Previous Article | Next Article 
J Virol, April 1998, p. 3401-3406, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molluscum Contagiosum Virus Topoisomerase:
Purification, Activities, and Response to Inhibitors
Young
Hwang,
Beibei
Wang, and
Frederic D.
Bushman*
The Salk Institute for Biological Studies, La
Jolla, California 92037
Received 22 October 1997/Accepted 17 December 1997
 |
ABSTRACT |
Molluscum contagiosum virus (MCV), the only member of the
Molluscipoxvirus genus, causes benign papules in healthy
people but disfiguring lesions in immunocompromised patients. The
sequence of MCV has been completed, revealing that MCV encodes a
probable type I topoisomerase enzyme. All poxviruses sequenced to date also encode type I topoisomerases, and in the case of vaccinia virus
the topoisomerase has been shown to be essential for replication. Thus,
inhibitors of the MCV topoisomerase might be useful as antiviral agents. We have cloned the gene for MCV topoisomerase, overexpressed and purified the protein, and begun to characterize its activities in
vitro. Like other eukaryotic type I topoisomerases, MCV topoisomerase can relax both positive and negative supercoils. An analysis of the
cleavage of plasmid and oligonucleotide substrates indicates that
cleavage by MCV topoisomerase is favored just 3' of the sequence 5'
(T/C)CCTT 3', resulting in formation of a covalent bond to the 3' T
residue, as with other poxvirus topoisomerases. We identified solution
conditions favorable for activity and measured the rate of formation
and decay of the covalent intermediate. MCV topoisomerase is sensitive
to inhibition by coumermycin A1 (50% inhibitory concentration, 32 µM) but insensitive to five other previously reported topoisomerase inhibitors. This work provides the point of departure for studies of
the mechanism of function of MCV topoisomerase and the development of
medically useful inhibitors.
 |
TEXT |
Molluscum contagiosum virus (MCV) is
one of nine poxviruses that causes diseases in humans (3).
The virus infects human keratinocytes, producing a distinctive
pathology. Cells near the surfaces of lesions become many times larger
than normal and become filled with a granular mass called molluscum
bodies. Untreated lesions in healthy people usually disappear
spontaneously within several months (4, 15). MCV infection
is more common in AIDS patients than in the general population (as high
as 5 to 18% [4]), and the consequences are much more
severe (14, 17). As many as 33% of AIDS patients with
CD4+ counts of less that 100 cells/mm3 may be
infected (4). In immunocompromised patients, papules can
form dense crops that are disfiguring and untreatable.
Among the MCV genes identified in the recently completed DNA sequence
was one encoding a putative type I topoisomerase (23). Type
I topoisomerases catalyze the formation of transient nicks in DNA which
result in DNA relaxation (5). Studies in many systems reveal
that such a DNA relaxation activity is important for efficient DNA
replication, transcription, and probably other functions (7,
31).
All the poxviruses studied to date encode a topoisomerase (6, 10,
12, 23). In the case of vaccinia virus topoisomerase, the most
thoroughly studied model, it has been shown that replication requires
topoisomerase function (29). Vaccinia virus topoisomerase is
a 34-kDa protein that binds to the sequence 5' (T/C)CCTT 3' and cleaves
just 3' of the 3'-most T, forming a covalent phosphotyrosine intermediate (20, 27, 30). Amino acid residues important for
topoisomerase function have been identified and characterized (2,
11, 13, 21), and an X-ray structure has been reported for an
amino-terminal fragment potentially involved in DNA binding (25). Topoisomerase enzymes derived from orf virus and
entomopoxvirus have also been studied in vitro (6, 12). Here
we describe the purification and initial analysis of the topoisomerase
of MCV.
Cloning and site-directed mutagenesis of the MCV topoisomerase
gene.
To clone the MCV topoisomerase gene (encoded between base
pairs 104017 and 104985 [23, 24]), the coding sequence
was amplified by PCR, using primers complementary to sequences at each
end. MCV DNA from infected human lesions, kindly supplied by Bernard Moss (National Institutes of Health), was used as the PCR template. A
band of the expected size was generated in amplification reactions and
cloned into the pTA cloning vector (Invitrogen). DNA sequencing revealed that the coding region matched the reported sequence except
for two positions, a leucine at amino acid 273 changed to glutamine and
a glycine at position 313 changed to glutamic acid (data not shown). It
is unclear whether these changes represented errors introduced in the
PCR step or natural polymorphisms among different MCV isolates. In
order to simplify interpretation of subsequent studies, positions 273 and 313 were changed by site-directed mutagenesis to leucine at 273 and
glycine at 313 to match the published sequence.
Overexpression and purification of MCV topoisomerase.
For
overexpression of the MCV topoisomerase, the coding regions of the
initial isolate and the published wild-type were transferred to the T7
expression vector pET15B (Novagen). This resulted in the fusion of a
20-amino-acid linker containing a hexahistidine tag to the amino
terminus to facilitate purification [the MCV topoisomerase protein
containing the His tag is henceforth referred to as (HT)MCV-TOP].
(HT)MCV-TOP was purified from the soluble fraction of lysed
Escherichia coli cells by chromatography on Ni-chelating
Sepharose. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS/PAGE) of the fractions used for subsequent studies is shown in
Fig. 1, lane 2. (HT)MCV-TOP(L273Q,
G131E), the product of the originally isolated DNA, was also purified by this means (data not shown). The amino-terminal linker containing the hexahistidine purification tag also contains a thrombin cleavage site for proteolytic removal of the His tag after purification. Treatment of the purified (HT)MCV-TOP with thrombin yielded a protein shortened by the expected amount (Fig. 1, lane 3; the thrombin-treated protein is referred to as MCV-TOP).

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Analysis of MCV topoisomerase proteins by SDS-PAGE.
Lanes: 1, size markers; 2, purified (HT)MCV-TOP; 3, MCV-TOP (the same
fractions as in lane 2 but lacking the amino-terminal hexahistidine tag
which was removed by treatment with thrombin). MCV DNA from infected
human skin, generously supplied by Bernard Moss, provided the starting
material for cloning the MCV topoisomerase gene. The gene was amplified
by primers FB264 (5' CCTCCATATGAAACGCTTTTTTTTTTACAAG 3') and
FB265 (5' CGCGGATCCTCACCCCGTTTCGGGGCACCGCGC 3') that added
restriction sites for NdeI to the amino-terminal coding
region and BamHI to the carboxyl-terminal coding region.
This DNA fragment was cloned into the vector pCRII (Invitrogen) to
yield plasmid pBW37. The BamHI-NdeI insert was
released by cleavage with these enzymes. The purified DNA fragment was
then ligated with the T7 expression vector pET15B that had been cleaved
with BamHI and NdeI, yielding pBW38. This
manipulation results in the fusion of a sequence supplied by the vector
encoding a hexahistidine tag to the amino-terminal coding region.
Site-directed mutagenesis was carried out with the Clontech Transform
site-directed mutagenesis kit according to the manufacturer's
protocol. Changes (L273Q and G313E) were introduced into the MCV coding
region in plasmid pBW37 by primers BW124 (5'
CCCGAAACGGGGTGAGGGCCCGCGAATCTG 3') and BW125 (5'
GCGCTGACAGTGCTCGAGCTGGCGCGCCCGAAACGGAGTGAGGATCCGCGAATCTG 3'). To
enrich for the desired products, a third primer was used (BW121,
5' CTCGGTACCACGCGTGGCGTAATC 3') to eliminate a restriction
site in the starting vector (HindIII) and to introduce a
new site (MluI). The MCV coding insert was then transferred
to pET15B for overexpression in E. coli, yielding plasmid
pBW41. Plasmids pBW38 or pBW41 were introduced into the bacterial
strain BL21/DE3, which supplies T7 RNA polymerase under control of the
lacZ promoter. Transformed cells were grown to mid-log phase
at 30°C in super broth (16) and then induced to express
the MCV topoisomerase by the addition of
isopropyl- -D-thiogalactopyranoside to the culture
medium. Induced cells from 1.5 liters of culture were concentrated and
resuspended in 25 ml of 0.5 M NaCl-5 mM imidazole-20 mM Tris-HCl, pH
7.9 (binding buffer). Protease inhibitor AEBSF (Calbiochem) was added
to 25 µg/ml, and cells were lysed by treatment with 1 mg of lysozyme
per ml and sonication. The lysate was centrifuged at 15,000 rpm for 30 min in a JA20 rotor (Beckman). The supernatant was filtered and applied
to three 0.8-ml chelating Sepharose columns charged with nickel. The
columns were washed with binding buffer and then washed with binding
buffer containing 60 mM imidazole. (HT)MCV-TOP proteins were eluted
with binding buffer containing 1 M imidazole. Fractions were dialyzed
against 0.5 M NaCl-20 mM Tris (pH 8)-1 mM EDTA-0.1% Triton.
|
|
DNA relaxation by MCV topoisomerase proteins.
(HT)MCV-TOP,
(HT)MCV-TOP(L273Q, G313E), and MCV-TOP were assayed for DNA relaxation
activity. Column fractions were incubated with negatively supercoiled
pUC19 plasmid, and the products were analyzed on native agarose gels.
Figure 2, lane 2, displays the mobility
of relaxation products formed after incubation with (HT)MCV-TOP. The
product DNA migrates more slowly, since the relaxed form is less
compact than the substrate negative supercoil. To provide a marker for
the mobility of relaxed DNA, pFB312 was partially nicked by treatment
with HIV-1 integrase protein and subjected to electrophoresis in an
adjacent lane (Fig. 2, lane 12) (1, 26). Such plasmid
relaxation assays demonstrated activity for the (HT)MCV-TOP(L273Q,
G313E) and MCV-TOP proteins as well (data not shown). Mock extracts
from E. coli cells overexpressing irrelevant proteins showed
no such activity (data not shown). Subsequent assays were carried out
using the (HT)MCV-TOP protein.

View larger version (45K):
[in this window]
[in a new window]
|
FIG. 2.
Effects of ATP and MgCl2 on the relaxation
activity of (HT)MCV-TOP. DNA products were analyzed by electrophoresis
in the absence of ethidium bromide; DNAs were subsequently visualized
by ethidium bromide staining. Aliquots of reaction products were also
analyzed on gels containing ethidium bromide, which confirmed that the
relaxed products were covalently closed and not nicked (data not
shown). Standard assay conditions for assaying relaxation of
supercoiled plasmids were 200 mM potassium glutamate, 20 mM Tris-Cl (pH
8), 1 mM dithiothreitol, 0.1% Triton, 1 mM EDTA, 0.3 µg of plasmid
DNA, and various amounts of MCV topoisomerase in a 20-µl volume.
Reaction mixtures were incubated 5 to 30 min at 37°C, and the
reaction was stopped by the addition of protein gel loading dye
containing 0.5% SDS. Reaction products were separated by
electrophoresis on agarose gels containing Tris-acetate-EDTA and
visualized by staining with ethidium bromide.
|
|
Relaxation assays were used to identify optimal conditions for the
function of (HT)MCV-TOP. Titration of different salts identified
200 mM
potassium glutamate as optimal, potentially paralleling
the stimulation
of many DNA-protein interactions by soft anions
(
8). Nonidet
P-40 at 0.1% stimulated slightly. Divalent cation
was dispensable, so
subsequent reactions were carried out in the
presence of 10 mM EDTA.
The pH optimum was about 8 (data not shown).
The specific activity of the topoisomerase enzyme was estimated under
optimal conditions. Time course analyses indicated that
1 nM of active
MCV topoisomerase could relax 57 nM of pUC19 in
10 min, corresponding
to a relaxation rate of about 1.6 supercoils
per molecule per second
(data not shown). For comparison, vaccinia
virus topoisomerase was
found to relax 2.3 supercoils per molecule
per second (
28).
Topological requirements for relaxation.
Topoisomerase enzymes
differ in their substrate requirements for relaxation. In particular,
action on positively supercoiled substrates distinguishes among classes
of topoisomerases (7). The activity of (HT)MCV-TOP was
therefore tested on negatively supercoiled and positively supercoiled
substrates and found to relax both, as has been reported for other
poxvirus topoisomerases (6, 10, 12, 23).
Effects of ATP and Mg2+.
Poxvirus topoisomerases
are reported to differ in their response to Mg2+ and ATP.
Vaccinia virus topoisomerase is stimulated, whereas orf virus
topoisomerase is unaffected (6, 19, 28). The response of
(HT)MCV-TOP was therefore tested (Fig. 2). Relaxation under standard
conditions (200 mM potassium glutamate) is shown in lane 2. The
addition of MgCl2 at 10 mM, 1 mM, or 0.1 mM had little
effect (lanes 3 to 5). The addition of 10 mM ATP was inhibitory (lane
6), while addition of 1 mM or 0.1 mM had no effect (lanes 7 and 8). The
addition of 10 mM MgCl2 did not influence the response to
ATP (lanes 9 to 11). Repetition of this experiment in the presence of
100 mM NaCl or no added salt instead of the 200 mM potassium glutamate
yielded similar results (data not shown). Evidently (HT)MCV-TOP differs
from vaccinia virus but resembles orf virus topoisomerase in not
responding to MgCl2 and ATP.
Specificity of DNA cleavage.
The formation of the covalent
complex between topoisomerases and substrate DNA can be monitored by
assaying DNA cleavage. For most cellular topoisomerases, the covalent
intermediate is short-lived and specific inhibitors must be added for
the intermediate to accumulate. Poxvirus topoisomerases differ,
however, in that the intermediate accumulates in vitro, and cleaved DNA
products can be studied after stopping reactions by the addition of SDS (27).
To investigate the sequence specificity of cleavage by (HT)MCV-TOP,
preferred sites were mapped in pUC19 DNA. Linear pUC19
DNA was labeled
separately on each DNA strand at the 3' end, and
the labeled DNA was
incubated with (HT)MCV-TOP. Reaction products
were separated on
alkaline electrophoresis gels and visualized
by autoradiography (Fig.
3A). Seven sites of cleavage were
observed
(a to g in Fig.
3A) and mapped on the primary DNA sequence
(Fig.
3B). Each of these sites contains a 5' (T/C)CCTT 3' sequence
matching
the favored cleavage site reported for other poxvirus
topoisomerases
(Fig.
4A and data not
shown) (
6,
30).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 3.
Site-specific cleavage by (HT)MCV-TOP. (A) Linear pUC19
DNA uniquely labeled on each 3' end was incubated with purified MCV
topoisomerase, treated with 0.5% SDS, and separated on 1.6% alkaline
agarose gels by electrophoresis. Lanes: 1, no topoisomerase; 2, 400 ng
of topoisomerase; 3, no topoisomerase; 4, 400 ng of topoisomerase. To
generate the cleavage substrate, pUC19 DNA was linearized with
XbaI and 3' end labeled with Klenow enzyme and
[ -32P]dCTP. Linear pUC19 labeled on one end only was
then prepared by digestion with EcoRI (top strand) or
HindIII (bottom strand) to remove the label at the
undesired position. Reaction mixtures (20 µl) containing 20 mM
Tris-HCl, pH 8.0, 200 mM K-glutamate, 1 mM dithiothreitol, 0.1% Triton
X-100, 1 mM EDTA, and 50 ng of 3' end 32P-labeled linear
pUC19 DNA plus 400 ng topoisomerase were incubated at 37°C for 5 min.
Cleaved DNA products were disrupted by the addition of SDS to 0.5%,
heated at 95°C for 5 min, cooled on ice, adjusted to 50 mM NaOH and 1 mM EDTA, and then analyzed by electrophoresis on a 1.6% alkaline
agarose gel (16). (B) Diagram of the cleavage substrate and
the approximate positions of MCV topoisomerase cleavage sites in pUC19.
The site of strand labeling in each set of reactions is indicated by
open circles. The cleavage sites are indicated on the top or bottom
strand by arrows.
|
|

View larger version (36K):
[in this window]
[in a new window]
|
FIG. 4.
Analysis of the strand specificity of covalent complex
formation on the MCV sub a substrate. (A) Sequence of MCV sub a, an
oligonucleotide matching the most prominent site of cleavage by
(HT)MCV-TOP in pUC19 DNA (site a in Fig. 3). A consensus cleavage site,
5' CCCTT 3', is underlined; the favored cleavage site is marked by the
arrow. (B) Strand specificity of (HT)MCV-TOP covalent complex
formation. MCV sub a was separately labeled at either the 5' end or 3'
end of each strand, covalent complexes were formed with (HT)MCV-TOP,
and the products were assayed by SDS-PAGE. The numbers over each lane
correspond to the DNA ends indicated in panel A. Lanes: 1, 5'
end-labeled top strand; 2, 3' end-labeled top strand; 3, 3' end-labeled
bottom strand; 4, 5' end-labeled bottom strand. MCV sub a was end
labeled at the 5' end by treatment of one strand with
[ -32P]ATP and T4 polynucleotide kinase. After
labeling, the oligonucleotide was purified in a Sephadex G-25 spin
column and then hybridized to the complementary oligonucleotide by
heating and slow cooling. To prepare 3' labeled MCV sub a, the duplex
oligonucleotide was treated with Klenow fragment and
[ -32P]dCTP. Reaction mixtures (20 µl) contained 20 mM Tris-HCl, pH 8.0, 200 mM K-glutamate, 1 mM dithiothreitol, 0.1%
Triton X-100, 1 mM EDTA, 50 nM of 5' 32P-end-labeled MCV
sub a, and 600 nM of MCV topoisomerase. Reaction mixtures were
prewarmed at 37°C and then initiated by the addition of
topoisomerase. Covalent complex products were disrupted by the addition
of SDS and beta-mercaptoethanol to 0.5%, heated at 95°C for 5 min,
and then analyzed on 12% polyacrylamide gels containing 0.1% SDS.
Free oligonucleotide migrated with the bromophenol blue (BPB) dye
marker. (C) Cleavage of MCV sub a labeled at the 3' end of the bottom
strand. Reaction mixtures (20 µl) were diluted to 1:20, adjusted to
50% formamide, heated at 95°C for 5 min, and then separated on 8%
denaturing polyacrylamide gels containing 8.3 M urea in TBE buffer
(16). Reaction products were denatured, separated on a DNA
sequencing-type polyacrylamide gel, and visualized by autoradiography.
Lane 1 contains an oligonucleotide matching the expected 27 base
product of cleavage. Lane 2 displays the reaction substrate, and lane 3 contains the product of cleavage by (HT)MCV-TOP.
|
|
Polarity and strand specificity of covalent complex formation.
The polarity of the DNA cleavage involved in covalent complex formation
was investigated by using an oligonucleotide substrate (MCV sub a) that
matched the most prominent cleavage site (Fig. 4A). To investigate
cleavage specificity, oligonucleotide MCV sub a was separately labeled
on the 5' and 3' ends of the top and bottom DNA strands. Each substrate
was then incubated with (HT)MCV-TOP, and reactions were stopped with
SDS to trap the covalent intermediate. Reaction products were separated
by SDS-PAGE and visualized by autoradiography.
In this gel system, covalent complexes of (HT)MCV-TOP bound to cleavage
products migrated with the mass expected for the sum
of the molecular
weights. Unreacted substrates and free cleaved
strands migrated at the
buffer front with the bromophenol blue
marker dye. It can be seen that
only MCV sub a labeled at the
5' end of the bottom strand became bound
to protein (Fig.
4B,
lane 4). The observed slowly migrating band
displayed the mobility
expected for (HT)MCV-TOP (37 kDa) plus the 5'
DNA fragment (4.6
kDa). These data are consistent with the idea that
MCV topoisomerase,
like other poxvirus topoisomerases, forms a covalent
bond between
the enzyme and a 3' end in the substrate DNA.
The other half of the cleaved bottom strand is expected to be free of
bound protein. Reactions were carried out with the label
on the 3' end
of the bottom strand, and the length of DNA products
was analyzed by
electrophoresis on DNA sequencing-type gels (Fig.
4C, lanes 2 and 3).
As a control, the expected cleavage product
was synthesized, end
labeled, and analyzed in an adjacent lane
(Fig.
4C, lane 1). This
indicated that the product is as expected
for cleavage just 3' of the
conserved 5' CCCTT 3' sequence (Fig.
4C). No cleavage was detected at
the second 5' CCCTT 3' sequence
in MCV sub a, indicating that further
unidentified sequence features
are also important (only the preferred
cleavage site is underlined
in Fig.
4A).
Kinetic analysis of cleavage by (HT)MCV-TOP.
To begin to
elucidate the kinetics of (HT)MCV-TOP action, the rates of formation
and decay of the covalent complex were measured. (HT)MCV-TOP was
titrated into reactions containing 50 nM MCV sub a labeled at the 5'
end of the bottom strand. Reactions were incubated for 1 min at 37°C,
and production of the covalent complex was monitored by SDS-PAGE (Fig.
5A). A plateau was reached at 1,500 nM
topoisomerase, at which point about 30% of the substrate was in the
covalent form. Less covalent complex accumulated in the presence of 100 mM NaCl or no added salt (data not shown). The plateau likely
represents the state at which all substrate molecules are bound to
enzyme, and the proportion of cleaved versus uncleaved substrates
represents a balance between formation and decay rates of the cleaved
complex.

View larger version (23K):
[in this window]
[in a new window]
|
FIG. 5.
Kinetics of formation of the covalent intermediate. (A)
Titration of (HT)MCV-TOP with MCV sub a DNA 5' end labeled on the
bottom strand. Formation of the covalent complex was assayed by
SDS-PAGE. This assay and those described below were quantitated on a
Molecular Dynamics PhosphorImager. The concentrations of substrate
and (HT)MCV-TOP are as indicated. (B) Time course of formation of the
3' cleavage product accompanying covalent complex formation. (C) Time
course of formation of the covalent complex. MCV sub a labeled on the
5' end of the bottom strand was incubated with (HT)MCV-TOP, and
aliquots were assayed as a function of time by SDS-PAGE.
|
|
The rate of formation of the cleaved complex was then investigated.
First, MCV sub a was labeled on the 3' end of the bottom
strand to
monitor the production of the free 3' fragment after
cleavage (Fig.
5B). MCV topoisomerase (600 nM) was mixed with
50 nM MCV sub a, and
aliquots were withdrawn at different times
and analyzed on denaturing
polyacrylamide gels. The half time
for formation of the cleaved product
was less than 1 min.
The time for formation of the covalent complex was also measured under
the same conditions and also found to be less than
1 min, as expected
since DNA strand cleavage should be coupled
with covalent complex
formation (Fig.
5C). For unknown reasons,
the final extent of the
reaction measured by the two methods differed:
10% for production of
the 3' cleaved strand versus 30% for production
of the cleaved complex
(the yield of the 3' cleavage reactions
was variable among
experiments).
The rate of decay of covalent complexes was measured by preincubating
(HT)MCV-TOP with 5' labeled MCV sub a and then challenging
the reaction
with a 10-fold excess of unlabeled MCV sub a (Fig.
6A). The abundance of the covalent
complex declined to one-tenth
of its former amount with a half time of
3 min (Fig.
6B). These
data are consistent with the idea that the
turnover of (HT)MCV-TOP
is limited by a late step in the reaction
cycle, such as product
release.

View larger version (21K):
[in this window]
[in a new window]
|
FIG. 6.
Kinetics of decay of the covalent intermediate. (A)
Outline of the challenge protocol. (B) Analysis of decay of the
covalent complex. Reactions were stopped by treatment with SDS and
analyzed by SDS-PAGE. Lanes: 1, no added (HT)MCV-TOP; 2, (HT)MCV-TOP
but no added competitor; 3 to 8, (HT)MCV-TOP with a 10-fold excess of
competitor. Times after competitor addition are indicated above the
autoradiogram.
|
|
Inhibition of DNA relaxation by coumermycin A1.
To assay the
effect of known topoisomerase inhibitors on the MCV enzyme, inhibition
of the relaxation activity was tested. Conversion of the substrate
supercoiled plasmid DNA to relaxed circular DNA was measured after 5 min of incubation at 37°C in the presence of different concentrations
of inhibitors (Fig. 7). Coumermycin A1
inhibited MCV topoisomerase with a 50% inhibitory concentration of 32 µM (Fig. 7B). In contrast, five other topoisomerase inhibitors were
inactive against MCV topoisomerase at the concentrations tested (Fig.
7A and C).

View larger version (26K):
[in this window]
[in a new window]
|
FIG. 7.
Inhibition of DNA relaxation by several topoisomerase
inhibitors. (A) Inhibition of calf topoisomerase I and (HT)MCV-TOP by
camptothecin. Control reactions were performed without enzyme (lanes 1)
or without inhibitor (lanes 2). Concentrations of inhibitor added were
12.5 µM (lane 3), 25 µM (lane 4), 50 µM (lane 5), and 100 µM
(lane 6). The reaction mixtures contained a 10% (vol/vol) final
concentration of dimethyl sulfoxide. (B) Inhibition of calf
topoisomerase I and (HT)MCV-TOP by coumermycin A1. Lanes are the same
as described for panel A. (C) Quantitation of inhibition of (HT)MCV-TOP
by several topoisomerase inhibitors.
|
|
Implications.
The topoisomerase of MCV resembles previously
described poxvirus enzymes in many respects, though this could not have
been predicted since MCV topoisomerase is only 54% identical of that of vaccinia virus. The proteins are similar in size, relaxation specificity, and favored sites of action (6, 12, 28, 30). Evidently the common features previously described for the
topoisomerases of the Orthopoxvirus,
Parapoxvirus, and Entomopoxvirus B genera also
hold for the divergent Molluscipoxvirus genus.
The sequences favored for cleavage are identical among the poxvirus
topoisomerases studied. All cleave the same sites in pUC19
and favor
sequences containing the pentanucleotide 5' (C/T)CCTT
3'. However, the
precise nature of the sequences required for
cleavage has not been
fully clarified. In pUC19 DNA, there are
eight 5' CCCTT 3' sequences,
but only four were seen as cleavage
sites for MCV topoisomerase (Fig.
3). Three additional sites in
pUC19 found to be favored for cleavage
had the sequence 5' TCCTT
3' (data not shown). Two 5' CCCTT 3'
sequences are present in
oligonucleotide MCV sub a, but for unknown
reasons only one is
cleaved efficiently (Fig.
4C). Evidently base pairs
outside the
favored pentanucleotide are also important. The
topoisomerase
of vaccinia virus has been studied extensively, but there
also
the sequence determinants of cleavage have not been fully
clarified
(
11,
20,
27). Further data in this area may be
useful in
identifying the favored sequences and understanding their
role
in the topoisomerase mechanism.
MCV topoisomerase is a potentially attractive target for the
development of antiviral agents. Poxvirus type I topoisomerases
are
quite different from human type I topoisomerases, being smaller
and
only distantly related in sequence (
9). The MCV
topoisomerase
displays an unusual response to inhibitors for a
eukaryotic type
I topoisomerase. It is resistant to the type I
topoisomerase inhibitor
camptothecin, but sensitive to coumermycin A1,
which otherwise
acts only on type II topoisomerases. Vaccinia virus
topoisomerase
displays a similar pattern of sensitivity to inhibitors
(
18,
22,
28). These distinctive responses raises the hope
that
small molecules may be found that selectively inhibit MCV
topoisomerase
but not human topoisomerases. Such compounds might be
useful as
MCV antiviral agents. Small molecules active against MCV
topoisomerase
might be applied topically to MCV papules, potentially
circumventing
many possible concerns regarding toxicity of the
antiviral compound.
 |
ACKNOWLEDGMENTS |
We are particularly grateful to Bernard Moss for supplying MCV DNA
from patient samples. We thank members of the Bushman laboratory for
comments on the manuscript and Lawrence Linford for help with early
stages of the work.
This work was supported in part by award R97-SAL-088 from the
Universitywide AIDS Research Program.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: The Salk
Institute for Biological Studies, 10010 N. Torrey Pines Rd., La Jolla,
CA 92037. Phone: (619) 453-4100. Fax: (619) 554-0341. E-mail:
rick_bushman{at}qm.salk.edu.
 |
REFERENCES |
| 1.
|
Bushman, F. D., and R. Craigie.
1991.
Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.
Proc. Natl. Acad. Sci. USA
88:1339-1343[Abstract/Free Full Text].
|
| 2.
|
Cheng, C.,
L. K. Wang,
J. Sekiguchi, and S. Shuman.
1997.
Mutational analysis of 39 residues of vaccinia DNA topoisomerase identifies Lys-220, Arg-223, and Asn-228 as important for covalent catalysis.
J. Biol. Chem.
272:8263-8269[Abstract/Free Full Text].
|
| 3.
|
Fields, B. N., and D. M. Kinpe.
1990.
.
Virology.
Raven Press, New York, N.Y.
|
| 4.
|
Gottlieb, S. L., and P. L. Myskowski.
1994.
Molluscum contagiosum.
Int. J. Dermatol.
33:453-461[Medline].
|
| 5.
|
Gupta, M.,
A. Fujimori, and Y. Pommier.
1995.
Eukaryotic DNA topoisomerases I.
Biochim. Biophys. Acta
1262:1-14[Medline].
|
| 6.
|
Klemperer, N.,
D. J. Lyttle,
D. Tauzin,
P. Traktman, and A. J. Robinson.
1995.
Identification and characterization of the orf virus type I topoisomerase.
Virology
206:203-215[Medline].
|
| 7.
|
Kornberg, A., and T. Baker.
1991.
.
DNA replication. W. H.
Freeman and Company, New York, N.Y.
|
| 8.
|
Leirmo, S.,
C. Harrison,
D. S. Cayley,
R. R. Burgess, and M. T. Record.
1987.
Replacement of potassium chloride by potassium glutamate dramatically enhances protein-DNA interactions in vitro.
Biochemistry
26:2095-2101[Medline].
|
| 9.
|
Lynn, R. M.,
M.-A. Bjornsti,
P. R. Caron, and J. C. Wang.
1989.
Peptide sequencing and site-directed mutagenesis identify tyrosine-727 as the active site tyrosine of Saccharomyces cerevisiae DNA topoisomerase I.
Proc. Natl. Acad. Sci. USA
86:3559-3563[Abstract/Free Full Text].
|
| 10.
|
Massung, R. F.,
J. J. Esposito,
L. Lui,
J. Qi,
T. R. Utterback,
J. C. Knight,
L. Aubin,
T. E. Yuran,
J. M. Parsons,
V. N. Loparev,
N. A. Selivanov,
K. F. Cavallaro,
A. R. Kerlavage,
B. W. J. Mahy, and J. C. Venter.
1993.
Potential virulence determinants in terminal regions of variola smallpox virus genome.
Nature
366:748-751[Medline].
|
| 11.
|
Morham, S. G., and S. Shuman.
1992.
Covalent and noncovalent DNA binding by mutants of vaccinia DNA topoisomerase I.
J. Biol. Chem.
267:15984-15992[Abstract/Free Full Text].
|
| 12.
|
Petersen, B. O.,
R. L. Hall,
R. W. Moyer, and S. Shuman.
1997.
Characterization of a DNA topoisomerase encoded by Amsacta moorei entomopoxvirus.
Virology
230:197-206[Medline].
|
| 13.
|
Petersen, B. O., and S. Shuman.
1997.
Histidine 265 is important for covalent catalysis by vaccinia topoisomerase and is conserved in all eukaryotic type I enzymes.
J. Biol. Chem.
272:3891-3896[Abstract/Free Full Text].
|
| 14.
|
Petersen, C. S., and J. Gerstoft.
1992.
Molluscum contagiosum in HIV-infected patients.
Dermatology
184:19-21[Medline].
|
| 15.
|
Porter, C. D.,
N. W. Blake,
J. J. Cream, and L. C. Archard.
1992.
Molluscum contagiosum virus, p. 233-257. In
D. A. Wright, and L. Archer (ed.), Molecular and cell biology of sexually transmitted diseases.
Chapman and Hall, London, England.
|
| 16.
|
Sambrook, J.,
E. F. Fritsch, and T. Maniatis.
1989.
.
Molecular cloning: a laboratory manual, 2nd ed.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 17.
|
Schwartz, J. J., and P. L. Myskowski.
1992.
Molluscum contagiosum in patients with human immunodeficiency virus infection.
J. Am. Acad. Dermatol.
27:583-588[Medline].
|
| 18.
|
Sekiguchi, J., and S. Schuman.
1997.
Novobiocin inhibits vaccinia virus replication by blocking virus assembly.
Virology
235:129-137[Medline].
|
| 19.
|
Sekiguchi, J., and S. Shuman.
1994.
Stimulation of vaccinia topoisomerase I by nucleoside triphosphates.
J. Biol. Chem.
269:29760-29764[Abstract/Free Full Text].
|
| 20.
|
Sekiguchi, J., and S. Shuman.
1994.
Vaccinia topoisomerase binds circumferentially to DNA.
J. Biol. Chem.
269:31731-31734[Abstract/Free Full Text].
|
| 21.
|
Sekiguchi, J., and S. Shuman.
1996.
Identification of contacts between topoisomerase I and its target DNA by site-specific photocrosslinking.
EMBO J.
15:3448-3457[Medline].
|
| 22.
|
Sekiguchi, J.,
J. T. Stivers,
A. S. Mildvan, and S. Shuman.
1996.
Mechanism of inhibition of vaccinia DNA topoisomerase by novobiocin and coumermycin.
J. Biol. Chem.
271:2313-2322[Abstract/Free Full Text].
|
| 23.
|
Senkevich, T. G.,
J. J. Bugert,
J. R. Sisler,
E. V. Koonin,
G. Darai, and B. Moss.
1996.
Genome sequence of a human tumorigenic poxvirus: prediction of specific host response-evasion genes.
Science
273:813-816[Abstract].
|
| 24.
|
Senkevich, T. G.,
E. V. Koonin,
J. J. Bugert,
G. Darai, and B. Moss.
1997.
The genome of molluscum contagiosum virus: analysis and comparison with other poxviruses.
Virology
233:19-42[Medline].
|
| 25.
|
Sharma, A.,
R. Hanai, and A. Mondragon.
1994.
Crystal structure of the amino-terminal fragment of vaccinia virus DNA topoisomerase I at 1.6 Å resolution.
Structure
2:767-777[Medline].
|
| 26.
|
Sherman, P. A., and J. A. Fyfe.
1990.
Human immunodeficiency virus integration protein expressed in Escherichia coli possesses selective DNA cleaving activity.
Proc. Natl. Acad. Sci. USA
87:5119-5123[Abstract/Free Full Text].
|
| 27.
|
Shuman, S.
1991.
Site-specific DNA cleavage by vaccinia virus DNA topoisomerase I.
J. Biol. Chem.
266:1796-1803[Abstract/Free Full Text].
|
| 28.
|
Shuman, S.,
M. Golder, and B. Moss.
1988.
Characterization of vaccinia virus DNA topoisomerase I expressed in Escherichia coli.
J. Biol. Chem.
263:16401-16407[Abstract/Free Full Text].
|
| 29.
|
Shuman, S.,
M. Golder, and B. Moss.
1989.
Insertional mutagenesis of the vaccinia virus gene encoding a type I DNA topoisomerase: evidence that the gene is essential for virus growth.
Virology
170:302-306[Medline].
|
| 30.
|
Shuman, S., and J. Prescott.
1990.
Specific DNA cleavage and binding by vaccinia virus DNA topoisomerase I.
J. Biol. Chem.
265:17826-17836[Abstract/Free Full Text].
|
| 31.
|
Wang, J. C.
1996.
DNA topoisomerases.
Annu. Rev. Biochem.
65:635-692[Medline].
|
J Virol, April 1998, p. 3401-3406, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Mohr, S., Grandemange, S., Massimi, P., Darai, G., Banks, L., Martinou, J.-C., Zeier, M., Muranyi, W.
(2008). Targeting the Retinoblastoma Protein by MC007L, Gene Product of the Molluscum Contagiosum Virus: Detection of a Novel Virus-Cell Interaction by a Member of the Poxviruses. J. Virol.
82: 10625-10633
[Abstract]
[Full Text]
-
Hwang, Y., Minkah, N., Perry, K., Van Duyne, G. D., Bushman, F. D.
(2006). Regulation of Catalysis by the Smallpox Virus Topoisomerase. J. Biol. Chem.
281: 38052-38060
[Abstract]
[Full Text]
-
Bond, A., Reichert, Z., Stivers, J. T.
(2006). Novel and Specific Inhibitors of a Poxvirus Type I Topoisomerase. Mol. Pharmacol.
69: 547-557
[Abstract]
[Full Text]
-
Benarroch, D., Claverie, J.-M., Raoult, D., Shuman, S.
(2006). Characterization of Mimivirus DNA Topoisomerase IB Suggests Horizontal Gene Transfer between Eukaryal Viruses and Bacteria. J. Virol.
80: 314-321
[Abstract]
[Full Text]
-
Tian, L., Sayer, J. M., Jerina, D. M., Shuman, S.
(2004). Individual Nucleotide Bases, Not Base Pairs, Are Critical for Triggering Site-specific DNA Cleavage by Vaccinia Topoisomerase. J. Biol. Chem.
279: 39718-39726
[Abstract]
[Full Text]
-
Yakovleva, L., Handy, C. J., Sayer, J. M., Pirrung, M., Jerina, D. M., Shuman, S.
(2004). Benzo[c]phenanthrene Adducts and Nogalamycin Inhibit DNA Transesterification by Vaccinia Topoisomerase. J. Biol. Chem.
279: 23335-23342
[Abstract]
[Full Text]
-
Yakovleva, L., Tian, L., Sayer, J. M., Kalena, G. P., Kroth, H., Jerina, D. M., Shuman, S.
(2003). Site-specific DNA Transesterification by Vaccinia Topoisomerase: EFFECTS OF BENZO[{alpha}]PYRENE-dA, 8-OXOGUANINE, 8-OXOADENINE, AND 2-AMINOPURINE MODIFICATIONS. J. Biol. Chem.
278: 42170-42177
[Abstract]
[Full Text]
-
Da Fonseca, F., Moss, B.
(2003). Poxvirus DNA topoisomerase knockout mutant exhibits decreased infectivity associated with reduced early transcription. Proc. Natl. Acad. Sci. USA
100: 11291-11296
[Abstract]
[Full Text]
-
De Clercq, E.
(2001). Vaccinia Virus Inhibitors as a Paradigm for the Chemotherapy of Poxvirus Infections. Clin. Microbiol. Rev.
14: 382-397
[Abstract]
[Full Text]
-
Hwang, Y., Rhodes, D., Bushman, F.
(2000). Rapid microtiter assays for poxvirus topoisomerase, mammalian type IB topoisomerase and HIV-1 integrase: application to inhibitor isolation. Nucleic Acids Res
28: 4884-4892
[Abstract]
[Full Text]
-
Yoder, K. E., Bushman, F. D.
(2000). Repair of Gaps in Retroviral DNA Integration Intermediates. J. Virol.
74: 11191-11200
[Abstract]
[Full Text]
-
Hwang, Y., Rowley, D., Rhodes, D., Gertsch, J., Fenical, W., Bushman, F.
(1999). Mechanism of Inhibition of a Poxvirus Topoisomerase by the Marine Natural Product Sansalvamide A. Mol. Pharmacol.
55: 1049-1053
[Abstract]
[Full Text]
-
Hwang, Y., Burgin, A. Jr., Bushman, F.
(1999). DNA Contacts Stimulate Catalysis by a Poxvirus Topoisomerase. J. Biol. Chem.
274: 9160-9168
[Abstract]
[Full Text]
-
Farnet, C. M., Wang, B., Hansen, M., Lipford, J. R., Zalkow, L., Robinson, W. E. Jr., Siegel, J., Bushman, F.
(1998). Human Immunodeficiency Virus Type 1 cDNA Integration: New Aromatic Hydroxylated Inhibitors and Studies of the Inhibition Mechanism. Antimicrob. Agents Chemother.
42: 2245-2253
[Abstract]
[Full Text]