Previous Article | Next Article 
J Virol, April 1998, p. 3418-3422, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Virological and Molecular Demonstration of Human Immunodeficiency
Virus Type 2 Vertical Transmission
Patricia
Cavaco-Silva,1,*
Nuno C.
Taveira,1
Lino
Rosado,2
Maria H.
Lourenço,1
José
Moniz-Pereira,1
Nigel W.
Douglas,3
Rod S.
Daniels,3 and
Maria O.
Santos-Ferreira1
Departamento de Microbiologia, Faculdade de
Farmácia, Universidade de Lisboa, 1600 Lisbon,1 and
Hospital Dona
Estefânia, 1150 Lisbon,2 Portugal, and
National Institute for Medical Research, Mill Hill, London
NW7 1AA, United Kingdom3
Received 3 March 1997/Accepted 12 January 1998
 |
ABSTRACT |
To demonstrate that human immunodeficiency virus type 2 (HIV-2)
mother-to-child transmission exists, HIV-2 isolates were obtained from
both an asymptomatic mother (HIV-2 strain ARM), and her child (HIV-2
strain SAR), who had a diagnosis of AIDS. To determine their biological
phenotype, primary isolates were used to infect various primary
mononuclear cells and cell lines. HIV-2 ARM replicates in primary cells
and Jurkat-tat, while HIV-2 SAR infects these cells plus SupT1, which led us to classify HIV-2 ARM as a slow/low virus and HIV-2 SAR as having an intermediate (slow/low-3) phenotype. Molecular analysis of the env region corresponding to
gp125 was performed. Viral DNA was cloned, sequenced, and used to
construct phylogenetic trees. The DNA sequence analysis demonstrated an overall nucleotide diversity of 7.6%. The results present evidence that the child's strain is more virulent than the mother's strain, which is in agreement with the immunodeficiency of the child. The
phylogenetic trees that were constructed demonstrate that the two
isolates cluster together, being closer to each other than to any other
isolate described until now.
| |
TEXT |
Heterosexual transmission is
responsible for the majority of infections with human immunodeficiency
virus (HIV), leading to the probability of perinatally acquired HIV
infection (25). Although vertical transmission of HIV type 1 (HIV-1) is well documented (33), studies of HIV-2 vertical
transmission have been much more limited, probably because of the later
recognition of this second type of virus (7) and its more
limited geographic distribution, mainly in West Africa (14).
In Europe, reported cases of HIV-2 infection are rare, Portugal having
the highest incidence, 5.7% of all HIV infections (19).
First studies conducted in West Africa suggested that mother-to-child
transmission of HIV-2 could be absent (3, 26). However,
there is virological evidence suggesting that HIV-2 perinatal
transmission may occur (8). Cross-sectional serological and
clinical surveys have also demonstrated that pediatric HIV-2 infection
seems to be extremely rare (11, 20). Recent epidemiological
studies have confirmed that although HIV-2 vertical transmission
exists, it is uncommon compared to that of HIV-1 (1, 8).
A HIV-2 vertical transmission study, in which a total of 47 children
born to HIV-2-seropositive mothers are enrolled, has been conducted at
Lisbon's pediatric hospital. Here we report for the first time the
isolation and characterization, on the biological and molecular levels,
of two HIV-2 strains isolated from a mother-to-child transmission pair
enrolled in this study in which perinatal transmission occurred.
The mother (infected with HIV-2 strain ARM), a 35-year-old female
from Guinea-Bissau resident in Portugal since 1988, was probably
infected by heterosexual contact, for there is no history of blood
transfusion or drug addiction. She was diagnosed with HIV-2 infection
during the second trimester of pregnancy and remained asymptomatic
throughout gestation. The female child (infected with HIV-2 strain
SAR), was born on 10/22/1992 in a Maternity Hospital in Lisbon by
vaginal delivery and was bottle fed. At birth, neurological examination
of the child was normal and there were no malformations. At 50 days of
life, failure to thrive and increasing irritability were noted. Before
3 months of age, AIDS category C2 (6) was diagnosed
when the child had Pneumocystis carinii pneumonia and
serious HIV encephalopathy. The total lymphocyte count was
2,930/mm3, the CD4 count was 860/mm3 (29%),
and the CD8 count was 470/mm3 (16%). Zidovudine
therapy was started at 3 months of age.
Patients were tested by HIV-1 and HIV-2 enzyme-linked immunosorbent
assays with confirmation by Western blot and synthetic peptide assays
(ELAVIA I/II, NEW LAV-BLOT I/II, and Pepti LAV 1-2, all from
Diagnostics Pasteur). Mother and infant sera reacted strongly in the
enzyme-linked immunosorbent assay for HIV-2 and showed a complete
reactivity profile for HIV-2 proteins on a Western blot. The Pepti LAV
1-2 analysis confirmed the HIV-2 seroreactivities (data not
shown).
The fact that the mother described in our study is asymptomatic is
interesting, for in other reports describing HIV-2 perinatal transmission, except in one epidemiological study (11), the majority of the mothers are symptomatic. To our knowledge, this is also
the first case showing that neurological disease can be associated with
an HIV-2-infected infant with a very early onset of symptoms. Other
reports of HIV-2-related symptoms in pediatric populations have
involved much older children, aged 20 months or more (17,
20).
Correlation of viral phenotype with clinical status and
transmission.
Peripheral blood was collected from both
subjects on the 27th day after delivery. Follow-up child samples were
also obtained at ages of 5, 8, and 12 months. Peripheral blood
mononuclear cells (PBMC) were cocultured with
phytohemagglutinin-stimulated PBMC from healthy blood donors and
monitored by reverse transcriptase (RT) activity (13) and
syncytium formation assays every 3 to 4 days. Peak RT activity was
reached very rapidly, i.e., day 4 of culture for HIV-2 SAR and day 6 for HIV-2 ARM, with values of 35,000 and 15,000 cpm/ml, respectively;
no visible cytopathic effects were seen. Virus isolation was achieved
for all samples obtained from the infant, which fulfills the criteria
of HIV diagnosis in children born to HIV-seropositive mothers
(6).
Virus tropism/phenotype studies were done by infecting a
variety of primary cells and cell lines: CEM, Hut78, SupT1,
Jurkat-tat, and U-937, an established monocytic cell
line. Monocyte-derived macrophages (MDM) were prepared
from phytohemagglutinin-stimulated PBMC by a modification of the
plastic adherence technique (10), and peripheral blood
lymphocytes (PBL), a T-lymphocyte-enriched cell fraction,
were obtained as the resultant nonadherent fraction. Both isolates
replicated well in PBMC and PBL, showing formation of a few small
syncytia, but failed to do so in MDM (Table
1). Of the established cell lines, only
Jurkat-tat and SupT1 were susceptible to infection. HIV-2
SAR Jurkat-tat cultures yielded a very high RT titer (6 × 106 cpm/ml), exhibiting extensive cytopathic effects,
such as ballooning degeneration and large syncytia; on the other hand,
HIV-2 SAR also infected SupT1 cells but gave significantly lower RT
yields and no syncytia were observed. The only cell line that HIV-2 ARM could infect, but without visible cytopathic effects, was
Jurkat-tat (RT titer of 1.5 × 106 cpm/ml),
which is unique, as it allows the replication of most poorly
replicating viruses (4). With these characteristics, the
mother's virus, HIV-2 ARM, can be classified as belonging to the
slow/low or non-syncytium-inducing type (9), suggesting that
this type of virus can be involved in HIV-2 vertical transmission, and
HIV-2 SAR can be classified as an intermediate (slow/low-3 or
syncytium-inducing [SI]) variant. Therefore, no apparent correlation seems to exist between syncytium induction and vertical transmission of
HIV-2, which is in agreement with the results of other studies regarding HIV-1 phenotype and the increased risk of vertical
transmission (15). The finding that the mother's slow/low
variant gave rise to an intermediate virus in the child is also
uncommon. Scarlatti and coworkers (27) described the
contrary: mothers with rapid/high viruses transmitted slow/low variants
to their children, but mothers with slow/low viruses only transmitted
viruses of the same phenotype. The possible selection of an
intermediate SI variant could be a sign of transmission upon delivery,
for transmission during gestation implies passage of the virus through
the placenta, which is enriched in macrophages that might select
against SI variants which replicate poorly in MDM (28).
Selective tropism for macrophages might be an important factor in
transmission of HIV via transplacental infection (18). A
more recent report stated that all primary isolates from transmitting
mothers and their infants replicated in MDM (24), while
others have presented evidence that the ability of HIV to replicate
efficiently in PBMC and infect human T-cell lines is associated with
transmission from mother to child (15, 27). Our results are
in agreement with the findings of the latter studies, for neither the
mother's nor the infant's virus productively infected MDM. On the
other hand, it is possible that due to the immunosuppression present in
the child, an SI variant that could have represented a minor phenotype
in the mother emerged, becoming the predominant one in the child.
The phenotypes of the mother's and child's viruses correlate with
their respective disease statuses and support reports associating more-virulent SI strains with quicker progression to AIDS in both HIV-1- and HIV-2-infected individuals (2, 31).
To analyze the size and antigenic reactivity profiles of viral
proteins, radioimmunoprecipitation-polyacrylamide gel
electrophoretic
assays were performed with anti-HIV-1 and anti-HIV-2
human serum
pools and cells infected with HIV-2 strains ARM, SAR, and
ROD.
For HIV-2 strains ARM and SAR,
env gene-encoded
glycoproteins
gp140, gp125, and gp41 were detected with human
anti-HIV-2 serum,
as were
gag-encoded proteins p55 and p26.
The molecular weights
of the HIV-2 strain ARM and SAR proteins were
similar to each
other and also to those of HIV-2 strain ROD proteins
(results
not shown).
Molecular analysis of HIV-2 env gene fragments derived
from the mother-infant pair.
To characterize HIV-2 strains ARM and
SAR at the genetic level, a nested PCR technique was used to amplify a
region of approximately 1,150 bp situated in the env gene
region encoding the carboxy-terminal part of V1 up to and including the
C5 region of gp125. The first round of amplification was
performed with previously described primers A1 and NT5
(30). The nested primers were PAT2
(CTGT TGGAATTCAACCCAAGAACCCTAGCAC) and PAT1 (CCATGCGCGTCGACAGACAAACTGCTCAGGA) (positions 6579 to 6610 and 7719 to 7689, respectively in HIV-2 ROD), containing EcoRI and SalI restriction sites
(underlined nucleotides). These fragments were cloned into M13
mp18/mp19 vectors and sequenced by using the gene-walking method.
Figure
1 gives alignments of the
nucleotide and translation products for HIV-2 strains ARM and SAR with
prototype HIV-2 strain
ROD. The percentage of nucleotide diversity
between ARM and SAR
over the sequenced region was 7.6%. This
translates into 89% sequence
homology at the amino acid level, which
is 2.4 to 2.9% higher
than that for the most closely related HIV-2
CBL23 glycoprotein
and at least 11% higher than that for the HIV-2B
and simian immunodeficiency
virus (SIV) sequences in the database
(
22). In common with other
HIV-2 isolates, the glycoproteins
of HIV-2 ARM and SAR show alternating
variable and constant domains
organized around a conserved core
of 16 cysteine residues over the
region analyzed (
22). Both
sequences contain 19 potential
N-linked glycosylation sites, 16
of which are conserved in position and
2 of which are shifted
by one or two amino acids, and ARM contains one
at residue 31
while SAR has one at residue 107 (Fig.
1). Notably, both
viruses
lack the glycosylation site (marked in Fig.
1) at the start of
the CD4-binding domain, which is conserved in all other HIV-2A
isolates
reported to date (
22). The absence of this glycosylation
site is unusual and may be of some importance, as its removal
has been
associated with a decrease in the CD4-binding capacity
of gp125
(
21).
View larger version (41K):
[in this window]
[in a new window]
|
FIG. 1.
Alignment of HIV-2 strain ARM, SAR, and ROD nucleotide
and translation product sequences spanning the gp125 region. For the
nucleotide sequences, dashes indicate gaps introduced to improve the
alignment, dots show agreement with the ARM sequence, and the letter n
represents nucleotides not resolved in the SAR sequence. For amino acid
alignments, residues which differ from the ARM sequence are shown,
dashes mark deletions compared to the ARM sequence, and X indicates an
amino acid that cannot be assigned in the SAR translation. The
locations of asparagine residues (N) which form part of a potential
N-linked glycosylation sequon are in boldface type, and $ marks the
position of the deleted sequon in the ARM and SAR sequences. The
positions of conserved cysteines are indicated (asterisks), as are the
locations of the variable domains (V1 to V5) and the cleavage site
between gp125 and gp41 ( ).
|
|
Overall, compared to isolate-specific and consensus sequences in the
database (
22), HIV-2 ARM and SAR show unusually long
V2
regions (17 and 18 amino acids, respectively, between the demarking
cysteines), which strengthen their close epidemiological relationship,
and high levels of nonconservative amino acid substitutions (73%
for
HIV-2 ARM and 56% for HIV-2 SAR).
In the
env gene, it has been shown that there is a
divergence of 0.5 to 10% within mother-infant pairs while the
divergence
is higher in unlinked pairs at 8 to 20% (
16).
HIV-1 sequences
of epidemiologically unlinked mothers and infants have
been reported
to differ by 10 to 17.3% in the V3 loop region and by
0.5 to 6.1%
for epidemiologically linked pairs (
32); in the
case reported
here, the two viruses present a total divergence of 7.6%
and the
V3 sequences differ by 2.9%, both values which are typical of
epidemiologically linked individuals.
To determine the evolutionary relationships of the newly identified
HIV-2 isolates, phylogenetic trees were constructed. Within
the genetic
data environment (
29), the ARM and SAR
env gene
translation products were aligned with those of HIV-2 and SIV,
as
reported in the Los Alamos database (
22), by using CLUSTAL
V
(
12). The nucleotide sequences of all of the viruses were
then aligned on the basis of this protein alignment. Positions
in the
alignment where gaps had been introduced were cut out,
as were
positions where ambiguous nucleotides occurred. On the
basis of an
alignment of the
env nucleotide sequences, phylogenetic
analysis was performed on the resultant nucleic acid alignments
by the
maximum-likelihood method by using the program fastDNAml
(
23). As shown in Fig.
2, the
viruses from the mother and infant
cluster together, being more related
to each other than to any
of the other viruses described to date. They
also belong to subtype
A, which is the predominant HIV-2 subtype in
Guinea-Bissau (
5)
and worldwide (
22).
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 2.
Phylogenetic relationships of HIV-2 strains ARM and SAR
to other HIV-2 and SIV strains. The highest-likelihood tree is shown
for alignments based on the coding regions spanning V2 to the carboxy
terminus of gp120, encompassing 973 nucleotides of HIV-2 and SIV. One
hundred unrooted trees were generated. The scale bar represents 10 substitutions per 100 nucleotides.
|
|
Our findings, linked to the first well-documented case of
mother-to-child HIV-2 transmission, support the importance of the
study
of these viruses and their implications for HIV infection
generally.
From the characteristics of the case described here,
it seems
reasonable to suggest that the properties of the transmitted
virus are
crucial for efficient transmission. The intermediate
phenotype of HIV-2
strain ARM that gave rise to more-virulent
strain SAR in the infant
might explain why there was efficient
transmission in the case studied
here. Further studies are needed
to understand better the mechanisms of
HIV-2 vertical transmission,
why it occurs so rarely, and what its
consequences are for infant
survival.
Nucleotide sequence accession numbers.
The nucleotide
sequences corresponding to the partial envelope sequences of HIV-2
strains ARM and SAR have been submitted to the GenBank database and
assigned accession no. AJ001162 and AJ001163, respectively.
| |
ACKNOWLEDGMENTS |
Patricia Cavaco-Silva is on a grant from Junta Nacional de
Investigação Científica e Tecnológica. This
work was supported in part by Comissão Nacional de Luta contra a
SIDA (Portuguese Ministry of Health).
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Departamento de
Microbiologia, Faculdade de Farmácia de Lisboa, Av. das
Forças Armadas, 1600 Lisboa, Portugal. Phone: 351-1-7946442. Fax:
351-1-7934212. E-mail: mhlourenco{at}ff.ul.pt.
| |
REFERENCES |
| 1.
|
Adjorlolo-Johnson, G.,
K. M. De Cock,
E. Ekpini,
K. M. Vetter,
T. Sibailly,
K. Brattegaard,
D. Yavo,
R. Doorly,
J. P. Whitaker,
L. Kestens,
C. Y. Ou,
J. R. George, and H. D. Gayle.
1994.
Prospective comparison of mother-to-child transmission of HIV-1 and HIV-2 in Abidjan, Ivory Coast.
JAMA
272:462-466[Abstract/Free Full Text].
|
| 2.
|
Albert, J.,
A. Nauclér,
B. Böttiger,
P. A. Broliden,
P. Albino,
S. A. Ouattara,
C. Björkegren,
A. Valentin,
G. Biberfeld, and E. M. Fenyö.
1990.
Replicate capacity of HIV-2, like HIV-1, correlates with severity of immunodeficiency.
AIDS
4:291-295[Medline].
|
| 3.
|
Andreasson, P. A.,
F. Dias,
A. Nauclér,
S. Andersson, and G. Biberfeld.
1993.
A prospective study of vertical transmission of HIV-2 in Bissau, Guinea-Bissau.
AIDS
7:989-993[Medline].
|
| 4.
|
Asjö, B.,
J. Albert,
F. Chiodi, and E. M. Fenyö.
1988.
Improved tissue culture technique for production of poorly replicating human immunodeficiency virus isolates.
J. Virol. Methods
19:191-196[Medline].
|
| 5.
|
Boeri, E.,
A. Giri,
F. Lillo,
G. Ferrari,
O. E. Varnier,
A. Ferro,
S. Sabbatani,
W. C. Saxinger, and G. Franchini.
1992.
In vivo genetic variability of the human immunodeficiency virus type 2 V3 region.
J. Virol.
66:4546-4550[Abstract/Free Full Text].
|
| 6.
|
Centers for Disease Control and Prevention.
1994.
Revised classification system for human immunodeficiency virus infection in children less than 13 years of age 1994.
Morbid. Mortal. Weekly Rep.
43:1-10.
|
| 7.
|
Clavel, F.,
D. Guétard,
F. Brun-Vézinet,
S. Chamaret,
M.-A. Rey,
M. O. Santos-Ferreira,
A. G. Laurent,
C. Dauguet,
C. Katlama,
C. Rouzioux,
D. Klatzmann,
J. L. Champalimaud, and L. Montagnier.
1986.
Isolation of a new human retrovirus from West African patients with AIDS.
Science
233:343-346[Abstract/Free Full Text].
|
| 8.
|
De Cock, K. M.,
F. Zadi,
G. Adjorlolo,
M. O. Diallo,
M. Sassa-Morokro,
E. Ekpini,
T. Sibailly,
R. Doorly,
V. Batter,
K. Brattegaard, and H. Gayle.
1994.
Retrospective study of maternal HIV-1 and HIV-2 infections and child survival in Abidjan, Côte d'Ivoire.
Br. Med. J.
308:441-443[Abstract/Free Full Text].
|
| 9.
|
Fenyö, E. M.,
L. Morfeldt-Manson,
F. Chiodi,
A. Lind,
A. Von Gegerfelt,
J. Albert,
E. Olausson, and B. Asjö.
1988.
Distinct replicative and cytopathic characteristics of human immunodeficiency virus isolates.
J. Virol.
62:4414-4419[Abstract/Free Full Text].
|
| 10.
|
Gartner, S.,
P. Markovits,
D. M. Markowitz,
M. H. Kaplan,
R. C. Gallo, and M. Popovic.
1986.
The role of mononuclear phagocytes in HTLV-III/LAV infection.
Science
233:215-219[Abstract/Free Full Text].
|
| 11.
|
Gayle, H. D.,
E. Gnaore,
G. Adjorlolo,
E. Ekpini,
R. Coulibaly,
A. Porter,
M. M. Braun,
M. L. K. Zabban,
J. Andou,
A. Timite,
J. Assi-Adou, and K. M. DeCock.
1992.
HIV-1 and HIV-2 infection in children in Abidjan, Côte d'Ivoire.
J. Acquired Immune Defic. Syndr.
5:513-517.
|
| 12.
|
Higgins, D. G., and P. M. Sharp.
1988.
CLUSTAL: a package for performing multiple sequence alignment on a microcomputer.
Gene
73:237-244[Medline].
|
| 13.
|
Hoffman, A. D.,
B. Banapour, and J. A. Levy.
1985.
Characterization of the AIDS-associated retrovirus reverse transcriptase and optimal conditions for its detection in virions.
Virology
147:326-335[Medline].
|
| 14.
| Kanki, P. J., and K. M. De Cock. 1994. Epidemiology and natural history of HIV-2. AIDS 8(Suppl.
1):s85-s93.
|
| 15.
|
Kliks, S. C.,
D. W. Wara,
D. V. Landers, and J. A. Levy.
1994.
Features of HIV-1 that could influence maternal-child transmission.
JAMA
272:467-474[Abstract/Free Full Text].
|
| 16.
|
Learn, G. H.,
B. T. M. Korber,
B. Foley,
B. H. Hahn,
S. M. Wolinsky, and J. M. Mullins.
1996.
Maintaining the integrity of human immunodeficiency virus sequence databases.
J. Virol.
70:5720-5730[Abstract/Free Full Text].
|
| 17.
|
Matheron, S.,
C. Courpotin,
F. Simon,
H. DiMaria,
H. Balloul,
S. Bartzack,
D. Dormont,
F. Brun-Vézinet,
A. G. Saimot, and J. P. Coulaud.
1990.
Vertical transmission of HIV-2.
Lancet
335:1103-1104[Medline].
|
| 18.
|
McGann, K. A.,
R. Collman,
D. L. Kolson,
F. Gonzalez-Scarano,
G. Coukos,
C. Coutifaris,
J. F. Strauss, and N. Nathanson.
1994.
Human immunodeficiency virus type 1 causes productive infection of macrophages in primary placental cell cultures.
J. Infect. Dis.
169:746-753[Medline].
|
| 19.
|
Ministério da Saúde, Portugal.
1997.
.
SIDA: situação em Portugal. Boletim Epidemiológico da C. N. L. C. S. 97, Março, 31.
Ministério da Saúde, Lisbon, Portugal.
|
| 20.
|
Morgan, G.,
H. A. Wilkins,
J. Pepin,
O. Jobe,
D. Brewster, and H. Whittle.
1990.
AIDS following mother-to-child transmission of HIV-2.
AIDS
4:879-882[Medline].
|
| 21.
|
Morikawa, Y.,
J. P. Moore,
A. J. Wilkinson, and I. M. Jones.
1991.
Reduction in CD4 binding affinity associated with removal of a single glycosylation site in the external glycoprotein of HIV-2.
Virology
180:853-856[Medline].
|
| 22.
|
Myers, G.,
B. Korber,
R. F. Smith,
J. A. Berzosfsky, and G. N. Pavlakis.
1994.
.
Human retroviruses and AIDS 1994: a compilation and analysis of nucleic acid and amino acid sequences.
Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, Los Alamos, N.Mex.
|
| 23.
|
Olsen, G. J.,
H. Matsuda,
R. Hagstrom, and R. Overbeek.
1994.
fastDNAml, a tool for construction of phylogenetic trees of DNA sequences using maximum likelihood.
Comput. Appl. Biosci.
10:41-48[Abstract/Free Full Text].
|
| 24.
|
Ometto, L.,
C. Zanotto,
A. Maccabruni,
D. Caselli,
D. Truscia,
C. Giaquinto,
E. Ruga,
L. Chieco-Bianchi, and A. De Rossi.
1995.
Viral phenotype and host-cell susceptibility to HIV-1 infection as risk factors for mother-to-child HIV-1 transmission.
AIDS
9:427-434[Medline].
|
| 25.
|
Peckam, C., and D. Gibb.
1995.
Mother-to-child transmission of the human immunodeficiency virus.
N. Engl. J. Med.
333:298-302[Free Full Text].
|
| 26.
|
Poulsen, A. G.,
B. B. Kvinesdal,
P. Aaby,
I. M. Lisse,
A. Gottschau,
K. Molbak,
F. Dias, and E. Lauritzen.
1992.
Lack of evidence of vertical transmission of human immunodeficiency virus type 2 in a sample of the general population in Bissau.
J. Acquired Immune Defic. Syndr.
5:25-30.
|
| 27.
|
Scarlatti, G.,
V. Hodara,
P. Rossi,
L. Muggiasca,
A. Bucceri,
J. Albert, and E. M. Fenyö.
1993.
Transmission of human immunodeficiency virus type 1 (HIV-1) from mother to child correlates with viral phenotype.
Virology
197:624-629[Medline].
|
| 28.
|
Schuitmaker, H.,
N. A. Koostra,
R. E. Y. de Goede,
F. De Wolf,
F. Miedema, and M. Tersmette.
1991.
Monocytotropic human immunodeficiency virus type 1 (HIV-1) variants detectable in all stages of HIV-1 infection lack T-cell line tropism and syncytium-inducing ability in primary T-cell culture.
J. Virol.
65:356-363[Abstract/Free Full Text].
|
| 29.
|
Smith, S. W.,
R. Overbeek,
C. R. Woese,
W. Gilbert, and P. M. Gillevet.
1994.
The genetic data environment an expandable GUI for multiple sequence analysis.
Comput. Appl. Biosci.
10:671-675[Abstract/Free Full Text].
|
| 30.
|
Taveira, N. C.,
F. Bex,
A. Burny,
P. M. Sharp,
M. O. Santos-Ferreira, and J. Moniz-Pereira.
1994.
Molecular characterization of the env gene from a non-syncytium-inducing HIV-2 isolate (HIV-2 ALI).
AIDS Res. Hum. Retroviruses
10:223-224[Medline].
|
| 31.
|
Tersmette, M.,
R. E. Y. De Goede,
B. J. Al,
I. Winkel,
B. Gruters,
H. T. Cuypers,
H. G. Huisman, and F. Miedema.
1988.
Differential syncytium-inducing capacity of human immunodeficiency virus isolates: frequent detection of syncytium-inducing isolates in patients with acquired immunodeficiency syndrome (AIDS) and AIDS-related complex.
J. Virol.
62:2026-2032[Abstract/Free Full Text].
|
| 32.
|
Wolinsky, S. M.,
C. M. Wike,
B. T. M. Korber,
C. Hutto,
W. P. Parks,
L. L. Rosenblum,
K. J. Kunstman,
M. R. Furtado, and J. L. Muñoz.
1992.
Selective transmission of human immunodeficiency virus type-1 variants from mothers to infants.
Science
255:1134-1137[Abstract/Free Full Text].
|
| 33.
|
Working Group on Mother-to-Child Transmission of HIV.
1995.
Rates of mother-to-child transmission of HIV-1 in Africa, America, and Europe: results from 13 perinatal studies.
J. Acquired Immune Defic. Syndr.
8:506-510.
|
J Virol, April 1998, p. 3418-3422, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Arien, K. K., Abraha, A., Quinones-Mateu, M. E., Kestens, L., Vanham, G., Arts, E. J.
(2005). The Replicative Fitness of Primary Human Immunodeficiency Virus Type 1 (HIV-1) Group M, HIV-1 Group O, and HIV-2 Isolates. J. Virol.
79: 8979-8990
[Abstract]
[Full Text]
-
Reeves, J. D., Doms, R. W.
(2002). Human immunodeficiency virus type 2. J. Gen. Virol.
83: 1253-1265
[Full Text]
-
Gomes, P., Taveira, N. C., Pereira, J. M., Antunes, F., Ferreira, M. O. S., Lourenço, M. H.
(1999). Quantitation of Human Immunodeficiency Virus Type 2 DNA in Peripheral Blood Mononuclear Cells by Using a Quantitative-Competitive PCR Assay. J. Clin. Microbiol.
37: 453-456
[Abstract]
[Full Text]
-
Zhang, Y.-j., Dragic, T., Cao, Y., Kostrikis, L., Kwon, D. S., Littman, D. R., KewalRamani, V. N., Moore, J. P.
(1998). Use of Coreceptors Other Than CCR5 by Non-Syncytium-Inducing Adult and Pediatric Isolates of Human Immunodeficiency Virus Type 1 Is Rare In Vitro. J. Virol.
72: 9337-9344
[Abstract]
[Full Text]
Top
Abstract
Text
