Institute of Molecular and Cell Biology,
National University of Singapore, Republic of
Singapore,1 and
Applied Tumor
Virology, German Cancer Research Center, 69009 Heidelberg,
Germany2
The gene functions, transcriptional regulation, and genome
replication of human papillomaviruses (HPVs) have been extensively studied. Thus far, however, there has been little research on the
organization of HPV genomes in the nuclei of infected cells. As a first
step to understand how chromatin and suprachromatin structures may
modulate the life cycles of these viruses, we have identified and
mapped interactions of HPV DNAs with the nuclear matrix. The endogenous
genomes of HPV type 16 (HPV-16) which are present in SiHa, HPKI, and
HPKII cells, adhere in vivo to the nuclear matrixes of these cell
lines. A tight association with the nuclear matrix in vivo may be
common to all genital HPV types, as the genomes of HPV-11, HPV-16,
HPV-18, and HPV-33 showed high affinity in vitro to preparations of the
nuclear matrix of C33A cells, as did the well-known nuclear matrix
attachment region (MAR) of the cellular beta interferon gene. Affinity
to the nuclear matrix is not evenly spread over the HPV-16 genome. Five
genomic segments have strong MAR properties, while the other parts of the genome have low or no affinity. Some of the five MARs correlate with known cis-responsive elements: a strong MAR lies in
the 5' segment of the long control region (LCR), and another one lies in the E6 gene, flanking the HPV enhancer, the replication origin, and
the E6 promoter. The strongest MAR coincides with the E5 gene and the
early-late intergenic region. Weak MAR activity is present in the E1
and E2 genes and in the 3' part of L2. The in vitro map of MAR activity
appears to reflect MAR properties in vivo, as we found for two selected
fragments with and without MAR activity. As is typical for many MARs,
the two segments with highest affinity, namely, the 5' LCR and the
early-late intergenic region, have an extraordinarily high A-T content
(up to 85%). It is likely that these MARs have specific functions in
the viral life cycle, as MARs predicted by nucleotide sequence
analysis, patterns of A-T content, transcription factor YY1 binding
sites, and likely topoisomerase II cleavage sites are conserved in
similar positions throughout all genital HPVs.
 |
INTRODUCTION |
The structure and expression
of human papillomavirus (HPV) genes have been extensively
researched, largely due to the great interest in the causal association
of these viruses with benign and malignant neoplasia (for overviews,
see references 27 and 28).
Although the replication mechanisms, cis-responsive
elements, and splicing of transcripts have been studied in great detail (for reviews, see references 4, 43, and
46), some important biological and medical phenomena
of the HPV life cycle remain to be elucidated. For example, it is still
poorly understood how HPV promoters are differentially regulated, how
transcripts are differentially spliced, or how HPV genomes achieve copy
number control. It may be possible that some of these phenomena are
modulated by the interaction of HPV genomes with histones and other
structural proteins of the nucleus. As only a few efforts have been
made to understand how HPV genomes are organized in the infected cell, we undertook this study of the interaction of HPV genomes with the
nuclear matrix.
In the eukaryotic nucleus, DNA and histone proteins interact to form
nucleosomes, which are the primary structural units of chromatin. Light
and electron microscope studies have revealed additional fibrogranular
structures in the nucleus that are comprised of components other than
those that make up chromatin (8). With the electron
microscope, these have been identified as part of the chromosomal
topology or, under other conditions, as a fibrillar network extending
throughout the nucleus with little resemblance to chromosomal
topology. These nonchromatin nuclear components have been termed the
nuclear matrix or nuclear scaffold. In recent years, the nuclear matrix
has attracted increasing interest, as it is now clear that most
enzymatic machineries that handle DNA and RNA associate with insoluble
nuclear structures and tend to occur in domains rather than diffusing
freely in the nucleus (for a review, see reference
59).
The structure and function of the nuclear matrix are not understood in
great detail at the molecular level. The nuclear matrix is
operationally defined as the insoluble fibrogranular material remaining
after the treatment of nuclei with DNase and extraction of histones and
most of the DNA. Different investigators use different isolation
procedures for the preparation of the nuclear matrix (7, 12, 22,
29, 40). Although these preparations can result in slight
variations of protein composition, it is generally thought that all
procedures identify by and large the same structures as seen in
electron micrographs, which are responsible for the compartmentalization of the nucleus. The nuclear matrix contains abundant and well-characterized structural proteins, such as lamins and
ribonucleoproteins (18, 41, 49), in addition to a large number of poorly characterized, low-abundance proteins. There is
evidence that some of these proteins, such as DNA and RNA polymerases (8), transcription factors (60), topoisomerase II
(23), and various splicing factors (35), fulfill
more than structural roles. From this, one may infer that the nuclear
matrix may topologically confine replication, transcription, splicing,
and mRNA export and that the nuclear functions that are most often
studied in solution occur, in vivo, in association with larger nuclear
structures.
Cellular DNA has been found to be tightly associated with the nuclear
matrix through specific DNA elements which have been termed matrix
attachment regions (MARs). Similar elements occur in DNA viruses
(14, 30, 47, 52). MARs may be up to a few hundred
nucleotides in length but do not demonstrate strictly conserved
sequence motifs, although many contain A-T-rich stretches and clusters
of topoisomerase II cleavage sites (23). MARs can occur
close to promoters and enhancers and can influence these cis-responsive elements (9, 10). MARs have also
been found close to origins of replication, in introns (12, 13,
32), and form part of the boundaries of actively transcribed
chromatin (12, 13, 40, 45). From these observations, one
could speculate that different MARs may have different functions and
may serve to bring various cis-responsive elements close to
matrix-bound protein assemblies.
Studies of cellular genes suggest that the nuclear matrix might
regulate some of the processes in the HPV life cycle that are not yet
understood. With this consideration in mind, we searched for MARs in
HPV type 16 (HPV-16). Some of the MARs that were mapped lie close to
important cis-responsive elements of HPV-16, namely, the
epithelial cell-specific enhancer, the E6 promoter, the replication origin, and the early-late intergenic region. Sequence studies suggest
that these MARs are conserved among HPV types with otherwise little
sequence similarity, suggesting an important and conserved function for
each of these MARs in the life cycle of papillomaviruses.
| |
MATERIALS AND METHODS |
Cell lines.
The cell lines C33A, which is free of HPV
genomes, and SiHa and CaSki, which carry endogenous HPV-16 genomes, are
derived from cervical carcinomas and are widely used in HPV research
(5, 17). The cell lines HPKI and HPKII were derived by
stable transfection of HPV-16 DNA into foreskin epithelial cells
(48) and were supplied for this study by M. Dürst.
Plasmid constructs.
pHPV16 contains the complete HPV-16
genome in the form of a BamHI insert in pSP65. Subclones are
summarized in Fig. 1 and were obtained as
follows. pHPV16-L1-E7 contains a segment between the genomic positions
(nucleotides [nt]) 5384 and 884 after deletion of a 4,499-bp
Asp718 fragment. The deleted 4,499-bp Asp718
fragment was cut with Bsp120I into two fragments with sizes
of 3,650 and 849 bp, which were cloned into pGEM7zf(+) (Promega) to
yield pHPV16-E1-L2 (nt 885 to 4530) and pHPV16-L2 (nt 4531 to 5383).
Subcloning of segments within and close to the long control region
(LCR) was performed by PCR, and the PCR products were inserted into the SrfI site of pCR-ScriptSK(+) (Stratagene). To obtain
pHPV16-3'L1 (nt 6862 to 7151), we used the primers U170
(CAACATCCCCCAGGAGGC) and L171
(CGTTAACAACTGCTTACGTTTTTTG); for pHPV16-5'LCR (nt 7150 to
7450), we used primers U172 (CGTCGGCTGTAAGTATTGT) and L173 (CGAATTCGGCTAAAGCTAC); for pHPV16-enh (nt 7451 to
7850), we used primers U175 (CGGCCTATTTGTAGCAACAACC)
and L176 (CCCATGTGCAGTTTTACAAATGAA); and for
pHPV16-oriprom (nt 7851 to 104), we used primers U177 (GTAAAGCTGCTGCCGGCTGTGTGCAAA) and L178
(CCTGTGGGTCCT GAAGCTTTGCAGTTCTCTT). pHPV16-E6 contains
the E6 gene in the plasmid pBluescript SK(+) (Stratagene)
flanked by HindIII and PstI sites. Three
other plasmids contain PCR fragments of HPV-16 DNA flanking the origin
of replication inserted into the SrfI site of
pCR-ScriptSK(+): pHPV16-oriprom-x contains a 259-bp fragment (nt 7746 to 104) obtained with the primers U193
(AATTGCGGATCCGGCATAAGGTTTAAACTTCTAA) and L178,
pHPV16-oriprom-y contains a 352-bp fragment (nt 7851 to 274)
obtained with the primers U177 and L194
(GGATCCCCATCTCTATATACTATGCATAAAT), and pHPV16-oriprom-z contains a 487-bp fragment (nt 7746 to 274) obtained with the primers
U193 and L194. The constructs pHPV16-5'LCRmut1, pHPV16-5'LCRmut2, and pHPV16-5'LCRmut3 carry the pHPV-16-5'LCR sequence (nt 7150 to 7450)
mutated with the QuickChange site-directed mutagenesis kit (Stratagene)
with the primers shown in Fig. 8F. pHPV16-E2 contains a 710-bp
MunI-SspBI restriction fragment (nt 2971 to 3680)
of HPV-16 in plasmid pGEMTEZ (Promega). pHPV16-E5, which contains a
802-bp DdeI restriction fragment (nt 3536 to 4337), was
constructed similarly. The control plasmids pCL and pGEM-xdelta contain
an 854-bp EcoRI fragment of the human beta interferon MAR in
pTZ-18R (39) and a 1,119-bp EcoRI-ClaI
fragment of mouse mitochondrial DNA (36), respectively.
View larger version (19K):
[in this window]
[in a new window]
|
FIG. 1.
Map of the HPV-16 genome, with genes, restriction
fragments, and PCR-generated subclones that were examined for
attachment to preparations of the nuclear matrix. The HPV-16 genome,
with a size of 7,906 bp, is represented after linearization at a single
BamHI site at position 6152 in the L1 gene. The numbers in
the boxes represent the sizes of the fragments in base pairs. Fragments
too small to be analyzed have been omitted.
|
|
Preparation of DNA fragments for nuclear matrix binding
assays.
DNA fragments were prepared for binding assays by cutting
the HPV-16 genome into fragments of different sizes which could be
distinguished from one another in agarose gel electrophoresis. Alternatively, plasmids containing segments of the HPV-16 DNA or
control DNA were first digested in aliquots of 10 µg and gel purified
following electrophoresis in low-melting-point agarose. DNA fragments
in gel slices were purified by digestion with 1 U of GELase (Epicentre
Technologies) per 200 mg of 1% agarose at 42°C for 3 h. These
DNA fragments and plasmid DNA from only one of the constructs were then
mixed together in stoichiometrically equivalent proportions. The mixed
DNA fragments were subsequently treated with calf intestinal
phosphatase followed by phenol-chloroform extraction and ethanol
precipitation. Five hundred nanograms of these mixed DNA fragments was
radioactively labelled with [
-32P]ATP by using
polynucleotide kinase and purified with NICK-spin columns (Pharmacia).
Preparation of the nuclear matrix and performance of DNA-nuclear
matrix binding assays.
The nuclear matrix was isolated as
described by Mirkovitch et al. (40) and modified by the
groups of Bode and Shenk (9, 39, 52). The technique is based
on low-salt extraction of nuclei in the presence of lithium
3,5-diiodosalicylate (LIS). Confluent C33A cells (approximately 2 × 107 cells) were washed twice with isolation buffer (3.75 mM Tris-HCl [pH 7.4], 0.05 mM spermine, 0.125 mM spermidine, 0.5 mM
EDTA [pH 7.4], 1% [vol/vol] thiodiglycol, 20 mM KCl; 0.2 mM
phenylmethylsulfonyl fluoride [PMSF]) and scraped into 10 ml of
isolation buffer containing, in addition, 0.1% digitonin. Nuclei were
released by 20 strokes in a Dounce homogenizer and pelleted by
centrifugation. The nuclear pellet was resuspended in 10 ml of
isolation buffer with 0.1% digitonin, carefully resuspended in a
Dounce homogenizer, and pelleted again by centrifugation. The nuclear
pellet was resuspended in 150 µl of freshly prepared nuclear buffer
(5 mM Tris-HCl [pH 7.4], 0.05 mM spermine, 0.125 mM spermidine, 20 mM
KCl, 1% [vol/vol] thiodiglycol, 0.1% digitonin, 0.2 mM PMSF, 1%
aprotinin) and incubated at 37°C for 20 min. Three milliliters of LIS
buffer (20 mM HEPES [pH 7.4], 100 mM lithium acetate, 1 mM Na-EDTA,
0.1% digitonin, 25 mM LIS [Sigma]) was added slowly with gentle
mixing to the heat-treated nuclear pellet. After 5 min, the suspension
was centrifuged at 2,400 × g for 5 min at 4°C, and
the pellet was resuspended in 10 ml of sterile digestion buffer (20 mM
Tris-HCl [pH 7.4], 0.05 mM spermine, 0.125 mM spermidine, 20 mM KCl,
70 mM NaCl, 10 mM MgCl2, 0.1% digitonin, 1% aprotinin,
0.1 mM PMSF), gently rocked for 20 min at room temperature, and
centrifuged as before. This procedure was repeated twice. The nuclear
matrix pellet was resuspended in 600 µl of digestion buffer,
supplemented with restriction enzyme BamHI or
EcoRI to a final concentration of 0.4 U/µl, and incubated
in a 37°C shaking incubator for 3 h to fragment the high-molecular-weight chromosomal DNA. For attachment between presumed
MARs and the nuclear matrix, the preparation was divided into four
aliquots, mixed with end-labelled test DNA (about 3 to 5 ng containing
about 50,000 cpm of 32P) in the presence or absence of
sonicated genomic Escherichia coli competitor DNA (5 to 60 µg), and incubated at 37°C overnight.
Centrifugation at 14,000 × g for 45 min at 4°C
separated this reaction mixture into nuclear matrix pellets and
supernatant. The pellets were washed twice in 500 µl of digestion
buffer and centrifuged for 30 min. A 100-µl aliquot of 10 mM Tris-HCl
(pH 8.5)-0.1 M EDTA-1% sodium dodecyl sulfate and 10 µg of salmon sperm carrier DNA were added to each tube of supernatant and pellet. After 100 µg of proteinase K was added to the supernatant and 200 µg of proteinase K was added to the pellet, the tubes were heated to
55°C for 3 and 18 h, respectively. The protein was extracted from these mixtures with phenol-chloroform, and the DNA was
precipitated with 600 µl of 0.6 M LiCl in ethanol.
DNA was pelleted by centrifugation, washed twice with 70% ethanol, and
dried. The DNA pellets were resuspended in 60 µl of Tris-EDTA buffer,
and the radioactivity was determined on a liquid scintillation counter.
Approximately equal fractions of DNA from the precipitate and the
supernatant were loaded on an agarose gel and separated by
electrophoresis. Approximately 15% of the total input DNA was loaded
into another lane as a reference in quantitative calculations. After
electrophoresis, the gel was dried onto a nylon membrane in a heated
gel drier and autoradiographed by exposure to Hyperfilm (Amersham).
Following exposure of the gel to a PhosphorImager screen, ImageQuant
software (Molecular Dynamics) was used to quantify the amount of DNA
represented by each band. To determine the relative binding affinities
of different DNA fragments, the intensity of each band of the pellet or
supernatant fraction was quantitated with reference to the respective
band in the input lane.
Association of HPV-16 DNA in vivo.
Nuclear matrices of SiHa,
HPKI, and HPKII cells (48) were prepared as described above
and digested with BamHI, HincII, or PstI. Matrix-bound and supernatant DNAs were separated, and
approximately 100 pg of each was amplified through 15 cycles of PCR
with primers amplifying HPV-16 DNA between nt 7010 and 110. The
reaction products were separated on agarose gels, blotted onto nylon
membranes, and hybridized with a radioactively labelled PstI
fragment of the HPV-16 DNA (nt 7010 to 879). For the study of the
behavior of a MAR in vivo, nuclear matrix prepared from CaSki cells as described above was digested with DdeI, EcoRI,
and PstI. The MAR of the E5 gene and the early-late
intergenic region was included in an 802-bp DdeI fragment
between genomic positions 3535 and 4337, which was further shortened by
a PstI cut at position 3697 to yield a fragment of 640 bp. A
309-bp segment from the enhancer without MAR activity was flanked by a
DdeI site at position 7764 and an EcoRI site at
position 7456. After processing of the nuclear matrix as described
above, these fragments were probed with radioactively labelled
fragments (positions 3535 to 4337 and 7450 to 7850, respectively).
| |
RESULTS |
The HPV-16 genome is associated with the nuclear matrix in
vivo.
The association of cellular and viral DNAs with the nuclear
matrix is a prerequisite for the control of important biological tasks,
such as transcription and DNA replication. It has not thus far been
reported whether any HPV genome contains MARs, elements that permit
specific attachment to the nuclear matrix. As there are technical
limitations to the use of cell lines with stably replicating episomal
HPV genomes, we decided to study the three cell lines SiHa, HPKI, and
HPKII for association of their endogenous, intrachromosomal HPV-16
genomes to the nuclear matrix. Figure 2
shows that after separation of the nuclear matrix from soluble fractions of the nuclei, more HPV-16 DNA can be amplified by PCR from
the nuclear matrix fractions than from the supernatant fractions. The
stronger signal obtained with HPKII cells probably stems from the fact
that these harbor about 10 copies of HPV-16 DNA, as opposed to one copy
in SiHa and HPKI cells. We conclude that in vivo, at least in case of
these three cell lines with the viral DNA being integrated into the
cellular DNA, HPV-16 genomes preferentially associate with the nuclear
matrix.
View larger version (56K):
[in this window]
[in a new window]
|
FIG. 2.
Association of the HPV-16 genome with the nuclear matrix
of SiHa, HPKI, and HPKII cells in vivo. I, input; P, matrix-bound DNA
fraction; S, DNA fraction in the supernatant.
|
|
The genomes of four genital HPV types specifically bind in vitro to
nuclear matrix.
It is well established that DNA elements that act
as MARs in vivo can be identified, mapped, and further characterized in vitro by their affinity to nuclear matrix preparations. To examine whether the attachment of HPV-16 DNA to the nuclear matrix shown in
vivo can also be observed in vitro and whether similar behavior is
shown by other papillomaviruses, we prepared nuclear matrix from C33A,
a cell line derived from an HPV-free cervical cancer, and incubated it
with radioactively labelled total genomic DNAs from HPV-11, HPV-16,
HPV-18, and HPV-33. As a positive control, we used the
well-characterized MAR of the human beta interferon gene, while the
bacterial cloning vector liberated by restriction digestion served as
an internal negative control. Figure 3
shows that the genomes of HPV-16 and HPV-33 bind strongly to the
nuclear matrix in the presence of a large excess of E. coli
competitor DNA. Also, HPV-11 and HPV-18 show affinity to the nuclear
matrix, although in this experiment the affinity was somewhat weaker
than those of the beta interferon MAR and the other two viruses. In this and all other MAR detection experiments described in this paper,
the presence of 5 to 100 µg of competitor DNA amounts to an
approximate DNA mass excess of 10,000- to 100,000-fold over the HPV
fragments under investigation. We conclude from Fig. 3 that HPV genomes
have an affinity for binding to the nuclear matrix that is similar to
that of the beta interferon MAR, and this property is distinct from
that of prokaryotic DNA.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Association of the HPV-11, HPV-16, HPV-18,
and HPV-33 genomes and the insert of the beta interferon (hu-Ifn
 ) clone MAR with the nuclear matrix of C33A cells in vitro. Lanes 1, input DNA; lanes 2 and 3, competition with 50- and 100-µg excesses of
E. coli DNA, respectively. While the prokaryotic vector is
efficiently competed from binding to the nuclear matrix at a low
concentration of competitor, HPV-16 and HPV-33 show MAR
activity like that of the strong beta interferon MAR. HPV-11 and
HPV-18 have MAR affinity but are competed at the highest
concentration of the competitor.
|
|
The HPV-16 genome contains specific MARs.
To address
whether MAR activity is evenly spread over the HPV-16 genome or
restricted to particular segments, we cleaved the HPV-16 genome
with BamHI, Asp718, and Bsp120I into
four fragments with sizes of 3650, 2633, 849, and 773 bp (Fig. 1) and
examined their interactions with nuclear matrix extracts of C33A cells. The outcome of this experiment is shown in Fig.
4A to D. This figure (and the analyses in
the subsequent figures) shows plasmid and potential MAR restriction
fragments (i) in the input ratios (lanes I), (ii) as binding to the
nuclear matrix without competitor (lanes P, 0) and with a large excess
of competitor (lanes P, 50), and (iii) as remaining in the unbound
supernatant in the absence of competitor (lanes S, 0) and in the
presence of competitor (lane S, 50).
View larger version (58K):
[in this window]
[in a new window]
|
FIG. 4.
MAR activity in vitro of subgenomic fragments of
HPV-16 DNA. (A) Comparison of a bacterial plasmid (pEZ) without MAR
activity with the MAR of the human beta interferon (hu-Ifn ) gene.
(B to D) MAR activity resides in each of four large restriction
fragments (cleavage by BamHI and Asp718)
encompassing the whole HPV-16 genome. (E and F) Refined mapping of
MAR activity of BspMI (E) and DdeI (F)
restriction fragments of BamHI-digested HPV-16 DNA shows
highly dissimilar MAR activity. (G) Map of restriction fragments with
strong and weak affinities to the nuclear matrix (dark and light
shading, respectively). I, input; P, matrix-bound DNA fraction; S, DNA
fraction in the supernatant; enh, enhancer. In this and all subsequent
figures, homologous bands in the P and S lanes occasionally run slower
or faster than the input DNA, as it was difficult to remove completely
all salt that remained from the MAR preparation.
|
|
Surprisingly, each of the four subclones showed affinity to the nuclear
matrix, similar to the positive control (Fig. 4A). As expected, no
affinity was observed with the bacterial cloning vectors.
To determine whether small fragments of the HPV-16 genome might
show differential affinity to the nuclear matrix, we digested HPV-16 DNA with BamHI and either BspMI or
DdeI, which resulted in 7 and 12 genomic fragments,
respectively. From Fig. 4E it is apparent that MAR activity is spread
unevenly over the HPV-16 genome. Densitometric analysis (data not
shown) points to the 1,432-bp fragment covering the end of L1 and the
5' LCR as the genomic segment with strongest MAR activity, followed by
three other fragments with sizes of 3,432, 1,189, and 790 bp, which have 10 to 30% less affinity. From Fig. 4F, which has the best resolution of different genomic segments, it is clear that high MAR
activity resides in two fragments. One, with a size of 1,611 bp,
includes the end of L1 and the LCR; the other, with a size of 802 bp,
includes E5 and the early-late intergenic region. Three fragments, with
sizes of 2,230, 864, and 630 bp, have 70 to 90% weaker affinity than
the 802-bp fragment. These fragments include E1-E2, the 3' end of L2,
and most of E6, respectively.
These observations are summarized in Fig. 4G. The MAR activity of the
E6 gene is not very pronounced in Fig. 4E and F but was confirmed on
reexamination (see below and Fig. 5A). The absence of MAR activity in
very small fragments is difficult to interpret, as MAR activity may be
lost as a result of decreasing fragment size rather than the absence
being due to sequence properties. Combining the data of Fig. 4, we
concluded that two larger genomic segments of HPV-16, which are
centered on (i) the 5' LCR and (ii) the E5 gene and the early-late
intergenic region, have high MAR activity. The fairly large sizes of
these fragments required a more detailed mapping of MAR activity.
The enhancer, promoter, and origin of replication of HPV-16 are
flanked by two strong MARs but do not possess intrinsic MAR
activity.
The identification of MAR activity in the HPV-16 LCR
and its flanking regions is intriguing, as MARs are frequently linked to enhancer, promoter, and replication origins, and these three functional elements of HPV-16, namely, the epithelial
cell-specific enhancer, the E6 promoter, and the viral replication
origin, are positioned in the HPV-16 LCR. Figure
5A shows the detailed mapping of MAR
activity in this genomic region. By PCR cloning, we subdivided into
five segments a region of 1,604 bp between genomic positions 6862 and
566, which includes and flanks the LCR. These fragments encode (i) the
3' part of the L1 gene, (ii) a 5' segment of the LCR stretching from L1
to a single E2 binding site 300 bp downstream of L1, (iii) a segment
further downstream containing the HPV-16 epithelium-specific
enhancer, (iv) a segment containing the replication origin and the
E6-E7 promoter, and (v) a 456-bp segment containing the E6 gene. Figure
5A indicates that strong MAR activity resides in the 5' segment of the
LCR and that nearly equivalent MAR activity resides in the E6 gene. In
contrast, the enhancer itself shows weak affinity, and the segment with
the replication origin and the promoter shows no MAR activity at all.
The 3' segment of the L1 gene showed no MAR behavior (data not shown).
We conclude from this that the three important
cis-responsive elements of the LCR are flanked by two strong
MARs but are not themselves directly attached to the nuclear matrix. As
the genetic properties of this part of the HPV-16 genome required
cloning of these five elements on DNA fragments of various sizes, we
included a control to measure whether size alone might contribute to
MAR activity. Figure 5B compares the 301-bp 5' LCR with four smaller
and larger fragments. Each of these fragments, which are depicted in
Fig. 5C, contains the E6 promoter, the replication origin, and a
portion of the enhancer upstream of the replication origin or the 5'
part of the E6 gene. It is apparent that these four fragments have only weak MAR affinity, if any, although their sizes differ by about 50%
above and below that with the 5' LCR-MAR.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 5.
(A) A 5' segment of the LCR and the E6 gene bind
strongly in vitro to the nuclear matrix of C33A cells, while there is
little binding of the epithelium-specific enhancer, the replication
origin, and the E6-E7 promoter. Also, a 3' segment of the L1 gene
showed no MAR behavior whatsoever (58). (B) The 301-bp
fragment with the 5' LCR has higher MAR affinity than four larger and
smaller fragments, including the E6 promoter (prom), the replication
origin (ori), 3' parts of the enhancer (enh), and 5' parts of the E6
gene. I, input; P, matrix-bound DNA fraction; S, DNA fraction in the
supernatant. (C) Locations and MAR affinities of fragments tested in
these experiments. Each box identifies one of the tested fragments; the
two shaded boxes indicate the only fragments with MAR activity.
|
|
The E5 gene and the early-late intergenic region contain the
strongest MAR of HPV-16, which is contiguous with weak MARs in E2
and E1 gene sequences.
From Fig. 4F it is apparent that an 802-bp
DdeI fragment had the highest affinity to the nuclear matrix
preparations. This fragment is between nucleotide positions 3536 and
4337 and includes the 3' end of E2, the E5 gene, and the early-late
intergenic region. Figure 6 shows a
refined analysis of this genomic region. The E5 gene is included in a
3,650-bp Asp718-Bsp120 fragment, which also
contains the E1 and E2 genes and the 5' terminus of L2. After digestion
with either SspB1, MunI, or Ppu10I,
this region can be subdivided into four, five, or three smaller
fragments, respectively. As documented in Fig. 6A to C and summarized
in Fig. 6D, the strongest MAR activity can be seen in fragments
including the E5 gene and a small part of the 3' terminus of E2.
Critical information can be gathered from a 428-bp SspB1
fragment which includes sequences between positions 3681 and 4108, including all of E5. As judged by densitometric analyses with a
PhosphorImager, all fragments 5' of E5 with E1 and E2 gene sequences
have relatively weaker MAR activity. The unsatisfactory analysis of the
777-bp fragment, which was poorly separated from a 783-bp fragment, was
later clarified by inclusion in another experiment (see Fig. 9). In
Fig. 6A, a 422-bp SspB1 fragment with the 5' end of L2, also
including part of the early-late intergenic region, is not well
resolved from the 428-bp fragment with strong MAR activity. From the
comparison of the positions of the respective bands in the precipitate
and the supernatant fractions, it seems that the 422-bp fragment is very poorly bound. This would place the 3' border of this MAR in the
intergenic region, with an extremely A-T-rich segment in the middle of
this region apparently not contributing much to the MAR property.
View larger version (54K):
[in this window]
[in a new window]
|
FIG. 6.
MAR activity of restriction fragments surrounding,
including, and flanking the HPV-16 E5 gene as shown in vitro with a
nuclear matrix preparation of C33A cells. As shown in panel D, E5 is
included in a 3,650-bp Asp718-Bsp120 fragment,
which can be further subdivided by SspB1, MunI,
or Ppu10I into four, five, and three smaller fragments,
respectively. Panels A to C document strong MAR activity in fragments
including the E5 gene and a small part of the 3' terminus of E2.
Particularly high activity is shown by a 428-bp SspB1
fragment which includes, between positions 3681 and 4108, all of E5.
All fragments 5' of E5 with E1 and E2 gene sequences have weak MAR
activity. I, input; P, matrix-bound DNA fraction; S, DNA fraction in
the supernatant.
|
|
These data suggest that the E5 gene and part of the early-late
intergenic region function as strong MARs. Minor affinity can be found
through the E2 and E1 genes. No significant activity can be found in
the late genes L2 and L1, although weak activity is suggested by the
behavior of a 790-bp BspM1 fragment in the 3' part of L2
(Fig. 4E). (Our data are schematically represented in Fig. 10A and are
discussed below in the context of other observations.)
HPV-16 MAR activity in CaSki cells in vivo.
We decided to
examine interactions between the HPV-16 genome and the nuclear
matrix in vivo in a manner similar to that for the in vitro
experiments. Toward this end, we digested nuclear matrix preparations
of CaSki cells, which have approximately 500 endogenous HPV-16
genomes, with restriction enzymes, purified the DNA, and processed the
preparations in Southern blots with radioactive HPV-16 DNA probes.
The identification of specific bands in initial experiments was
hampered by the presence of partially digested fragments and
derivatives of the numerous recombined HPV-16 genomes known to
exist in CaSki cells (5). It was possible, however, to
compare two small genomic segments, both including the MAR of the E5
gene and the early-late intergenic region, with an enhancer fragment
without MAR activity. Figure 7 shows that the latter segment could be competed with an excess of E. coli DNA, while the former could not be, and we conclude that this strong MAR, and possibly all HPV-16 MARs, shows in vivo activities similar to those observed in vitro and appears to be responsible for
the adherence of the complete HPV-16 genome to the nuclear matrix
as observed in Fig. 3.
View larger version (49K):
[in this window]
[in a new window]
|
FIG. 7.
The endogenous HPV-16 genomes of CaSki cells adhere
to the nuclear matrix with the MAR of the E5-early-late intergenic
region. I, input; P, matrix-bound DNA fraction; S, DNA fraction in the
supernatant. The MAR was included in a 640-bp
PstI-to-DdeI fragment between genomic positions
3697 and 4337 (panel A, lower band) or, alternatively, in the 802-bp
DdeI fragment between genomic positions 3535 and 4337, generated by incomplete digestion by PstI of genomes
embedded in nuclear matrix protein. As a fragment without MAR activity,
we monitored a 309-bp segment from the enhancer region between an
EcoRI site at position 7456 and a DdeI site at
position 7764 (asterisk in panel B). Binding of this band could be
competed by an excess of E. coli DNA. Since the probe used
in panel B was shorter, less stringent hybridization and washing
conditions (60 versus 65°C) were used. This resulted in its binding
to more partially digested fragments than in panel A. Restriction
enzyme site abbreviations in panel C: D, DdeI; P,
PstI; E, EcoRI.
|
|
Multiple point mutations in the 5'-LCR MAR reduce the affinity to
the nuclear matrix in vitro.
As a control for our observations, we
attempted to mutate one of the MARs of HPV-16. A deletion analysis
was strategically ruled out, as MARs show decreased affinity with
decreasing size (8-10). Also, the testing of individual
point mutations was precluded by the notion that MARs do not normally
exhibit strictly conserved sequence motifs. It is known, however, that
they contain (i) an increased frequency of motifs with similarity to
the topoisomerase II recognition sites (51, 56), (ii) A-T
rich regions, with prominence of the sequence ATATTT
(12, 15, 55), and (iii) sequences that are rich in the
dinucleotide TG. We have created three mutants of the 301-bp segment of
the 5' LCR with strong MAR affinity with 8, 17, and 23 point mutations,
which alter similarities to these sequence traits (Fig.
8A). Although these mutations change only
2.7 to 7.8% of the sequence of the 5' LCR segment, we determined by a
densitometric analysis of Fig. 8A to D that these mutations reduced the
affinity to the nuclear matrix by 50, 70, and 78%, respectively
(58).
View larger version (61K):
[in this window]
[in a new window]
|
FIG. 8.
Multiple point mutations in the 5' LCR reduce MAR
activity in vitro. (A) In vitro MAR activity of the 301-bp 5'-LCR
fragment with the HPV-16 wild-type (WT) sequence. (B to D) Activity
with this sequence mutated in 8 (Mut1), 17 (Mut2), and 23 positions
(Mut3), respectively. With changes of 2.7 to 8% of the sequence of the
5'-LCR segment, densitometric analysis with a PhosphorImager showed MAR
activity reduced by 50, 70, and 78%, respectively. The positive
control is a 574-bp fragment including the E5 MAR (positions 3764 to
4337); controls for weak MAR activity are a 400-bp enhancer (enh)
segment and a 228-bp segment from the E2 gene. I, input; P,
matrix-bound DNA; S, DNA fraction in the supernatant. (E) Position of
the mutated sequence within the 5' LCR of HPV-16, showing
Drosophila (D-TopII) and chicken (C-TopII) topoisomerase II
sequences with only one mismatch as well as a highly conserved YY1 site
and an E2 binding site between the 5' LCR and the enhancer segment. (F)
Multiple point mutations were chosen to alter typical sequence elements
of MARs: (i) GT dinucleotides, (ii) chicken topoisomerase II motifs
with two or fewer mismatches (56) (boxed sequences), (iii)
Drosophila topoisomerase II motifs with two or fewer
mismatches (51) (underlined sequences in the upper part),
and (iv) the sequence ATATTT (15, 55). Underlined
sequences in the lower part indicate the oligonucleotides used for
mutagenesis.
|
|
A-T richness alone is not sufficient for binding the nuclear matrix
in vitro.
The early-late intergenic region and the 5' LCR overlap
with some of the more A-T-rich sequences of the HPV-16 genome (see Fig. 10C and discussion below). As it is known that a potential for
duplex DNA destabilization is an intrinsic property of MARs (6), we determined whether A-T richness alone would generate MAR-like affinities in our test systems. Toward this goal, we compared
a segment of mouse mitochondrial DNA, having an A-T content of 66.6%,
with the human beta interferon DNA, the E2 gene segment, and the
early-late intergenic region, which have A-T contents of 68.8, 61.3, and 69.3%, respectively. Figure 9 shows
that the HPV-16 early-late segment has a 50% higher MAR affinity
in vitro than the mitochondrial DNA, although its A-T content is
similar, while the E2 gene segment, with a 5% lower A-T content,
behaves similarly to the mitochondrial DNA. These findings do not
support A-T richness of the LCR and the early-late intergenic segments as the only basis for MAR affinity.
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 9.
Comparison of a segment of mouse mitochondrial DNA (mu.
mito. DNA) (having an A-T content of 66.6%) with the human beta
interferon MAR (hu. Ifn. ), an E2 gene segment, and the early-late
intergenic region (having A-T contents of 68.8, 61.3, and 69.3%,
respectively) shows that A-T richness alone is not sufficient for
binding the nuclear matrix in vitro. I, input; P, matrix-bound DNA; S,
DNA fraction in the supernatant.
|
|
| |
DISCUSSION |
MARs in the HPV-16 genome are close to
cis-responsive elements.
The HPV-16 genome has at
least five genomic segments with affinity to the nuclear matrix in
vitro, as is summarized in Fig. 10A.
Two MARs bracket a 500-bp segment of the LCR forming a functional unit
which houses the epithelial cell-specific enhancer, the replication origin, and the E6 promoter. One of these two MARs is atypical in being
completely positioned within a gene, namely, E6. This may indicate the
existence of cis-responsive elements required for induction
of a promoter in the E7 gene (24b). The other MAR is
positioned in the 5' segment of the LCR. This segment has an approximate length of 300 bp and stretches from the end of L1 to the
only E2 site in the center of the LCR. The only known functional elements contained in this region are a transcription termination site
and a regulatory element involved in transcript stability (21), although transcriptional modulation by this segment
has been reported for HPV-11 (3, 19). Interestingly,
this MAR of HPV-16 had been analyzed by footprint experiments (24a)
before its function was understood, and it was found to contain several short footprints as well as a very extensive footprint, fp1l, covering
more than 100 bp. Given that the size and A-T richness of this segment
are conserved in all genital HPVs (Fig. 10C and D) (58), it
is likely that the MAR properties of this segment are important for the
life cycle of HPVs.
View larger version (36K):
[in this window]
[in a new window]
|
FIG. 10.
Genomic properties of HPV genomes. (A) Strong and weak
MARs of HPV-16 (thicker and thinner symbols, respectively) relative
to its gene organization. (B) Presence of Drosophila
topoisomerase II (topo II) consensus sequences (51) in
genital HPV types. The bars represent the occurrence of this sequence,
with maximally one mismatch, in 250-bp segments after alignment with
the sequence of 28 genital HPV types, whose genomic sequence is
completely known (40a). (C and D) A+T contents of HPV-16 and
HPV-11, respectively. The A+T contents a 100-bp window moved across
the total genomic sequence are shown. (E) Prediction of MAR activity by
the MAR finder computer algorithm with a window of 1 kb and steps of 10 bp (55).
|
|
A third MAR, the strongest in our tests, overlaps with the E5 gene and
the early-late intergenic region. This segment has the highest A-T
content in the HPV-16 genome and those of other genital HPVs (Fig.
10C and our unpublished observations). Two additional genomic stretches
with weak MAR affinity lie in the E1 and E2 genes and in the 3' side of
the L2 gene. We have mapped these MARs with less precision than the
higher-affinity MARs.
It is likely that the five MARs detected in vitro are responsible for
the in vivo matrix attachment of the whole HPV-16 genomes observed
in SiHa, CaSki, and HPK cells. The sequence evaluations described below
indicate that the attachment of HPV-11, HPV-18, and HPV-33
may stem from MARs in similar genomic positions. MARs may be highly
conserved among all genital HPVs, as are the genes and other
cis-responsive elements, although these viruses have overall
sequence similarities of only about 60%.
Potential topoisomerase II cleavage sites and YY1 binding sites in
HPV-16 are conserved between genital HPVs.
Topoisomerase II is
a major component of the nuclear matrix (23), with cleavage
sites for topoisomerase II frequently being associated with MAR
affinity (12, 23, 32). Topoisomerase II makes double-strand
nicks in DNA during the winding and unwinding reactions involved in
transcription and replication. The binding and cleavage by
topoisomerase II show sequence preference but not strict sequence
specificity. Consensus recognition sequences have been published for
Drosophila (51) and for chicken
(56) topoisomerase II. These two consensus sequences are not
very similar, although the topoisomerase II targets are probably the
same, as the enzymes cleave similar sites in vitro (56). A
search of topoisomerase II motifs in the genomes of 28 different
genital HPVs by using the Drosophila (Fig. 10B) and the
chicken (58) consensus elements predicts topoisomerase II
sites to predominate in six genomic positions of these HPVs.
Considering the correlation of topoisomerase II sites with MARs, it is
noteworthy that in genital HPVs, three high-incidence areas of likely
topoisomerase II sites lie close to the MARs we detected experimentally
in HPV-16, namely, maxima at positions 500 and 7500, which flank
the LCR, and around position 4000 at the early-late intergenic region. Three additional maxima overlap with the E1 and E2 genes and the 3' end
of L2, where we found weak MARs. It is surprising to observe such a
specific distribution, as the functions of topoisomerase II are
normally linked to the progression of replication forks and to the
elongation of transcripts, and there seems little reason why these
functions should otherwise be linked to the genomic organization of
HPVs.
It should also be noted that the MAR in the 5' LCR of HPV-16
contains a high-affinity YY1 site (positions 7427 to 7434)
(42), which is present in all genital HPVs (43),
as YY1 is a transcription factor preferentially enriched in nuclear
matrix preparations (25). This site may contribute to the
interaction of the 5' LCR with the nuclear matrix, although in
experiments not shown here we could not determine a differential
affinity of the 5'-LCR segment of HPV-16 with a wild-type or
mutated YY1 site (58).
The genomes of genital HPVs have a highly conserved pattern of A-T-
and G-C-rich stretches that correlates with MARs of HPV-16.
Most MARs of cellular DNA have a high A-T content, a property also
shown by the HPV-16 MARs in the 5' LCR and in the early-late intergenic region (Fig. 10C). The genomes of HPV-11, HPV-16,
HPV-18, and HPV-33 have overall A-T contents of 59, 63.5, 59.5, and 63.5%, respectively. A comparison of Fig. 10C and D shows that in
HPV-16 and HPV-11, this A-T content is not homogenous through
either of the genomes but that A-T- and G-C-rich segments alternate, with maxima of A-T richness between 70 and 85% and minima between 30 and 50%. The pattern of A-T and G-C richness is conserved between HPV-16 and HPV-11 (Fig. 10C and D) and between all other
genital HPV types (58), in spite an overall sequence
similarity of only about 60% among these HPV types. It is of interest
that maxima of A-T richness in the 5' LCR, E6, E5, and the early-late
intergenic region coincide with the MAR properties of HPV-16.
Mathematical modelling predicts some of the MARs of
HPV-16.
A computer program that allows the search for
potential MARs has been developed (34, 55). This algorithm
evaluates sequences for six different properties frequently found
in MARs: (i) ATTTA-like motifs, (ii) A-T-rich sequences, (iii) TG
dinucleotide-rich sequences, (iv) curved DNA, (v) kinked DNA, and (vi)
topoisomerase II sites. Figure 10E shows that for HPV-16 this
program predicts MARs flanking the LCR and in the early-late intergenic
region but does not strongly indicate the other experimentally
determined MARs. This algorithm consistently detected MARs close to the
LCR, in E1-E2, and the early-late intergenic regions of many different
HPVs, although the comparison between many types showed much less
similarity than the study of A-T richness or the topoisomerase II sites
alone did (58).
Possible functions of MARs in the HPV life cycle.
Figure
11 gives a hypothetical model of the
higher-order structure of the HPV-16 DNA in the nucleus, with MARs
anchoring three genomic loops: (i) the enhancer-replication
origin-promoter region, (ii) most of the early genes, and (iii) the
late genes. While this study aimed to provide structural data, future
research will have to address the functional consequences of such
structures. In the case of cellular genes, MARs have been found
to support a number of very different processes, including
transcriptional modulation, splicing and transport of mRNA, and
replication. Similar roles may later be attributed to the HPV-16
MARs.
View larger version (11K):
[in this window]
[in a new window]
|
FIG. 11.
Schematic representation of the hypothetical topology
of the HPV-16 genome attached to the nuclear matrix. Strong MARs in
the 5' LCR and in the E6 and the E5 genes create three accessible
genomic loops, with MARs separating the cis-responsive
elements of the LCR, the early genes, and the late genes. enh-ori-prom,
enhancer-origin-promoter.
|
|
The proximity of two MARs to the HPV-16 enhancer and promoter
suggests a role in transcriptional regulation, as MARs have been
shown to work synergistically with promoters or enhancers, possibly by
bringing cis-responsive elements close to matrix-bound transcriptional complexes (2, 10, 12, 13, 22, 40, 45, 57) or
by generating an extended domain of accessible chromatin
(31). The latter mechanism is reminiscent of the case for
the bovine papillomavirus type 1 (BPV-1) LCR, which overlaps with the
only nucleosome-free stretch of BPV-1 chromatin (50). It is
of interest that the composition of the nuclear matrix can change in a
differentiation-dependent manner (20, 33), as altered
transcription of genital HPVs depending on the cell type (24), epithelial differentiation state (44), and
tumorigenesis (54) is only partially understood.
One may postulate that the MAR in the E1-E2-E5 region of HPV-16
might stimulate recombination, particularly since in malignant lesions
HPV genomes are often integrated by recombination of this part of the
HPV genome with cellular DNA (5, 17, 37, 53, 54). Documented
examples of a role of MARs in recombination are the integration of
woodchuck hepatitis virus DNA close to cellular MARs during progression
of hepatomas (11) and the integration of
Agrobacterium T-DNA in transgenic plants at a MAR close to one T-DNA end (16).
Association between BPV-1 genomes and metaphase chromosomes has been
proposed to support copy number control of BPV-1 genomes (38). As there are indications that a 672-bp fragment of
BPV-1 adjacent to the viral origin of replication associates with the nuclear matrix (1), one may speculate that MARs could be a tool for papillomavirus genomes to attach to nuclear structures during
mitosis toward equal partition between daughter nuclei. This is
reminiscent of observations made for three other DNA viruses, simian
virus 40 (SV40), adenoviruses, and Epstein-Barr virus. In the SV40
genome a MAR sequence has been mapped to a 300-bp segment central to
the large T-antigen gene (47), which may help the SV40
genome to be preferentially associated with nuclear structures
(14). The adenovirus genome has been found attached to the
nuclear matrix in the form of episomal DNA, and this may occur with the
help of the adenovirus-encoded protein covalently bound to the termini
of the viral genome (52). Finally, a 5.2-kb segment of
Epstein-Barr virus replicating as an episome allows high-affinity
association with the nuclear matrix in Raji cells (26, 30)
due to the close association of an MAR, the latent viral replication
origin, and an enhancer.
We are grateful to J. Bode, W. T. Garrard, S. A. Krawetz, and
G. B. Singh for valuable and very detailed technical advice. The
plasmids pCL and pGEM-xdelta were the kind gift of J. Bode. G. B. Singh created the MAR-finder program and assisted in its use. Robin M. Watts and Walter Stünkel gave valuable editorial advice in
writing the manuscript.
| 1.
|
Adom, J. N.,
F. Gouilleux, and H. Richard-Foy.
1992.
Interaction with the nuclear matrix of a chimeric construct containing a replication origin and a transcription unit.
Biochim. Biophys. Acta
1171:187-197[Medline].
|
| 2.
|
Antoniou, M., and F. Grosveld.
1990.
Beta-globin dominant control region interacts differently with distal and proximal promoter elements.
Genes Dev.
4:1007-1013[Abstract/Free Full Text].
|
| 3.
|
Auborn, K. J., and B. M. Steinberg.
1991.
A key DNA-protein interaction determines the function of the 5'URR enhancer in human papillomavirus type 11.
Virology
181:132-138[Medline].
|
| 4.
|
Baker, C., and C. Calef.
1996.
Maps of papillomavirus transcripts, p. 3-14.
In
G. Myers, A. Halpern, C. Baker, A. McBride, C. Wheeler, and J. Doorbar (ed.), Human papillomaviruses 1996 compendium, part III. Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 5.
|
Baker, C. C.,
W. C. Phelps,
V. Lindgren,
M. J. Braun,
M. A. Gonda, and P. M. Howley.
1987.
Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines.
J. Virol.
61:962-971[Abstract/Free Full Text].
|
| 6.
|
Benham, C.,
T. Kohwi-Shigematsu, and J. Bode.
1997.
Stress-induced duplex DNA destabilization in scaffold/matrix attachment regions.
J. Mol. Biol.
274:181-196[Medline].
|
| 7.
|
Berezney, R., and D. S. Coffey.
1974.
Identification of a nuclear protein matrix.
Biochem. Biophys. Res. Commun.
60:1410-1417[Medline].
|
| 8.
|
Berezney, R.,
M. J. Mortillaro,
H. Ma,
X. Wei, and J. Samarabandu.
1995.
The nuclear matrix: a structural milieu for genomic function.
Int. Rev. Cytol.
162A:1-65.
|
| 9.
|
Bode, J., and K. Maass.
1988.
Chromatin domain surrounding the human interferon-beta gene as defined by scaffold-attached regions.
Biochemistry
27:4706-4711[Medline].
|
| 10.
|
Bode, J.,
T. Schlake,
M. Rios-Ramirez,
C. Mielke,
M. Stengert,
V. Kay, and D. Klehr-Wirth.
1995.
Scaffold/matrix-attached regions: structural properties creating transcriptionally active loci.
Int. Rev. Cytol.
162A:389-454.
|
| 11.
|
Bruni, R.,
C. Argentini,
E. D'Ugo,
R. Guiseppetti,
A. R. Ciccaglione, and M. Rapicetta.
1995.
Recurrence of WHV integration in the b3n locus in woodchuck hepatocellular carcinoma.
Virology
214:229-234[Medline].
|
| 12.
|
Cockerill, P. N., and W. T. Garrard.
1986.
Chromosomal loop anchorage of the kappa immunoglobulin gene occurs next to the enhancer in a region containing topoisomerase II sites.
Cell
44:273-282[Medline].
|
| 13.
|
Cockerill, P. N.,
M. H. Yuen, and W. T. Garrard.
1987.
The enhancer of the immunoglobulin heavy chain locus is flanked by presumptive chromosomal loop anchorage elements.
J. Biol. Chem.
262:5394-5407[Abstract/Free Full Text].
|
| 14.
|
Deppert, W., and R. Schirmbeck.
1995.
The nuclear matrix and virus function.
Int. Rev. Cytol.
162A:485-537.
|
| 15.
|
Dickinson, L. A.,
T. Joh,
Y. Kohwi, and T. Kohwi-Shigematsu.
1992.
A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition.
Cell
70:631-645[Medline].
|
| 16.
|
Dietz, A.,
V. Kay,
T. Schlake,
J. Landsmann, and J. Bode.
1994.
A plant scaffold attached region detected close to a T-DNA integration site is active in mammalian cells.
Nucleic Acids Res.
22:2744-2751[Abstract/Free Full Text].
|
| 17.
|
El Awadi, M.,
J. B. Kaplan,
S. J. O'Brien, and R. D. Burk.
1987.
Molecular analysis of integrated human papillomavirus 16 sequences in the cervical cancer cell line SiHa.
Virology
159:389-398[Medline].
|
| 18.
|
Fackelmayer, F., and A. Richter.
1994.
Purification of two isoforms of hnRNA-U and characterization of their nucleic acid binding activity.
Biochemistry
33:10416-10422[Medline].
|
| 19.
|
Farr, A.,
S. Pattison,
B. S. Youn, and A. Roman.
1995.
Detection of silencer activity in the long control regions of human papillomavirus type 6 isolated from both benign and malignant lesions.
J. Gen. Virol.
76:827-835[Abstract/Free Full Text].
|
| 20.
|
Fey, E. G., and S. Penman.
1988.
Nuclear matrix proteins reflect cell type of origin in cultured human cells.
Proc. Natl. Acad. Sci. USA
85:121-125[Abstract/Free Full Text].
|
| 21.
|
Furth, P. A.,
W. T. Choe,
J. H. Rex,
J. C. Byrne, and C. C. Baker.
1994.
Sequences homologous to 5' splice sites are required for the inhibitory activity of papillomavirus late 3' untranslated regions.
Mol. Cell. Biol.
14:5278-5289[Abstract/Free Full Text].
|
| 22.
|
Gasser, S. M., and U. K. Laemmli.
1986.
Cohabitation of scaffold binding regions with upstream/enhancer elements of three developmentally regulated genes of D. melanogaster.
Cell
46:521-530[Medline].
|
| 23.
|
Gasser, S. M.,
T. Laroche,
J. Falquet,
E. Boy de la Tour, and U. K. Laemmli.
1986.
Metaphase chromosome structure. Involvement of topoisomerase II.
J. Mol. Biol.
188:613-629[Medline].
|
| 24.
|
Gloss, B.,
H. U. Bernard,
K. Seedorf, and G. Klock.
1987.
The upstream regulatory region of the human papillomavirus-16 contains an E2 protein-independent enhancer which is specific for cervical carcinoma cells and regulated by glucocorticoid hormones.
EMBO J.
6:3735-3743[Medline].
|
| 24a.
|
Gloss, B.,
T. Chong, and H.-U. Bernard.
1989.
Numerous nuclear proteins bind the long control region of human papillomavirus type 16: a subset of 6 of 23 DNase I-protected segments coincides with the location of the cell-type-specific enhancer.
J. Virol.
63:1142-1152[Abstract/Free Full Text].
|
| 24b.
|
Grassmann, K.,
B. Rapp,
H. Maschek,
K. U. Petry, and T. Iftner.
1996.
Identification of a differentiation-inducible promoter in the E7 open reading frame of human papillomavirus type 16 (HPV-16) in raft cultures of a new cell line containing high copy numbers of episomal HPV-16 DNA.
J. Virol.
70:2339-2349[Abstract].
|
| 25.
|
Guo, B.,
P. R. Odgren,
A. J. van Wijnen,
T. J. Last,
J. Nickerson,
S. Penman,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1995.
The nuclear matrix protein NMP-1 is the transcription factor YY1.
Proc. Natl. Acad. Sci. USA
92:10526-10530[Abstract/Free Full Text].
|
| 26.
|
Hörtnagel, K.,
J. Mautner,
L. J. Strobl,
D. A. Wolf,
B. Christoph,
C. Geltinger, and A. Pollack.
1995.
The role of immunoglobulin kappa elements in c-myc activation.
Oncogene
10:1393-1401[Medline].
|
| 27.
|
Howley, P. M.
1996.
Papillomavirinae: the viruses and their application, p. 2045-2076.
In
Field's virology. Lippincott Raven Publishers, Philadelphia, Pa.
|
| 28.
|
International Agency for Research on Cancer.
1995.
In
Monograph on the evaluation of carcinogenic risks to humans, vol. 64. Human papillomaviruses.
International Agency for Research on Cancer, Lyon, France.
|
| 29.
|
Jackson, D. A., and P. R. Cook.
1985.
A general method for preparing chromatin containing intact DNA.
EMBO J.
4:913-918[Medline].
|
| 30.
|
Jankelevich, S.,
J. L. Kolman,
J. W. Bodnar, and G. Miller.
1992.
A nuclear matrix attachment region organizes the Epstein-Barr viral plasmid in Raji cells into a single DNA domain.
EMBO J.
11:1165-1176[Medline].
|
| 31.
|
Jenuwein, T.,
W. C. Forrester,
L. A. Fernandez-Herrero,
G. Laible,
M. Dull, and R. Grosschedl.
1997.
Extension of chromatin accessibility by nuclear matrix attachment regions.
Nature
385:269-272[Medline].
|
| 32.
|
Kas, E., and L. A. Chasin.
1987.
Anchorage of the Chinese hamster dihydrofolate reductase gene to the nuclear scaffold occurs in an intragenic region.
J. Mol. Biol.
198:677-692[Medline].
|
| 33.
|
Keesee, S. K.,
M. D. Meneghini,
R. P. Szaro, and Y. J. Wu.
1994.
Nuclear matrix proteins in human colon cancer.
Proc. Natl. Acad. Sci. USA
91:1913-1916[Abstract/Free Full Text].
|
| 34.
|
Kramer, J. A.,
G. B. Singh, and S. A. Krawetz.
1996.
Computer assisted search for nuclear matrix attachment.
Genomics
33:305-308[Medline].
|
| 35.
|
Li, H., and P. M. Bingman.
1991.
Arginine/serine-rich domains of the su(wa) and tra RNA processing regulators target proteins to a subnuclear compartment implicated in splicing.
Cell
67:335-342[Medline].
|
| 36.
|
Lutfalla, G.,
H. Blanc, and R. Bertolotti.
1985.
Shuttling of integrated vectors from mammalian cells to E. coli is mediated by head-to-tail multimeric inserts.
Somat. Cell. Mol. Genet.
11:223-238[Medline].
|
| 37.
|
Matsukura, T.,
T. Kanda,
A. Furuno,
H. Yoshikawa,
T. Kawana, and K. Yoshiike.
1986.
Cloning of monomeric human papillomavirus type 16 DNA integrated within cell DNA from a cervical carcinoma.
Virology
58:979-982.
|
| 38.
|
McBride, A. A., and M. Skiadopoulos.
1996.
BPV-1 viral genomes and the E2 transactivator protein are associated with cellular metaphase chromosomes, p. 163.
In
Abstracts from the 15th International Papillomavirus Workshop, Queensland.
|
| 39.
|
Mielke, C.,
Y. Kohwi,
T. Kohwi-Shigematsu, and J. Bode.
1990.
Hierarchical binding of DNA fragments derived from scaffold-attached regions: correlation of properties in vitro and function in vivo.
Biochemistry
29:7475-7485[Medline].
|
| 40.
|
Mirkovitch, J.,
M. E. Mirault, and U. K. Laemmli.
1984.
Organization of the higher-order chromatin loop: specific DNA attachment sites on nuclear scaffold.
Cell
39:223-232[Medline].
|
| 40a.
|
Myers, G.,
H. U. Bernard,
H. Delius,
C. Baker,
J. Icenogel,
A. Halpern, and C. Wheeler.
1995.
In
Human papillomaviruses 1995. A compilation and analysis of nucleic acid and amino acid sequences.
Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 41.
|
Nakayasu, H., and R. Berezney.
1991.
Nuclear matrins: identification of the major nuclear matrix proteins.
Proc. Natl. Acad. Sci. USA
88:10312-10316[Abstract/Free Full Text].
|
| 42.
|
O'Connor, M. J.,
S. H. Tan,
C. H. Tan, and H. U. Bernard.
1996.
YY1 represses human papillomavirus type 16 transcription by quencing AP-1 activity.
J. Virol.
70:6529-6539[Abstract/Free Full Text].
|
| 43.
|
O'Connor, M.,
S. Y. Chan, and H. U. Bernard.
1995.
Transcription factor binding sites in the long control regions of genital HPVs, p. 21-40.
In
G. Myers, H. U. Bernard, H. Delius, C. Baker, J. Icenogle, A. Halpern, and C. Wheeler (ed.), Human papillomaviruses 1995 compendium, part III-A. Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 44.
|
Parker, J. N.,
W. Zhao,
K. J. Askins,
T. R. Broker, and L. T. Chow.
1997.
Mutational analyses of differentiation-dependent human papillomavirus type 18 enhancer elements in epithelial raft cultures of neonatal foreskin keratinocytes.
Cell Growth Differ.
8:751-762[Abstract].
|
| 45.
|
Phi-Van, L., and W. H. Strätling.
1988.
The matrix attachment regions of the chicken lysozyme gene co-map with the boundaries of the chromatin domain.
EMBO J.
7:655-664[Medline].
|
| 46.
|
Piirsoo, M.,
E. Ustav,
T. Mandel,
A. Stenlund, and M. Ustav.
1996.
Cis and trans requirements for stable episomal maintenance of the BPV-1 replicator.
EMBO J.
15:1-11[Medline].
|
| 47.
|
Pommier, Y.,
P. N. Cockerill,
K. W. Kohn, and W. T. Garrard.
1990.
Identification within the simian virus 40 genome of a chromosomal loop attachment site that contains topoisomerase II cleavage sites.
J. Virol.
64:419-423[Abstract/Free Full Text].
|
| 48.
|
Rohlfs, M.,
S. Winkenbach,
S. Meyer,
T. Rupp, and M. Dürst.
1991.
Viral transcription in human keratinocyte cell lines immortalized by human papillomavirus type 16.
Virology
183:331-342[Medline].
|
| 49.
|
Romig, H.,
F. O. Fackelmeyer,
A. Renz,
U. Ramsperger, and A. Richter.
1992.
Characterization of SAF-A, a novel nuclear DNA binding protein from HeLa cells with high affinity for nuclear matrix/scaffold attachment DNA elements.
EMBO J.
11:3431-3440[Medline].
|
| 50.
|
Rösl, F.,
W. Waldeck, and G. Sauer.
1983.
Isolation of episomal bovine papillomavirus chromatin and identification of a DNase I-hypersensitive region.
J. Virol.
46:567-574[Abstract/Free Full Text].
|
| 51.
|
Sander, M., and T. Hsieh.
1985.
Drosophila topoisomerase II double-strand cleavage: analysis of DNA sequence homology at the cleavage site.
Nucleic Acids Res.
13:1057-1072[Abstract/Free Full Text].
|
| 52.
|
Schaack, J.,
W. Y. Ho,
P. Freimuth, and T. Shenk.
1990.
Adenovirus terminal protein mediates both nuclear matrix association and efficient transcription of adenovirus DNA.
Genes Dev.
4:1197-1208[Abstract/Free Full Text].
|
| 53.
|
Schneider-Gädicke, A., and E. Schwarz.
1986.
Different human cervical carcinoma cell lines show similar transcription pattern of human papillomavirus type 18 early genes.
EMBO J.
5:2285-2292[Medline].
|
| 54.
|
Schwarz, E.,
U. K. Freese,
L. Gissmann,
W. Mayer,
B. Roggenbuck,
A. Stremlau, and H. zur Hausen.
1985.
Structure and transcription of human papillomavirus sequences in cervical carcinoma cells.
Nature
314:111-114[Medline].
|
| 55.
|
Singh, G. B.,
J. A. Kramer, and S. A. Krawetz.
1997.
Mathematical model to predict regions of chromatin attachment to the nuclear matrix.
Nucleic Acids Res.
25:1419-1425[Abstract/Free Full Text].
|
| 56.
|
Spitzner, J. R., and M. T. Muller.
1988.
A consensus sequence for cleavage by vertebrate DNA topoisomerase II.
Nucleic Acids Res.
16:5533-5556[Abstract/Free Full Text].
|
| 57.
|
Stief, A.,
D. M. Winter,
W. H. Stratling, and A. E. Sippel.
1989.
A nuclear DNA attachment element mediates elevated and position-independent gene activity.
Nature
341:343-345[Medline].
|
| 58.
| Tan, S. H., and H. U. Bernard.
Unpublished observations.
|
| 59.
|
van Driel, R.,
D. G. Wansink,
B. van Steensel,
M. A. Grande,
W. Schul, and L. de Jong.
1995.
Nuclear domains and the nuclear matrix.
Int. Rev. Cytol.
162A:151-189.
|
| 60.
|
Van Wijnen, A. J.,
J. P. Bidwell,
E. G. Fey,
S. Penman,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1993.
Nuclear matrix association of multiple sequence-specific DNA binding activities related to Sp1, ATF, CCAAT, C/EBP, Oct-1, and AP-1.
Biochemistry
32:8397-8402[Medline].
|
![[Feedback]](/icons/banner/feedbackACT.gif){kind=icon}
![[For Subscribers]](/icons/banner/subscriberACT.gif){kind=icon}
![[Archive]](/icons/banner/archiveACT.gif){kind=icon}
![[Search]](/icons/banner/searchACT.gif){kind=icon}
![[Contents]](/icons/banner/tocACT.gif){kind=icon}
Top
Abstract
Introduction
Present address: Department of Neurobiology and Behavior, Columbia
University, New York, NY 10032.
