Previous Article | Next Article 
J Virol, April 1998, p. 3442-3445, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Physiological Knockout of the Envelope Gene of the Single-Copy
ERV-3 Human Endogenous Retrovirus in a Fraction of the
Caucasian Population
Nathalie
de Parseval and
Thierry
Heidmann*
Unité des Rétrovirus
Endogènes et Eléments Retroïdes des Eucaryotes
Supérieurs, CNRS UMR 1573, Institut Gustave Roussy, 94805 Villejuif Cedex, France
Received 1 December 1997/Accepted 5 January 1998
 |
ABSTRACT |
ERV-3 is an evolutionarily conserved single-copy human endogenous
retrovirus with a coding envelope gene potentially involved in
important placental functions. We have investigated the sequence variability of this gene among 150 unrelated Caucasian individuals and
found eight polymorphic sites. One of them corresponds to the
introduction of a stop codon resulting in the production of a severely
truncated ERV-3 envelope protein lacking both the fusion peptide
and the immunosuppressive domain of the protein. The stop codon is
observed in a homozygous state in approximately 1%
of Caucasian individuals without evidence for counterselection,
thus precluding the involvement of any essential function of
the gene in placental implantation and development. This natural
knockout provides a mean to investigate other potential roles for this otherwise highly conserved gene.
 |
TEXT |
ERV-3 (HERV-R) is a single-copy
human endogenous retrovirus (reviewed in references 10,
16, and 18) that is present in the genomes
of all great apes and Old World monkeys and has also been identified in
the genome of one New World monkey (3, 11, 15). This
provirus, located close to the chromosome 7 centromere, comprises
gag, pol, and env genes bordered by 5'
and 3' long terminal repeats. The gag and pol
genes both contain in-frame termination codons, but the env
gene has an intact open reading frame capable of encoding a retroviral
envelope glycoprotein. This protein would comprise the surface unit
(SU) domain and a transmembrane (TM) moiety lacking a hydrophobic
domain (4). Envelope-associated mRNAs are expressed at
a low level in most human tissues and at a high level in placental
syncytiotrophoblastic cells (i.e., trophoblastic cells which have fused
to form a syncytial layer), in embryonic tissues such as the adrenal
glands and nervous tissues, in the fetal heart, in sebaceous glands,
and in some tumor cell lines and tissues (1, 2, 6, 8, 9).
Antibodies raised against part of the TM domain demonstrate expression
in the syncytiotrophoblast of a 65-kDa protein, as revealed by
immunofluorescence and by Western blot analyses (17).
The persistence of an open reading frame within a sequence present in
primates for more than 30 million years (3, 11, 15) strongly
suggests a biological function for this protein. Taking into account
established properties of retroviral envelopes, several hypotheses
(reviewed in reference 17) have been proposed. (i)
The ERV-3 envelope contains a putative immunosuppressive domain, whose
expression at the placental barrier could participate in protection of
the fetus from the maternal immune system. (ii) The fusion peptide
within the ERV-3 TM domain could be involved in cell fusion and
therefore participate in the formation of the syncytiotrophoblast,
where ERV-3 is specifically expressed. (iii) Expression of the ERV-3
envelope could prevent retroviral infections, through receptor
interference.
A way to evaluate the relevance of such hypotheses is to investigate
the possible existence of polymorphisms among individuals within the
ERV-3 envelope coding region. Polymorphisms have already been described
for the ERV-3 provirus, but in noncoding regions (13,
14). One is a restriction polymorphism located at the 3' end of
pol, revealed upon MspI digestion
(14), and eight other polymorphisms were identified in the
5' and 3' long terminal repeats, the linkage of which defined three
allelic forms of ERV-3 (13). In the present study, we found
that polymorphisms within the coding region of the ERV-3 envelope gene
do exist. We further found that one of them results in the introduction
of a stop codon, leading to the production of a severely
truncated ERV-3 glycoprotein. Screening of a large panel of
individuals shows that this knockout is present in a homozygous state
in approximately 1% of the Caucasian population.
Polymorphism within the env coding region.
The
entire ERV-3 envelope gene of five unrelated healthy Caucasian donors
was PCR amplified from genomic DNA by using the 5' S2 and the 3' AS
primers indicated in Fig. 1. A PCR was
carried out for 35 cycles (1 min at 94°C, 1 min at 60°C, 4 min at
72°C) with 50 ng of genomic DNA, 50 pmol of each PCR primer, 1.5 mM magnesium acetate, and 0.2 mM each deoxynucleoside triphosphate in 50 µl of PCR buffer (Perkin-Elmer Tth polymerase and buffer). Direct sequencing of the complete gene was performed with 200 ng of the
PCR product by using the set of primers shown in Fig. 1 and the Applied
Biosystems Taq DyeDeoxy Terminator Cycle Sequencing kit with
an ABI 373A sequencer (Perkin-Elmer). As illustrated in Fig. 1, single
nucleotide differences among the sequences from the five individuals
(i.e., polymorphic sites) were detected, clustered in two regions of
the gene. Comparison with the published ERV-3 sequence (4)
further revealed five differences common to the DNAs of all five
individuals, suggesting that they correspond to errors in the original
report rather than to polymorphisms (as confirmed below by partial
sequencing of 24 more individuals). Altogether, eight polymorphic sites
can therefore be defined, seven of which correspond to amino acid
substitutions (Table 1). Strikingly, one
of these substitutions (a C-to-T transition at position 1354) results
in the introduction of a stop codon, which very prematurely closes the
envelope reading frame. This was observed for one of the five
individuals (no. 618) in a heterozygous state. To analyze the actual
distribution of this unexpected polymorphism, we screened a much
larger panel of unrelated Caucasian individuals, including 23 additional healthy donors and 122 parents from the panel of the
Centre d'Etude du Polymorphisme Humain (CEPH). DNAs were amplified by
using the S3 and AS3 primers (Fig. 1) and slightly modified PCR
conditions (30 s at 94°C, 30 s at 60°C, 1 min at 72°C). As
the C
T transition results in the loss of a Bsp1286I site
(see Fig. 2A), 200 ng of the S3-AS3 amplimers was digested with
Bsp1286I and analyzed by agarose gel electrophoresis and ethidium bromide staining. Figure 2A
shows a series of 13 restriction patterns, disclosing one individual
with a T/T profile (lane 5), one with a C/T profile (lane 11), and the
others with a C/C profile. As the C
T transition also predicts the
gain of an NlaIII site, the C/T and T/T amplified fragments
were digested with NlaIII to confirm the allelic profile
(data not shown). Direct sequencing of the S3-AS3 amplimers was also
performed by using S3 as a sequencing primer for 29 individuals to
further verify the result of the restriction analysis. Chromatograms of
the three different allelic profiles at nucleotide 1354 are shown in
Fig. 2B for individual 1423.02 with a C/C profile, individual 13293.02 with a C/T profile, and individual 1463.02 with a T/T profile. The
consequence of this polymorphism for the encoded proteins was finally
assessed by a direct coupled transcription-translation assay performed on the DNA from individuals with the stop codon (together with control individuals) PCR amplified by using a T7 promoter and a Kozak
ATG-containing primer (T7atg 5' primer and AS 3' primer pair). PCR
amplification of the complete envelope gene was performed under the
same conditions as for the S2-AS primer pair. Two hundred nanograms of the amplification products was used, after ethanol precipitation, in the TNT Coupled Reticulocyte Lysate System (Promega) in accordance with the manufacturer's instructions, with
[3H]methionine (ICN) for protein labelling. After
electrophoresis of the translation products, the sodium dodecyl
sulfate-polyacrylamide gels were impregnated with
En3Hance (Dupont de Nemours), rinsed with water, dried, and
autoradiographed. As illustrated in Fig. 2C, sodium dodecyl
sulfate-polyacrylamide gel electrophoretic analysis of the
translational products for the three allelic profiles shows different
patterns, 62- and 25-kDa proteins for individual 13293.02, a single
62-kDa protein for individual 1423.02, and a truncated 25-kDa product
for individual 1463.02, as expected from the genotypes of these
individuals.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 1.
Identification of polymorphic sites within the sequences
of ERV-3 envelope genes from five unrelated individuals. The ERV-3
provirus with the envelope open reading frame (open rectangle) and its
expected functional domains, including the proteolytic cleavage site,
the fusion peptide, and the immunosuppressive domain, are schematically
represented at the top. The putative hydrophobic domain is shown in a
dotted rectangle as an extension of the open reading frame if the stop
codon at nucleotide 2500 is read through. The G insertion at position
796 (see Table 1) leads to an upstream shift in the frame, unlike that
of the previously published ERV-3 sequence, and introduces a potential
signal peptide and four new Met codons (represented by short vertical
lines). LTR, long terminal repeat; SD, splice donor site; SA, splice
acceptor site. The primers used in this study are indicated, and 5'-3'
sequences are given for S2 (CGGCCGAAGCTTGAGTCATCATCAGGG),
T7atg
(GCTAATACGACTCACTATAGGAACAGACCACCatgACTAAAACCCTGTTGTATCA),
S3 (AACCAACAATCACTAGGGCC), AS3
(TGCCCCTCCATAAAGTCTTTCCTAG), and AS
(GTTAATACTTAGTTAGGGCC). At the bottom, the envelope gene
sequences of five individuals and the corresponding polymorphic sites
within the ERV-3 consensus sequence are represented; both alleles for
each site are indicated. Numbers refer to the ERV-3 pol-env
published sequence (4; accession no. M12140).
|
|

View larger version (43K):
[in this window]
[in a new window]
|
FIG. 2.
(A) Expected Bsp1286I restriction map of the
ERV-3 S3-AS3 amplimer and restriction analysis of a series of 13 individuals. The arrows indicate the restriction fragments obtained
after electrophoresis in a 2% agarose gel. Molecular size markers are
shown on the right. (B) Nucleotide sequence analysis of PCR-amplified
genomic fragments from three individuals for the polymorphism at
nucleotide 1354. Lane numbers refer to those in A. (C) Direct in vitro
transcription-translation assay for ERV-3 envelope gene products from
the three individuals in B. The arrows indicate the translational
products after migration in a 14% polyacrylamide gel. The two ERV-3
envelope proteins obtained are represented, and the SU, the TM, the FP
(fusion peptide), and the ISU (immunosuppressive domain) are indicated.
SDS-PAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
|
|
Distribution of the stop codon among individuals.
As
summarized in Table 2, among the 150 individuals tested for the stop codon polymorphism, we detected C/C
homozygotes in 123 cases (82%) and C/T heterozygotes in 25 cases
(16.7%), and 2 individuals (1.3%) were homozygous for the stop codon
(T/T profile). The relative proportion of homozygotes and heterozygotes
for the stop codon is compatible with the Hardy-Weinberger equilibrium, suggesting that no counterselection is associated with the T/T genotype. This was further strengthened by the proportion of the T/T
genotype among the children from two parents of the CEPH panel that we
had identified as being both heterozygous for the stop polymorphism. As
illustrated in Fig. 3, determination of
the genotypes of the individuals of the corresponding family (including
four grandparents and seven children not included in the previous
analysis) showed that two children harbor the T/T genotype, one child
has the C/C genotype, and four children have the C/T genotype.
Altogether, these data strongly suggest that no essential function is
associated with the expression of the envelope protein. More
specifically, among the plausible roles that had been hypothesized for
the ERV-3 gene (see the introductory paragraph), those involving
immunosuppression at the placental barrier or differentiation of the
placental cells seem to be precluded by the existence of T/T
homozygotes at an expected frequency. Indeed, for those individuals,
fetal development must have been associated with a placenta expressing
a severely truncated ERV-3 envelope protein (the placenta is of fetal
origin and thus has the same T/T genotype), i.e., lacking both the
fusion peptide and the immunosuppressive domain of ERV-3. Thus, the
reasons for the conservation of the ERV-3 2-kb open reading frame are not to be found in a selective pressure imposed by essential
placental functions. It can be noted, in addition, that the two
individuals in the CEPH panel with a T/T genotype (a man and a woman)
were parents of 10 children each, also suggesting that the
ERV-3 knockout of one of the parents has no effect on procreative
function.

View larger version (11K):
[in this window]
[in a new window]
|
FIG. 3.
Pedigree of a CEPH family whose parents are heterozygous
for the stop mutation. Open symbols represent C/C homozygous
individuals; filled symbols represent T/T homozygous individuals, and
mixed symbols represent C/T heterozygous individuals. Squares, males;
circles, females.
|
|
Conclusion.
In this study, we have shown that the ERV-3
envelope gene is subject to important genetic variations among members
of the Caucasian population. Eight polymorphic sites have been found in
this gene, seven of which correspond to an amino acid change. One of
them introduces a stop codon, resulting in a physiological knockout of
the ERV-3 envelope in 1% of the Caucasian population. This already
permits rejection of previously proposed roles for this protein in
relation to essential functions in placental development. Yet, the
polymorphisms we describe here
which are superimposed on strong
sequence conservation of the gene in evolution (confirmed by partial
sequencing of the chimpanzee gene which discloses >99% homology at
the amino acid level in the regions of the two polymorphic clusters
[5a])
now provide a means to investigate other
possible roles for this conserved open reading frame. Among them,
involvement of the ERV-3 envelope as a protection against infectious
retroviruses remains plausible, all the more so as it would actually
impose only limited selective pressure among members of the human
population. Other plausible roles concern the involvement of this
protein in autoimmune diseases or cancer. Several lines of evidence
establish a correlation between expression of TM retroviral proteins by tumor cells and enhanced tumorigenicity (reviewed in reference 12), and it is tempting to speculate that
individuals homozygous for the truncated ERV-3 envelope protein might
be less prone to certain forms of cancer. A possible role for
endogenous retroviruses in autoimmune diseases has also been suggested
(7, 16) and was actually recently demonstrated in type I
diabetes (5). As far as ERV-3 is concerned, antibodies
against the TM protein of the envelope were found in patients with
Sjögren's syndrome and systemic lupus erythematosus at a
significantly higher level than in healthy donors (9), and
anti-ERV-3 TM antibodies are also elevated in pregnant women, the
highest level being detected in women whose babies are subject to
congenital heart block, suggesting a role of this protein in the
pathogenesis of this pregnancy-associated autoimmune disease
(9). These hypotheses can now be tested by examination of
the ERV-3 protein polymorphic sites identified here.
 |
ACKNOWLEDGMENTS |
We are grateful to the CEPH for access to their panel of
individuals, to J. Weissenbach and J. Feunteun for the gift of DNAs from healthy donors and helpful discussions, and to C. Lavialle for
critical reading of the manuscript.
This work was supported by the CNRS and by grants from the ARC
(contract 6552 awarded to T.H. and a fellowship awarded to N.P.) and
from the Ligue Nationale contre le Cancer.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité des
Rétrovirus Endogènes et Eléments Retroïdes
des Eucaryotes Supérieurs, CNRS UMR 1573, Institut Gustave
Roussy, 39, rue Camille Desmoulins, 94805 Villejuif Cedex, France.
E-mail: heidmann{at}igr.fr.
 |
REFERENCES |
| 1.
|
Andersson, A. C.,
M. Merza,
P. Venables,
F. Ponten,
J. Sundström,
M. Cohen, and E. Larsson.
1996.
Elevated levels of the endogenous retrovirus erv3 in human sebaceous glands.
J. Invest. Dermatol.
106:125-128[Medline].
|
| 2.
|
Boyd, M. T.,
C. M. Bax,
B. E. Bax,
D. L. Bloxam, and R. A. Weiss.
1993.
The human endogenous retrovirus ERV-3 is upregulated in differentiating placental trophoblast cells.
Virology
196:905-909[Medline].
|
| 3.
|
Cohen, M., and E. Larsson.
1988.
Human endogenous retroviruses.
Bioessays
9:191-196[Medline].
|
| 4.
|
Cohen, M.,
M. Powers,
C. O'Connell, and N. Kato.
1985.
The nucleotide sequence of the env gene from the human provirus erv3 and isolation and characterization of an erv3-specific cDNA.
Virology
147:449-458[Medline].
|
| 5.
|
Conrad, B.,
R. N. Weissmahr,
J. Böni,
R. Arcari,
J. Schüpbach, and B. Mach.
1997.
A human endogenous retroviral superantigen as candidate autoimmune gene in type I diabetes.
Cell
90:303-313[Medline].
|
| 5a.
| de Parseval, N. Unpublished data.
|
| 6.
|
Kato, N.,
E. Larsson, and M. Cohen.
1988.
Absence of expression of a human endogenous retrovirus is correlated with choriocarcinoma.
Int. J. Cancer
41:380-385[Medline].
|
| 7.
|
Krieg, A. M.,
M. F. Gourley, and A. Perl.
1992.
Endogenous retroviruses: potential etiologic agents in autoimmunity.
FASEB J.
6:2537-2544[Abstract].
|
| 8.
|
Larsson, E.,
A. C. Andersson, and B. O. Nilsson.
1994.
Expression of an endogenous retrovirus (erv3 HERV-R) in human reproductive and embryonic tissues evidence for a function for envelope gene products.
Ups. J. Med. Sci.
99:113-120[Medline].
|
| 9.
|
Li, J.-M.,
W. S. Fan,
A. C. Horsfall,
A. C. Anderson,
S. Rigby,
E. Larsson, and P. J. W. Venables.
1996.
The expression of human endogenous retrovirus-3 in fetal cardiac tissue and antibodies in congenital heart block.
Clin. Exp. Immunol.
104:388-393[Medline].
|
| 10.
|
Löwer, R.,
J. Löwer, and R. Kurth.
1996.
The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences.
Proc. Natl. Acad. Sci. USA
93:5177-5184[Abstract/Free Full Text].
|
| 11.
|
O'Connell, C.,
S. O'Brien,
W. G. Nash, and M. Cohen.
1984.
Erv3, a full length human endogenous provirus: chromosomal localization and evolutionary relationship.
Virology
138:225-235[Medline].
|
| 12.
|
Oostendorp, R. A. J.,
C. J. L. M. Meijer, and R. J. Scheper.
1993.
Immunosuppression by retroviral-envelope-related proteins, and their role in non-retroviral human disease.
Crit. Rev. Oncol. Hematol.
14:189-206[Medline].
|
| 13.
|
Rassmussen, H. B.,
A. Heltberg,
G. Lisby, and J. Clausen.
1996.
Three allelic forms of the human endogenous retrovirus erv3, and their frequencies in multiple sclerosis patients and healthy individuals.
Autoimmunity
23:111-117[Medline].
|
| 14.
| Rubin, L. A., K. A. Siminovitch, M. H. Shi, and M. Cohen. 1991. A novel retroviral gene association with
rheumatoid arthritis. Arthritis Rheum.
34(Suppl.):S60.
|
| 15.
|
Shih, A.,
E. Coutavas, and M. G. Rush.
1991.
Evolutionary implications of primate endogenous retroviruses.
Virology
182:495-502[Medline].
|
| 16.
|
Urnovitz, H. B., and W. H. Murphy.
1996.
Human endogenous retroviruses: nature, occurrence, and clinical implications in human disease.
Clin. Microbiol. Rev.
9:72-99[Abstract].
|
| 17.
|
Venables, S.,
M. Brookes,
W. Fan,
E. Larsson,
R. N. Maini, and M. T. Boyd.
1995.
Abundance of an endogenous retroviral envelope protein in placental trophoblast suggests a biological function.
Virology
211:589-592[Medline].
|
| 18.
|
Wilkinson, D. A.,
D. L. Mager, and J.-A. C. Leong.
1994.
Endogenous human retroviruses, 465-535.. In
J. A. Levy (ed.), The Retroviridae.
Plenum Press, New York, N.Y.
|
J Virol, April 1998, p. 3442-3445, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sugimoto, J., Schust, D. J.
(2009). Review: Human Endogenous Retroviruses and the Placenta. Reproductive Sciences
16: 1023-1033
[Abstract]
-
Ryan, F. P
(2009). An alternative approach to medical genetics based on modern evolutionary biology. Part 2: retroviral symbiosis. JRSM
102: 324-331
[Full Text]
-
Stoye, J. P.
(2009). Proviral protein provides placental function. Proc. Natl. Acad. Sci. USA
106: 11827-11828
[Full Text]
-
Mangeney, M., Renard, M., Schlecht-Louf, G., Bouallaga, I., Heidmann, O., Letzelter, C., Richaud, A., Ducos, B., Heidmann, T.
(2007). Placental syncytins: Genetic disjunction between the fusogenic and immunosuppressive activity of retroviral envelope proteins. Proc. Natl. Acad. Sci. USA
104: 20534-20539
[Abstract]
[Full Text]
-
Caceres, M., NISC Comparative Sequencing Program, , Thomas, J. W.
(2006). The Gene of Retroviral Origin Syncytin 1 is Specific to Hominoids and is Inactive in Old World Monkeys. J Hered
97: 100-106
[Abstract]
[Full Text]
-
Andersson, A.-C., Yun, Z., Sperber, G. O., Larsson, E., Blomberg, J.
(2005). ERV3 and Related Sequences in Humans: Structure and RNA Expression. J. Virol.
79: 9270-9284
[Abstract]
[Full Text]
-
Ryan, F. P
(2004). Human endogenous retroviruses in health and disease: a symbiotic perspective. JRSM
97: 560-565
[Full Text]
-
Blaise, S., de Parseval, N., Benit, L., Heidmann, T.
(2003). Genomewide screening for fusogenic human endogenous retrovirus envelopes identifies syncytin 2, a gene conserved on primate evolution. Proc. Natl. Acad. Sci. USA
100: 13013-13018
[Abstract]
[Full Text]
-
de Parseval, N., Lazar, V., Casella, J.-F., Benit, L., Heidmann, T.
(2003). Survey of Human Genes of Retroviral Origin: Identification and Transcriptome of the Genes with Coding Capacity for Complete Envelope Proteins. J. Virol.
77: 10414-10422
[Abstract]
[Full Text]
-
Frendo, J.-L., Olivier, D., Cheynet, V., Blond, J.-L., Bouton, O., Vidaud, M., Rabreau, M., Evain-Brion, D., Mallet, F.
(2003). Direct Involvement of HERV-W Env Glycoprotein in Human Trophoblast Cell Fusion and Differentiation. Mol. Cell. Biol.
23: 3566-3574
[Abstract]
[Full Text]
-
Mangeney, M., de Parseval, N., Thomas, G., Heidmann, T.
(2001). The full-length envelope of an HERV-H human endogenous retrovirus has immunosuppressive properties. J. Gen. Virol.
82: 2515-2518
[Abstract]
[Full Text]
-
Czauderna, F., Fischer, N., Boller, K., Kurth, R., Tönjes, R. R.
(2000). Establishment and Characterization of Molecular Clones of Porcine Endogenous Retroviruses Replicating on Human Cells. J. Virol.
74: 4028-4038
[Abstract]
[Full Text]
-
Blond, J.-L., Lavillette, D., Cheynet, V., Bouton, O., Oriol, G., Chapel-Fernandes, S., Mandrand, B., Mallet, F., Cosset, F.-L.
(2000). An Envelope Glycoprotein of the Human Endogenous Retrovirus HERV-W Is Expressed in the Human Placenta and Fuses Cells Expressing the Type D Mammalian Retrovirus Receptor. J. Virol.
74: 3321-3329
[Abstract]
[Full Text]