of
sooty mangabeys and Asian rhesus macaques is not known, nor is the
difference in relatedness of the accessory receptors for this virus in
these two hosts (1, 13, 15). The adaptive process may hinge
on the viral need for the most efficient env conformation to
bind the CD4 T cells and begin the infective process. Increased
pathogenicity would imply increased viral adaptation and increased
ability to bind and enter the target cells of the new host. The most
variable, or most adaptable, regions were V1 and the V4. The precise
role of V1 (in HIV or SIV infections) is not yet known. V3 and C4 are known to play a role in the binding of CD4 (23); although
not binding directly, they play a conformational role. Because V3 and
C4 span V4, V4 (along with other regions in the env gene) may encode amino acids that are part of the CD4 binding domain. If the
binding of the CD4 and accessory receptor are relevant to the
development of lentivirus pathogenicity, it would follow that the
fastest-adapting areas of the env gene would be those needed to contact the CD4 and accessory receptor for SIVsm
(CCKR-5 is the known accessory receptor for HIV-1 and SIV
(15). If so, V1 and V4 are in conformational contact and are
the major env structures involved in binding and entry.
The relative clustering of the env sequences by virulence
and by sequence divergence shows the impact of genetic variation of
env upon pathogenicity. The difficulty of nonrobust
phylogenetic separation of the P3 to P6 sequences shows that
env evolution is not a simple linear process. Apparently,
convergence can occur during multiple serial infections after
adaptation has occurred in relation to the env gene of
SIVsm. The decreasing heterogeneity seen in the P3 to P6 taxa may
reflect the reduced adaptation and convergence or sequence stability of
the new consensus around which these sequences evolve in a decreasing
area or may indicate that selection has effectively removed
unsuccessful variants.
 |
ACKNOWLEDGMENTS |
We thank Korbinian Strimmer and Arndt von Haeseler
(Universität München) for providing a prerelease version of
PUZZLE 3.0 and helpful advice, Carla Kuiken (Los Alamos) and David
Mindell (University of Michigan) for critical reading and revision of the manuscript, Nick Goldman (University of Cambridge) and David Hillis
(University of Texas) for explaining the basics of quartet resolution,
and Lucy Phillips for editorial wisdom. An anonymous reviewer was
exceedingly helpful in coaxing the manuscript into a more informative
and readable form. Thank you.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Human Retrovirology, Academic Medical Centre, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, The Netherlands. Phone: (31-20) 566-4853. Fax: (31-20) 691-6531. E-mail:
p.j.valli{at}amc.uva.nl.
 |
REFERENCES |
| 1.
|
Alkhatib, G.,
C. Combadiere,
C. C. Broder,
Y. Feng,
P. E. Kennedy,
P. M. Murphy, and E. A. Berger.
1996.
CC-CKR-5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1.
Science
272:1955-1958[Abstract].
|
| 2.
|
Amedee, A. M.,
N. Lacour,
J. L. Gierman,
L. N. Martin,
J. E. Clements,
R. Bohm, Jr.,
R. M. Harrison, and M. Murphey-Corb.
1995.
Genotypic selection of simian immunodeficiency virus in macaque infants infected transplacentally.
J. Virol.
69:7982-7990[Abstract].
|
| 3.
|
Back, N. K.,
L. Smit,
M. Schutten,
P. L. Nara,
M. Tersmette, and J. Goudsmit.
1993.
Mutations in human immunodeficiency virus type 1 gp41 affect sensitivity to neutralization by gp120 antibodies.
J. Virol.
67:6897-6902[Abstract/Free Full Text].
|
| 4.
|
Bandelt, H. J., and A. W. Dress.
1992.
Split decomposition: a new and useful approach to phylogenetic analysis of distance data.
Mol. Phylogenet. Evol.
1:242-252[Medline].
|
| 5.
|
Baskin, G. B.,
L. N. Martin,
M. Murphey-Corb,
F. S. Hu,
D. Kuebler, and B. Davison.
1995.
Distribution of SIV in lymph nodes of serially sacrificed rhesus monkeys.
AIDS Res. Hum. Retroviruses
11:273-285[Medline].
|
| 6.
|
Baskin, G. B.,
L. N. Martin,
S. R. Rangan,
B. J. Gormus,
M. Murphey-Corb,
R. H. Wolf, and K. F. Soike.
1986.
Transmissible lymphoma and simian acquired immunodeficiency syndrome in rhesus monkeys.
JNCI
77:127-139.
|
| 7.
|
Bohm, R. P., Jr.,
L. N. Martin,
B. Davison-Fairburn,
G. B. Baskin, and M. Murphey-Corb.
1993.
Neonatal disease induced by SIV infection of the rhesus monkey (Macaca mulatta).
AIDS Res. Hum. Retroviruses
9:1131-1137[Medline].
|
| 8.
|
Boom, R.,
C. J. Sol,
M. M. Salimans,
C. L. Jansen,
P. M. Wertheim-van Dillen, and J. van der Noordaa.
1990.
Rapid and simple method for purification of nucleic acids.
J. Clin. Microbiol.
28:495-503[Abstract/Free Full Text].
|
| 9.
|
Bou-Habib, D. C.,
G. Roderiquez,
T. Oravecz,
P. W. Berman,
P. Lusso, and M. A. Norcross.
1994.
Cryptic nature of envelope V3 region epitopes protects primary monocytotropic human immunodeficiency virus type 1 from antibody neutralization.
J. Virol.
68:6006-6013[Abstract/Free Full Text].
|
| 10.
|
Burns, D. P.,
C. Collignon, and R. C. Desrosiers.
1993.
Simian immunodeficiency virus mutants resistant to serum neutralization arise during persistent infection of rhesus monkeys.
J. Virol.
67:4104-4113[Abstract/Free Full Text].
|
| 11.
|
Chakrabarti, L.,
V. Baptiste,
E. Khatissian,
M. C. Cumont,
A. M. Aubertin,
L. Montagnier, and B. Hurtrel.
1995.
Limited viral spread and rapid immune response in lymph nodes of macaques inoculated with attenuated simian immunodeficiency virus.
Virology
213:535-548[Medline].
|
| 12.
|
Chesebro, B.,
K. Wehrly,
J. Nishio, and S. Perryman.
1992.
Macrophage-tropic human immunodeficiency virus isolates from different patients exhibit unusual V3 envelope sequence homogeneity in comparison with T-cell-tropic isolates: definition of critical amino acids involved in cell tropism.
J. Virol.
66:6547-6554[Abstract/Free Full Text].
|
| 13.
|
Cocchi, F.,
A. L. DeVico,
A. Garzino-Demo,
S. K. Arya,
R. C. Gallo, and P. Lusso.
1995.
Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells.
Science
270:1811-1815[Abstract/Free Full Text].
|
| 14.
|
Courgnaud, V.,
F. Laure,
P. N. Fultz,
L. Montagnier,
C. Brechot, and P. Sonigo.
1992.
Genetic differences accounting for evolution and pathogenicity of simian immunodeficiency virus from a sooty mangabey monkey after cross-species transmission to a pig-tailed macaque.
J. Virol.
66:414-419[Abstract/Free Full Text].
|
| 15.
|
Dragic, T.,
V. Litwin,
G. P. Allaway,
S. R. Martin,
Y. Huang,
K. A. Nagashima,
C. Cayanan,
P. J. Maddon,
R. A. Koup,
J. P. Moore, and W. A. Paxton.
1996.
HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5.
Nature
381:667-673[Medline].
|
| 16.
|
Eigen, M.,
R. Winkler-Oswatitsch, and A. Dress.
1988.
Statistical geometry in sequence space: a method of quantitative comparative sequence analysis.
Proc. Natl. Acad. Sci. USA
85:5913-5917[Abstract/Free Full Text].
|
| 17.
|
Franchini, G., and M. S. Reitz, Jr.
1994.
Phylogenesis and genetic complexity of the nonhuman primate retroviridae.
AIDS Res. Hum. Retroviruses
10:1047-1060[Medline].
|
| 17a.
| Goldman, N. Personal communication.
|
| 18.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[Medline].
|
| 18a.
|
Hillis, D. M.
1996.
Inferring complex phylogenies.
Nature
383:130-131[Medline].
|
| 18b.
| Hillis, D. M. Personal communication.
|
| 19.
|
Hirsch, V. M.,
G. Dapolito,
P. R. Johnson,
W. R. Elkins,
W. T. London,
R. J. Montali,
S. Goldstein, and C. Brown.
1995.
Induction of AIDS by simian immunodeficiency virus from an African green monkey: species-specific variation in pathogenicity correlates with the extent of in vivo replication.
J. Virol.
69:955-967[Abstract].
|
| 20.
|
Hirsch, V. M., and P. R. Johnson.
1994.
Pathogenic diversity of simian immunodeficiency viruses.
Virus Res.
32:183-203[Medline].
|
| 21.
|
Hirsch, V. M.,
J. E. Martin,
G. Dapolito,
W. R. Elkins,
W. T. London,
S. Goldstein, and P. R. Johnson.
1994.
Spontaneous substitutions in the vicinity of the V3 analog affect cell tropism and pathogenicity of simian immunodeficiency virus.
J. Virol.
68:2649-2661[Abstract/Free Full Text].
|
| 22.
|
Hirsch, V. M.,
R. A. Olmsted,
M. Murphey-Corb,
R. H. Purcell, and P. R. Johnson.
1989.
An African primate lentivirus (SIVsm) closely related to HIV-2.
Nature
339:389-392[Medline].
|
| 23.
|
Kirchhoff, F.,
H. G. Morrison, and R. C. Desrosiers.
1995.
Identification of V3 mutations that can compensate for inactivating mutations in C4 of simian immunodeficiency virus.
Virology
213:179-189[Medline].
|
| 24.
|
Kirchoff, F.,
K. Mori, and R. C. Desrosiers.
1994.
The "V3" domain is a determinant of simian immunodeficiency virus cell tropism.
J. Virol.
68:3682-3692[Abstract/Free Full Text].
|
| 25.
|
Kodama, T.,
K. Mori,
T. Kawahara,
D. J. Ringler, and R. C. Desrosiers.
1993.
Analysis of simian immunodeficiency virus sequence variation in tissues of rhesus macaques with simian AIDS.
J. Virol.
67:6522-6534[Abstract/Free Full Text].
|
| 26.
|
Kumar, S.,
K. Tamura, and M. Nei.
1994.
MEGA: Molecular Evolutionary Genetics Analysis software for microcomputers.
Comput. Applic. Biosci.
10:189-191.
[Abstract/Free Full Text] |
| 27.
|
Leitner, T.,
D. Escanilla,
C. Franzev,
U. Mathias, and J. Albert.
1996.
Accurate reconstruction of a known HIV-1 transmission history by phylogenetic tree analysis.
Proc. Natl. Acad. Sci. USA
93:10864-10869[Abstract/Free Full Text].
|
| 28.
|
Luciw, P. A.,
K. E. Shaw,
R. E. Unger,
V. Planelles,
M. W. Stout,
J. E. Lackner,
E. Pratt-Lowe,
N. J. Leung,
B. Banapour, and M. L. Marthas.
1992.
Genetic and biological comparisons of pathogenic and nonpathogenic molecular clones of simian immunodeficiency virus (SIVmac).
AIDS Res. Hum. Retroviruses
8:395-402[Medline].
|
| 29.
|
Lukashov, V. V.,
C. L. Kuiken, and J. Goudsmit.
1995.
Intrahost human immunodeficiency virus type 1 evolution is related to length of the immunocompetent period.
J. Virol.
69:6911-6916[Abstract].
|
| 30.
|
Margush, T., and F. R. McMorris.
1981.
Consensus n-trees.
Bull. Math. Biol.
43:239-244.
|
| 31.
|
Marthas, M. L.,
R. A. Ramos,
B. L. Lohman,
K. K. Van Rompay,
R. E. Unger,
C. J. Miller,
B. Banapour,
N. C. Pedersen, and P. A. Luciw.
1993.
Viral determinants of simian immunodeficiency virus (SIV) virulence in rhesus macaques assessed by using attenuated and pathogenic molecular clones of SIVmac.
J. Virol.
67:6047-6055[Abstract/Free Full Text].
|
| 32.
|
Miller, M. A.,
M. Murphey-Corb, and R. C. Montelaro.
1992.
Identification of broadly reactive continuous antigenic determinants of simian immunodeficiency virus glycoproteins.
AIDS Res. Hum. Retroviruses
8:1153-1164[Medline].
|
| 33.
|
Mindell, D. P.
1996.
Positive selection and rates of evolution in immunodeficiency viruses from humans and chimpanzees.
Proc. Natl. Acad. Sci. USA
93:3284-3288[Abstract/Free Full Text].
|
| 33a.
|
Mindell, D. P.,
J. W. Shultz, and P. W. Ewald.
1995.
The AIDS Pandemic is new, but is HIV new?
Syst. Biol.
44:77-92.
|
| 34.
|
Muller-Trutwin, M. C.,
S. Corbet,
M. D. Tavares,
V. M. A. Herve,
E. Nerrienet,
M. Georges-Courbot,
W. Saurin,
P. Sonigo, and F. Barre-Sinoussi.
1996.
The evolutionary rate of nonpathogenic simian immunodeficiency virus (SIVagm) is in agreement with a rapid and continuous replication in vivo.
Virology
223:89-102[Medline].
|
| 35.
|
Murphey-Corb, M.,
L. N. Martin,
S. R. Rangan,
G. B. Baskin,
B. J. Gormus,
R. H. Wolf,
W. A. Andes,
M. West, and R. C. Montelaro.
1986.
Isolation of an HTLV-III-related retrovirus from macaques with simian AIDS and its possible origin in asymptomatic mangabeys.
Nature
321:435-437[Medline].
|
| 36.
|
Myers, G.,
K. MacInnes, and B. Korber.
1992.
The emergence of simian/human immunodeficiency viruses.
AIDS Res. Hum. Retroviruses
8:373-386[Medline].
|
| 37.
|
Novembre, F. J.,
P. R. Johnson,
M. G. Lewis,
D. C. Anderson,
S. Klumpp,
H. M. McClure, and V. M. Hirsch.
1993.
Multiple viral determinants contribute to pathogenicity of the acutely lethal simian immunodeficiency virus SIVsmmPBj variant.
J. Virol.
67:2466-2474[Abstract/Free Full Text].
|
| 38.
|
Overbaugh, J., and L. M. Rudensey.
1992.
Alterations in potential sites for glycosylation predominate during evolution of the simian immunodeficiency virus envelope gene in macaques.
J. Virol.
66:5937-5948[Abstract/Free Full Text].
|
| 39.
|
Overbaugh, J.,
L. M. Rudensey,
M. D. Papenhausen,
R. E. Benveniste, and W. R. Morton.
1993.
Variation in simian immunodeficiency virus env is confined to V1 and V4 during progression to simian AIDS.
J. Virol.
65:7025-7031.
|
| 40.
|
Pathak, V. K., and H. Temin.
1990.
Broad spectrum of in vivo forward mutations, hypermutations and mutational hot spots in a retroviral vector after a single replication cycle: substitutions, frameshifts and hypermutations.
Proc. Natl. Acad. Sci. USA.
87:6019-6023[Abstract/Free Full Text].
|
| 41.
|
Reimann, K. A.,
K. Tenner-Racz,
P. Racz,
D. C. Montefiori,
Y. Yasutomi,
W. Lin,
B. J. Ransil, and N. L. Letvin.
1994.
Immunopathogenic events in acute infection of rhesus monkeys with simian immunodeficiency virus of macaques.
J. Virol.
68:2362-2370[Abstract/Free Full Text].
|
| 42.
|
Rudensey, L. M.,
J. T. Kimata,
R. E. Benveniste, and J. Overbaugh.
1995.
Progression to AIDS in macaques is associated with changes in the replication, tropism, and cytopathic properties of the simian immunodeficiency virus variant population.
Virology
207:528-542[Medline].
|
| 43.
|
Sakuragi, S.,
J. Sakuragi, and A. Adachi.
1995.
Both SU and TM env proteins are responsible for monkey cell tropism of simian immunodeficiency virus SIV mac.
Arch. Virol.
140:2255-2260[Medline].
|
| 44.
|
Schwiebert, R., and P. N. Fultz.
1994.
Immune activation and viral burden in acute disease induced by simian immunodeficiency virus SIVsmmPBj14: correlation between in vitro and in vivo events.
J. Virol.
68:5538-5547[Abstract/Free Full Text].
|
| 45.
|
Sellner, L. N.,
R. J. Coelen, and J. S. Mackenzie.
1994.
Sensitive detection of Ross River virus-a one-tube nested RT-PCR.
J. Virol. Methods
49:47-58[Medline].
|
| 46.
|
Sharma, D. P.,
M. C. Zink,
M. Anderson,
R. Adams,
J. E. Clements,
S. V. Joag, and O. Narayan.
1992.
Derivation of neurotropic simian immunodeficiency virus from exclusively lymphocyte tropic parental virus: pathogenesis of infection in macaques.
J. Virol.
66:3550-3556[Abstract/Free Full Text].
|
| 47.
|
Shpaer, E. G., and J. I. Mullins.
1993.
Rates of amino acid change in the envelope protein correlate with pathogenicity of primate lentiviruses.
J. Mol. Evol.
37:57-65[Medline].
|
| 48.
|
Strimmer, K.,
N. Goldman, and A. von Haeseler.
1997.
Bayesian probabilities and quartet puzzling.
Mol. Biol. Evol.
14:210-211.
|
| 49.
|
Strimmer, K., and A. von Haeseler.
1997.
Likelihood-mapping: a simple method to visualize phylogenetic content of a sequence alignment.
Proc. Natl. Acad. Sci. USA
94:6815-6819[Abstract/Free Full Text].
|
| 50.
|
Strimmer, K., and A. von Haeseler.
1996.
Quartet puzzling: a quartet maximum-likelihood method for reconstructing tree topologies.
J. Mol. Evol.
13:964-969.
|
| 51.
|
Swofford, D. L.
1991.
In
PAUP: phylogenetic analysis using parsimony, version 3.1.1.
Illinois Natural History Survey, Champaign.
|
| 52.
|
Tersmette, M.,
R. A. Gruters,
F. de Wolf,
R. E. Y. de Goede,
J. M. A. Lange,
P. T. A. Schellekens,
J. Goudsmit,
H. G. Huisman, and F. Miedema.
1989.
Evidence for a role of virulent human immunodeficiency (HIV) in the pathogenesis of acquired immunodeficiency syndrome: studies on sequential HIV isolates.
J. Virol.
63:2118-2125[Abstract/Free Full Text].
|
| 53.
| Valli, P. J. S., V. V. Lukashov, and J. Goudsmit. Shortening of the symptom-free period in rhesus macaques
related to decreasing non-synonymous variation in the env
variable regions of SIVsm during passage. Submitted for publication.
|
| 53a.
| Valli, P. J. S., J. L. Heeney, and J. Goudsmit.
Selection for macrophage tropism during serial passage of SIVsm in
rhesus macaques concomitant with increased virulence. Submitted for
publication.
|
| 54.
|
Wain-Hobson, S.
1996.
Running the gamut of retroviral variation.
Trends Microbiol.
4:135-141[Medline].
|
| 54a.
|
Yang, Z., and N. Goldman.
1997.
Are big trees indeed easy?
Trends Ecol. Evol.
12:357.
|
| 55.
|
Zhang, J. Y.,
L. N. Martin,
E. A. Watson,
R. C. Montelaro,
M. West,
L. Epstein, and M. Murphey-Corb.
1988.
Simian immunodeficiency virus/delta-induced immunodeficiency disease in rhesus monkeys: relation of antibody response and antigenemia.
J. Infect. Dis.
158:1277-1286[Medline].
|
J Virol, May 1998, p. 3673-3683, Vol. 72, No. 5
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Silvestri, G., Fedanov, A., Germon, S., Kozyr, N., Kaiser, W. J., Garber, D. A., McClure, H., Feinberg, M. B., Staprans, S. I.
(2005). Divergent Host Responses during Primary Simian Immunodeficiency Virus SIVsm Infection of Natural Sooty Mangabey and Nonnatural Rhesus Macaque Hosts. J. Virol.
79: 4043-4054
[Abstract]
[Full Text]
-
Tan, Z., Gibbs, A. J., Tomitaka, Y., Sanchez, F., Ponz, F., Ohshima, K.
(2005). Mutations in Turnip mosaic virus genomes that have adapted to Raphanus sativus. J. Gen. Virol.
86: 501-510
[Abstract]
[Full Text]
-
Liang, X.-Z., Lee, B. T. K., Wong, S.-M.
(2002). Covariation in the Capsid Protein of Hibiscus Chlorotic Ringspot Virus Induced by Serial Passaging in a Host That Restricts Movement Leads to Avirulence in Its Systemic Host. J. Virol.
76: 12320-12324
[Abstract]
[Full Text]