Previous Article | Next Article 
J Virol, April 1998, p. 3321-3329, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Localization of Human Cytomegalovirus Structural
Proteins to the Nuclear Matrix of Infected Human Fibroblasts
V.
Sanchez,1
P. C.
Angeletti,2
J. A.
Engler,2 and
W.
J.
Britt1,3,*
Departments of
Microbiology,1
Biochemistry and
Molecular Genetics,2 and
Pediatrics,3 University of Alabama
at Birmingham, Birmingham, Alabama 35233
Received 10 October 1997/Accepted 9 December 1997
 |
ABSTRACT |
The intranuclear assembly of herpesvirus subviral particles remains
an incompletely understood process. Previous studies have described the
nuclear localization of capsid and tegument proteins as well as
intranuclear tegumentation of capsid-like particles. The temporally and
spatially regulated replication of viral DNA suggests that assembly may
also be regulated by compartmentalization of structural proteins. We
have investigated the intranuclear location of several structural and
nonstructural proteins of human cytomegalovirus (HCMV). Tegument
components including pp65 (ppUL83) and ppUL69 and capsid components
including the major capsid protein (pUL86) and the small capsid protein
(pUL48/49) were retained within the nuclear matrix (NM), whereas the
immediate-early regulatory proteins IE-1 and IE-2 were present in the
soluble nuclear fraction. The association of pp65 with the NM resisted
washes with 1 M guanidine hydrochloride, and direct binding to the NM
could be demonstrated by far-Western blotting. Furthermore, pp65
exhibited accumulation along the nuclear periphery and in far-Western
analysis bound to proteins which comigrated with proteins of the size
of nuclear lamins. A direct interaction between pp65 and lamins was
demonstrated by coprecipitation of lamins in immune complexes
containing pp65. Together, our findings provide evidence that major
virion structural proteins localized to a nuclear compartment, the NM,
during permissive infection of human fibroblasts.
| |
INTRODUCTION |
Recent studies have indicated that
the human cytomegalovirus (HCMV) virion is composed of a larger number
of proteins than previously thought, suggesting that assembly of the
infectious particle is extraordinarily complex (3). The
description of the architecture of the virion has been simplified to
include three distinct structures: the capsid, the envelope, and a
poorly characterized region between the capsid and envelope termed the tegument (54, 55). The protein composition of the HCMV
tegument has been incompletely defined, but it is thought to be
composed of a large number of phosphoproteins (3, 46).
Although there is general agreement that the capsid is assembled in the
nucleus, considerable controversy continues to surround the identity of the cellular site of envelopment of herpesviruses (4, 19, 30,
53). The assembly pathway of the tegument region remains even
less well understood. The distribution of protein components of the
HCMV tegument suggests that assembly of this virion structure takes
place in both the nucleus and the cytoplasm. Tegument proteins encoded
by UL82 (pp71), UL83 (pp65), and UL69 open reading frames appear to
localize in the nucleus, while the tegument protein pp28 (ppUL99) is
detected in extranuclear compartments of infected cells (24, 26,
38, 58, 61). HCMV pp150 (UL32) has been reported to demonstrate
both a nuclear and a cytoplasmic distribution (34), although
studies in our laboratory have suggested that pp150 is predominantly a
cytoplasmic protein (58). This organization of tegument
components suggests that these proteins are incorporated into the
virion in an ordered manner and, furthermore, that understanding tegument morphogenesis could provide insight into the pathways of
virion assembly and nuclear egress.
To further describe virion maturation, we have begun an investigation
of the pathway in which the tegument is assembled around the
nucleocapsid. Recent studies of herpes simplex virus (HSV) together
with previous reports describing replication centers in the nuclei of
infected cells have suggested that herpesviruses not only employ
complex regulatory controls of transcription and replication (18,
41, 42, 56) but possibly regulate particle assembly by localizing
structural proteins into discrete subnuclear compartments (63,
64). Recent studies by Ward and coworkers have divided the
nucleus of HSV-infected cells into different compartments called
assemblons based on localization of known proteins of HSV
(64). These included compartments for replication and
subviral particle formation (64). We have begun a series of
experiments to further define the assembly and nuclear egress of HCMV.
Specifically, we have examined the distribution of several tegument
proteins within the nuclear matrix of infected cells in order to define
spatial relationships and potential colocalization of structural
proteins late in infection. This compartment of the nucleus was
examined initially because it has been defined biochemically and thus
represented a nuclear compartment which could be analyzed by both
biochemical and imaging techniques.
The nuclear matrix is a proteinaceous network which is tightly
associated with the inner nuclear membrane. In many cell systems, the
nuclear matrix has been found to be the site of active transcription and replication of cellular DNA (6, 28, 35, 48, 49, 62).
Proteins involved in these processes as well as those with regulatory
roles in cell division localize to this nuclear scaffold (8, 15,
22, 32, 39, 40, 43, 52). Among DNA viruses, there are numerous
examples of viral gene products which associate with the nuclear matrix
or nuclear matrix structures (2, 10, 14, 16, 21, 25, 31, 37, 44,
51, 60, 66). This association may serve to compartmentalize
products necessary for efficient transcription and replication of the
viral genome or to sequester components involved in virion maturation
(5, 7, 25, 37, 44, 51, 66). The role of the nuclear matrix in the replicative cycle of herpesviruses, including HCMV, has not been
extensively studied. In this report we have described the binding of
several HCMV virion structural proteins including pp65 (ppUL83),
ppUL69, and the major capsid protein (MCP; pUL86) to the nuclear matrix
of HCMV-infected cells. The accumulation of virion components on the
nuclear matrix late in infection suggested that this compartment was a
potential staging site for virion structural proteins prior to their
assembly into subviral particles.
| |
MATERIALS AND METHODS |
Cells, viruses, and antibodies.
Human foreskin fibroblasts
(HF) and monkey BSC-1 cells were maintained in medium 199 with 5%
newborn calf serum and antibiotics at 37°C. For in situ nuclear
matrix extractions, HF were grown on glass coverslips at 37°C in 5%
CO2. Cells were infected with the AD169 strain of HCMV at a
multiplicity of infection of 0.1 to 1. The human epidermoid carcinoma
cell line HEp-2 and monkey Cos7 cells were maintained at 37°C in 5%
CO2 in Dulbecco's modified Eagle medium supplemented with
10% fetal calf serum and antibiotics.
The recombinant vaccinia viruses vv-Eco V gB and vv-pp65 were
propagated in BSC-1 cells. The construction and characterization of
these recombinant vaccinia viruses have been reported elsewhere (9, 13). The vv-Eco V gB construct differs from the vv-gB recombinant previously reported in that it contains the gB gene of
AD169 truncated at nucleotide 1950 and the corresponding gB protein
terminates at amino acid 650. This protein lacks the carboxy terminus
including the transmembrane region and represents a secreted form of
HCMV gB. The pp65-green fluorescent protein fusion was constructed by
using the EGFP-N2 plasmid (Clontech, Palo Alto, Calif.). A
BamHI site was generated at the 5' end of the pp65 genomic
sequence by PCR using the primer 5' TTTTTTGGATCCATGGAGTCGCGCGGT 3'. The product was fused in frame into the EGFP-N2 vector 3' to
the enhanced green fluorescence protein (EGFP) coding sequence.
HCMV proteins were detected with monoclonal antibodies (MAbs)
previously described (
1,
12,
50,
65). The MAbs used
in this
study include those with specific reactivity to IE-1 (p63-27),
IE-2
(IE-2-9-5), pp65 (28-19, 65-8, 28-103, 28-77), MCP (28-4),
the small
capsid protein (SCP) (11-2-23), gB (7-17), UL69 (UL69),
UL44 (28-21),
and pp28 (41-18). The guinea pig polyclonal serum
recognizing pp65 was
generated by repeated immunization of guinea
pigs with pp65 purified
from bacteria. The previously characterized
rabbit polyclonal antibody
237 against lamins a, b, and c was
a generous gift from Robert Goldman
(Department of Cell and Molecular
Biology, Northwestern University
School of Medicine) (
29). The
rabbit polyclonal sera against
lamins a and c and against lamin
b (
17) were a generous gift
from Nilabh Chaudhary (RPI, Boulder,
Colo.). The MAb against lamin B1,
NA12, was purchased from Oncogene
Sciences (Boston, Mass.). Fluorescein
isothiocyanate (FITC)-conjugated
goat anti-mouse immunoglobulin G (IgG)
and FITC-conjugated goat
anti-guinea pig IgG antibodies were obtained
from Cappell Laboratories
(Raleigh, N.C.). Texas red-conjugated goat
anti-rabbit IgG antibody
was purchased from Southern Biotechnology
Associates (Birmingham,
Ala.).
Preparation of nuclear matrix.
Nuclear matrix fractions were
prepared by a method similar to that described by Mirkovitch et al.
(45). AD169-infected HF, vv-pp65 and vv-Eco V gB-infected
BSC-1 cells, or uninfected HEp-2 cells were fractionated by extraction
in 0.1 or 0.2% Nonidet P-40 (NP-40) in phosphate-buffered saline (PBS;
137 mM NaCl, 8.1 mM NaH2PO4 · 12H2O, 2.7 mM KCl, 1.8 mM KH2PO4
[pH 7.4]) to yield crude nuclei. Nuclei were resuspended in 1 ml of
digestion buffer (20 mM Tris-HCl [pH 7.4], 20 mM KCl, 70 mM NaCl, 10 mM MgCl2, 0.05 mM spermine, 0.125 mM spermidine) with 1 mM
phenylmethylsulfonyl fluoride (PMSF) and subjected to digestion with
DNase I (0.05 mg/ml) for 15 min at room temperature. Nuclei were then
resuspended in digestion buffer with 0.1% digitonin and incubated at
room temperature for 10 min. The nuclear material was pelleted and then
extracted in high-salt buffer (2 M NaCl, 20 mM HEPES [pH 7.4], 20 mM
EDTA) on ice for 5 min. The nuclear material was then pelleted and
washed twice in digestion buffer and finally resuspended in sodium
dodecyl sulfate (SDS) sample buffer with 5% 2-mercaptoethanol or
washed three times in 1 M guanidine hydrochloride in digestion buffer
(2 min per wash) before addition of sample buffer (25). For
a typical experiment, six 150-cm2 flasks of AD169-infected
HF were harvested. For quantitative Western blots, AD169-infected HF
cells from 14 150-cm2 flasks were fractionated and protein
content was determined by using bicinchoninic acid reagent (Pierce,
Rockford, Ill.). The radioactive signal was quantitated on a Molecular
Dynamics PhosphorImager. For far-Western blots, nuclear matrix
fractions were isolated from four 150-cm2 flasks of HEp-2
cells.
Nuclear matrix extracts for immunoprecipitation were prepared by a
method similar to that described by Fey and Penman (
23).
Briefly, the nuclear matrix material extracted from AD169-infected
cells was solubilized in disassembly buffer (8 M urea, 20 mM
morpholineethanesulfonic
acid [pH 6.6], 1 mM EGTA, 1 mM PMSF, 0.1 mM
MgCl
2, 1% 2-mercaptoethanol)
for 16 h at 4°C. The
insoluble material was removed by centrifugation.
The urea was removed
from the supernatant by step dialysis against
Tris-buffered saline
(TBS; 50 mM Tris-HCl, 150 mM NaCl, 1 mM EDTA,
pH 7.4) at 4°C, and the
insoluble material was removed at each
step. A mixture of three
pp65-specific MAbs (28-19, 28-103, and
65-8) was used to precipitate
the dialyzed extract. Immunoprecipitates
were collected on protein
A-agarose and washed extensively in
radioimmunoprecipitation assay
buffer (1% NP-40, 1% deoxycholate,
and 0.2% SDS in TBS [pH 7.4]).
The samples were subjected to SDS-polyacrylamide
gel electrophoresis
(PAGE) and then transferred to nitrocellulose
for Western blotting as
described previously (
12).
For in situ extraction of AD169-infected HF, a different method was
used for nuclear matrix preparation. This method was similar
to that
described by He et al. (
33). Infected monolayers grown
on
glass coverslips were treated with digestion buffer (described
above)
with 0.1 mM PMSF and 0.5% NP-40 for 3 to 5 min on ice.
The monolayers
were then treated with digestion buffer containing
DNase I (0.05 mg/ml)
for 15 min at room temperature. Chromatin
was removed by washing
monolayers three times with 0.25 M ammonium
sulfate in digestion buffer
(pH 7.2) at room temperature, 10 min
per wash. Cells were then
extracted with high-salt buffer (described
above) for 5 min on ice.
Cell cytoskeletons were carefully rinsed
with digestion buffer and then
fixed in 2.5% paraformaldehyde
in PBS for 20 min at room temperature.
Fluorescence microscopy.
Virus-infected HF grown on glass
coverslips were fixed in 2.5% paraformaldehyde in PBS and
permeabilized with 0.2% Triton X-100 in PBS for 5 min. After rinsing,
cells and extracted cytoskeletons were blocked with 30% goat serum in
PBS for 30 min at 37°C. Coverslips were incubated with primary
antibody with 1% goat serum for 1 h at 37°C. Coverslips were
washed three times in PBS, 5 min per wash, and then incubated with
FITC-conjugated and/or Texas red-conjugated secondary antibody for
1 h at 37°C. After washing, coverslips were refixed with 0.5%
paraformaldehyde in PBS for 10 min. After rinsing in PBS, coverslips
were mounted with SlowFade antifade reagent (Molecular Probes, Eugene,
Oreg.), sealed with fingernail polish, and viewed on a Leitz Diavert
fluorescence microscope or a Zeiss confocal microscope.
Cos7 cells grown on coverslips were transfected by either the
Lipofectin (
57) or calcium phosphate (5' Prime-3' Prime,
Boulder,
Colo.) protocol. Cells were transfected with a modified pcDNA3
vector (Invitrogen, San Diego, Calif.) containing the pp65 genomic
sequence or a vector encoding a green fluorescent protein-pp65
fusion
protein (Clontech). Transfected cells were fixed 36 to
48 h
posttransfection, and cells expressing pp65 were reacted
with MAb 28-19 followed by FITC-conjugated goat anti-mouse IgG
antibody as described
above.
Far-Western blots.
pp65 was purified from Escherichia
coli transformed with the plasmid trc/hisA (Invitrogen), which
contained the complete pp65 open reading frame. After induction with
isopropylthio-
-D-galactopyranoside, cultures were
collected and the bacterial pellet was resuspended in denaturing lysis
buffer (20 mM Tris-HCl, 100 mM NaCl, 8 M urea [pH 8.0]). The
suspension was sonicated on ice until translucent. Insoluble material
was removed by centrifugation at 10,000 × g for 10 min. The lysate was incubated with Talon metal affinity resin
(Clontech) at room temperature with gentle rocking for 30 min. The
resin was collected by centrifugation and washed with denaturing lysis
buffer three times, 10 min per wash. pp65 was eluted by incubating the
resin with denaturing lysis buffer containing 75 mM imidazole four
times, 10 min per elution. Fractions were pooled, and the urea was
removed by dialysis against TBS. Protein concentration was determined
by using bicinchoninic acid reagent (Pierce).
Nuclear matrix samples from HEp-2 cells were subjected to SDS-PAGE as
previously described (
12). Proteins were blotted to
nitrocellulose, and filters were blocked in 5% dry milk in PBS.
Strips
were incubated with 150 to 200 µg of pp65 per strip in
5% milk
overnight at room temperature with gentle rocking (
2).
The
strip was washed in PBS three times, 10 min per wash; following
the
final wash, it was incubated with the pp65-specific MAb 28-19
for
4 h at 37°C and then washed in PBS as described above. The
strip
was then incubated with a rabbit anti-mouse IgG secondary
antibody for
1 h at 37°C. The filter was washed again and then
incubated with
125I-protein A for 30 min at 37°C. After washing, filters
were dried
and mounted, and bound antibody was detected by
autoradiography.
For Western blot analysis, nuclear matrix samples were
separated
electrophoretically and then blotted. Strips were processed
as
previously described (
12).
| |
RESULTS |
Tegument and capsid protein components of HCMV are associated with
the nuclear matrix.
Phosphoprotein 65 (pp65) is one of the most
abundant protein components of extracellular virions and dense bodies.
Shortly after HCMV infection of human fibroblasts, pp65 can be detected in the nucleus of infected cells, suggesting that it is actively transported to this cellular compartment (26, 61).
Immunofluorescence microscopy of AD169-infected HF as well as of Cos7
cells transfected with a plasmid containing the pp65 genomic sequence
revealed the accumulation of pp65 into discrete structures in the
nucleus (Fig. 1A to D). Similarly, in
studies utilizing a pp65-green fluorescent protein fusion, we observed
compartmentalization of the protein as well as focal accumulation along
the periphery of the nucleus (Fig. 1E and F). Together with previously
reported findings which indicated that deletion mutants of pp65 lacking
the carboxy-terminal nuclear targeting signals continued to accumulate
in the nucleus (26, 61), these results suggested that pp65
might contain additional domains which could mediate nuclear retention
by targeting the protein to a specific nuclear structure.
View larger version (50K):
[in this window]
[in a new window]
|
FIG. 1.
HCMV pp65 is a nuclear protein that is detected in
subnuclear structures. HF were grown on coverslips and infected with
AD169. Three to five days postinfection (100% cytopathic effect),
cells were fixed and stained in immunofluorescence assays with the
pp65-specific MAb 65-8 (A), MAb 28-19 (B), or polyclonal guinea pig
serum against bacterially expressed pp65 (C). Cos7 cells transfected
with a vector expressing pp65 (D) or an EGFP-pp65 fusion protein (E and
F) were fixed and stained with MAb 28-19 (D only). Magnifications: (A
to C) ×400; (D to F) ×1,000.
|
|
To characterize the interaction of pp65 with subnuclear structures, we
investigated the binding of the protein to the nuclear
matrix of
HCMV-infected HF. Extraction of isolated nuclei with
2 M NaCl resulted
in an insoluble pellet containing pp65, as demonstrated
by Western
blotting using the pp65-specific MAb 28-19 (Fig.
2A).
Because pp65 was an abundant
structural protein, we examined the
possibility that other virion
components were also present in
the nuclear matrix. Western blot
analysis of infected cells revealed
that several virion structural
proteins were associated with the
nuclear matrix. Structural components
including the MCP (pUL86)
and the tegument protein ppUL69 were also
retained in the nuclear
matrix fraction. In addition, the nonstructural
viral polymerase
accessory protein ppUL44 and previously described
lower-molecular-weight
forms of this protein were associated with the
nuclear matrix
fraction of infected cells. The binding of these
proteins was
stable and resisted three washes with 1 M guanidine
hydrochloride
except for an observable decrease in the 50- to 52-kDa
forms of
pp65 (Fig.
2B). The interaction of these proteins was also
specific,
as other virus-encoded proteins previously shown to localize
in
the nucleus of infected cells, including the 72-kDa IE-1 and 86-kDa
IE-2, were not detected in the nuclear matrix (Fig.
2). In addition,
two cytoplasmic virion proteins, gB (gpUL55) and pp28 (ppUL99),
were
not detected in the nuclear matrix of infected cells (Fig.
2).
View larger version (46K):
[in this window]
[in a new window]
|
FIG. 2.
HCMV-encoded structural and nonstructural proteins are
retained in the nuclear matrix of HCMV AD169-infected human
fibroblasts. Nuclei from AD169-infected HF were isolated by treatment
with nonionic detergent and then treated with DNase and high salt to
remove soluble components from the nuclear matrix fraction. (A) Nuclear
matrix-containing filters were probed with MAbs specific for gB, IE1,
IE2, ppUL44, ppUL69, pp28, MCP, and pp65. (B) Filters containing
proteins from nuclear matrix fractions washed with 1 M guanidine
hydrochloride prior to electrophoretic separation were probed with the
antibodies listed above. Sizes are indicated in kilodaltons.
|
|
The presence of structural components of the capsid and tegument on the
nuclear matrix suggested that this nuclear structure
was a potential
assembly site for subviral structures. Furthermore,
the strength of the
association between viral and cellular proteins
of the nuclear matrix
as reflected by their binding following
washes with 1 M guanidine
hydrochloride suggested a direct interaction
between individual virion
proteins and components of the nuclear
matrix. Alternatively,
individual virion structural proteins could
be tethered to the matrix
through interactions with other virus-encoded
proteins. To gauge the
relative strength of these protein-protein
interactions, we measured
the quantity of pp65 distributed between
the different pools collected
during the fractionation procedure
(Fig.
3). As shown in Fig.
3B and Table
1, only a small amount
of the total
cellular pp65 can be detected in the soluble fraction
isolated by
treatment of cells with 0.2% NP-40. This fraction
contained the
cytoplasm and nuclear proteins released by this
treatment, as
demonstrated by the presence of IE-1 in Fig.
3A.
The nuclear and
nuclear matrix fractions contained more pp65 per
microgram of protein
than the soluble fraction (Fig.
3B; Table
1). In addition, quantitation
of signal intensity showed that
the relative amount of pp65 was not
greatly reduced by the fractionation
procedure (Fig.
3B, lanes 2 to 4;
Table
1). In fact, there was
a relative enrichment of pp65 on the
nuclear matrix and in the
guanidine hydrochloride-washed pellet (Table
1). Of interest
was the apparent loss of the 50- and 52-kDa forms of
pp65 during
the guanidine hydrochloride wash (Fig.
3; Table
1),
suggesting
that these products were not as strongly retained as the
full-length
protein. Consistent with our findings shown in Fig.
2, the
IE-1
protein was not enriched in the nuclear matrix fraction and was
contained in the soluble fraction (Fig.
3).
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 3.
Quantitative Western blots of nuclear matrix
preparations from AD169-infected HF. HCMV-infected cells were
fractionated, and protein content in each fraction was determined as
described in Materials and Methods. Twenty-five micrograms of each of
the fractions was loaded into the lanes (C, cytoplasm, soluble protein;
N, detergent-treated nuclei; NM, nuclear matrix pellet; GW, guanidine
hydrochloride-washed NM) and transferred to nitrocellulose filters.
Filters were reacted with MAb p63-27 against IE-1 (A) or MAb 28-19 against pp65 (B) and processed for autoradiography. Counts for each
fraction were determined on a PhosphorImager and were as follows: IE-1,
449,874.4, 13,951.6, 9,332.5, and 9,514.3 for C, N, NM, and GW
fractions, respectively; pp65 (68 kDa), 239,720.7, 2,048,547.0, 1,206,468.7, and 1,172,115.9 for C, N, NM, and GW fractions,
respectively; pp65 (50-kDa form), 33,155.2, 1,003,560.2, 774,609.0, and
188,991.4 for C, N, NM, and GW fractions, respectively. Sizes are
indicated in kilodaltons.
|
|
To further examine the compartmentalization of virion structural
components on the nuclear matrix, we performed immunofluorescence
assays of in situ-extracted, HCMV-infected HF. These assays were
also
used to estimate the quantity of protein removed during the
extraction
procedure. As shown in Fig.
4A, the IE-1
protein was
readily detected in fixed cells but not in extracted
cytoskeletal
frameworks following treatment with high salt and DNase
(Fig.
4B). The absence of IE-1 in in situ-extracted cells confirmed
the
results of the Western blot analysis which suggested that
a significant
amount of IE-1 was not retained on the nuclear matrix.
In contrast,
ppUL44, MCP, ppUL69, and pp65 were retained in the
insoluble nuclear
matrix fraction (Fig.
4D, F, H, and J, respectively).
Furthermore, the
pattern of immunofluorescence suggested that
these proteins were
localized to subnuclear structures and not
evenly distributed
throughout the nucleus. In addition, we observed
the retention in the
nuclear matrix of the minor capsid protein
(pUL85) and the small capsid
protein, p12 (pUL48/49) (data not
shown). Note the lack of reactivity
of primary and secondary antibodies
with uninfected cells which were
present in these preparations
demonstrating the specificity of these
MAbs.
View larger version (79K):
[in this window]
[in a new window]
|
FIG. 4.
Immunofluorescence assays of in situ-extracted,
AD169-infected HF. HF grown on glass coverslips were infected with HCMV
AD169 5 days prior to harvesting. Infected cells were untreated (A, C,
E, G, and I) or extracted with detergent, DNase, and high salt (B, D,
F, H, and J) before fixation with 2.5% paraformaldehyde. Coverslips
were then reacted with MAbs specific for IE-1 (A and B), ppUL44 (C and
D), MCP (E and F), ppUL69 (G and H), or pp65 (I and J). Antibody
binding was detected with FITC-conjugated goat anti-mouse IgG antibody
and recorded by conventional fluorescence microscopy. Magnification for
all frames is ×348.
|
|
The tegument phosphoprotein pp65 binds to the nuclear matrix.
The interaction between pp65 and the nuclear matrix could be explained
by either a direct binding of pp65 to a component of the nuclear matrix
or an indirect binding through an association with another
virus-encoded protein and/or DNase-resistant nucleic acid which was
associated with a protein component of the nuclear matrix. We initially
addressed this question by examining the association of pp65 with the
nuclear matrix of cells infected with a recombinant vaccinia virus
expressing pp65. Recombinant pp65 expressed in the absence of other
HCMV-encoded proteins was enriched in the nuclear matrix and 1 M
guanidine hydrochloride-washed fractions (Fig.
5). As a control for the extraction
procedure, similar experiments were performed with cells expressing a
truncated form of HCMV gB. We could not detect enrichment of the
130-kDa precursor form of this gB or of its 30-kDa cleavage product in the nuclear matrix or guanidine hydrochloride-washed pellets. These
results indicated that pp65 was retained in the nuclear matrix of
cells in the absence of other viral proteins.
View larger version (45K):
[in this window]
[in a new window]
|
FIG. 5.
pp65 expressed by recombinant vaccinia virus vv-pp65 is
retained in the nuclear matrix of infected BSC-1 monkey cells.
Cytoplasmic (C), nuclear (N), nuclear matrix (NM), and guanidine-washed
nuclear matrix (GW) fractions were prepared from recombinant vaccinia
virus vv-Eco V gb (A)- or vv-pp65 (B)-infected BSC-1 cells as described
in Materials and Methods. The samples (10 µg per lane) were analyzed
by Western blotting using a gB-specific or pp65-specific MAb and
developed with 125I-protein A. Sizes are indicated in
kilodaltons.
|
|
To directly investigate the specificity of the protein-protein
interactions between pp65 and nuclear matrix components, we
performed
far-Western blotting with nuclear matrix material derived
from the
human cell line HEp-2 as the substrate for binding. A
pp65 fusion
protein containing a His
6 tag at the amino terminus
was
purified from
E. coli and used to probe the nitrocellulose
membrane containing electrophoretically separated nuclear matrix
proteins. Binding of pp65 to the nuclear matrix proteins was then
detected with the pp65-specific MAb 28-19. The results of this
experiment indicated a direct interaction between pp65 and at
least
three cellular proteins which migrated between 50 and 70
kDa and two
other proteins which migrated at approximately 30
kDa (Fig.
6A, lane FW). Interestingly, the 50- to
70-kDa bands
were of the approximate molecular size of nuclear lamins,
which
together represent major protein constituents of the nuclear
matrix.
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 6.
pp65 binds to a nuclear matrix protein which comigrates
with lamin B1 in vitro. (A) Nuclear matrix material was isolated from
the human carcinoma cell line HEp-2 as described in Materials and
Methods. Proteins were electrophoretically separated and then blotted
onto nitrocellulose. Filters were then reacted with pp65-specific MAb
28-19 (lane C), purified pp65 followed by anti-pp65 MAb 28-19 (lane
FW), or anti-lamin B1 MAb NA12 (lane NA12). Antibody binding was
detected by addition of anti-mouse IgG antibody followed by
125I-protein A and autoradiography. Migration of molecular
mass markers is shown in kilodaltons at the left. (B) Coprecipitation
of pp65 and lamins from soluble nuclear matrix extracts. Soluble
nuclear matrix extracts prepared from AD169-infected HF were
immunoprecipitated with MAbs against pp65. Immunoprecipitated proteins
were separated by SDS-PAGE and transferred to nitrocellulose for
Western blotting with antibodies specific for pp65 (28-19), lamins
(237), and a control MAb specific for ppUL44 (28-21). Antibody binding
was detected by addition of rabbit anti-mouse IgG antibody (lanes 28-19 and 28-21 only) followed by 125I-protein A and
autoradiography. Immunoglobulin heavy chains were detected with a
rabbit anti-mouse immunoglobulin antibody followed by addition of
125I-protein A and autoradiography (lane C). Migration of
the molecular mass marker (in kilodaltons) and immunoglobulin heavy
chains (Hc) is shown in the margins.
|
|
In earlier experiments, we observed focal accumulations of pp65 along
the periphery of the nucleus (Fig.
1E and F). Together,
these findings
were consistent with the association of pp65 with
proteins of the
nuclear lamina, the protein network which provides
the structural
framework of the nuclear envelope (
27,
47).
Using a MAb
against human lamin B1, we found that the 68-kDa band
detected in the
far-Western blot comigrated with the 68-kDa band
of the lamin B1
Western blot (Fig.
6A, lane NA12). Together, these
results suggested a
direct interaction between pp65 and proteins
of the nuclear matrix,
possibly components of the nuclear lamina.
pp65 interacts with lamins in the nuclear matrix fraction.
Direct investigations of protein-protein interactions with nuclear
lamins have been complicated by the insolubility of lamins. We
approached the study of pp65 interactions with these proteins by
preparing soluble nuclear matrix proteins through step dialysis of
nuclear matrix extracts from AD169-infected cells. The soluble nuclear
matrix proteins were immunoprecipitated with a mixture of pp65-specific
MAbs, and the precipitated proteins were separated by SDS-PAGE and then
transferred to nitrocellulose membranes. The membranes were probed with
the anti-pp65 MAb 28-19, a polyvalent rabbit antiserum specific for
lamins (237) (29), and a control MAb, 28-21, which is
specific for ppUL44. The pp65-specific MAb detected pp65 and several
forms of this protein (Fig. 6B). The lamin-specific antiserum 237 detected lamins in the immunoprecipitated complex (Fig. 6B). The
immunoreactive protein(s) migrated at approximately 68 kDa, consistent
with the migration of lamins. Antiserum 237 failed to react with
recombinant derived pp65 produced in bacteria, indicating that the
reactivity for lamins was specific (data not shown). In contrast, MAb
28-21 reacted with three proteins which ranged in size between 50 and
45 kDa (Fig. 6B). Although we cannot rule out the possibility that at
least one of these bands represents a ppUL44-related protein, we
observed the same three bands in the membrane developed with the
pp65-specific MAb, suggesting that these proteins represented
reactivity of the anti-mouse IgG second antibody with the different
forms of the immunoglobulin heavy chain present in the original
immunoprecipitate (Fig. 6B). The identity of these bands was confirmed
by probing a filter with rabbit anti-mouse IgG antibody (lane C), which
produced the same pattern of reactivity as the control anti-ppUL44
antibody. Together with our findings from the far-Western analysis,
these findings indicated that pp65 interacted directly with lamins.
To further examine the interactions between pp65 and lamins, in
situ-extracted AD169-infected HF were reacted with an anti-pp65
MAb and
a rabbit polyclonal serum against lamins a and c (
17).
We
observed localization of pp65 along the periphery of the nucleus
of
infected cells (Fig.
7A). Similarly,
the distribution of lamins
a and c along the nuclear
periphery was consistent with previous
studies (Fig.
7B)
(
17,
29). As shown in Fig.
7C, we noted
colocalization of
pp65 and lamins a and c. We also examined HCMV-infected
HF late in
infection when extensive cytopathic effects were present.
In some
cells, we observed extranuclear, vacuole-like structures
containing
both pp65 and lamin b (Fig.
7D to F). These results
were consistent
with the biochemical data suggesting a direct
interaction between pp65
and proteins of the nuclear lamina.
View larger version (105K):
[in this window]
[in a new window]
|
FIG. 7.
Colocalization of pp65 and lamins. Nuclear
matrix-extracted (A to C) or unextracted (D to F) HCMV-infected cells
were stained with a murine MAb against pp65 (green; A and D) and a
rabbit antiserum against lamins a and c (red; B) or against lamin b
(red; E). Colocalization (blue) of pp65 and lamins is shown in panels C
and F. Magnification for all panels, ×890.
|
|
| |
DISCUSSION |
In this report, we have described the subcellular distribution of
several structural and nonstructural proteins of HCMV. Specifically, we
have investigated the intranuclear localization of protein components
of the virion tegument and capsid. Because these proteins were
colocalized in a specific nuclear structure, the nuclear matrix, we
have proposed that the nuclear matrix is a potential site of particle
morphogenesis in the HCMV-infected cell.
Intranuclear compartmentalization of proteins from several DNA viruses
has been well documented. Studies of adenovirus-infected cells have
described the spatial separation of viral transcription and replication
sites (51). Virus-encoded proteins involved in replication
of the adenovirus genome have been localized to discrete nuclear
structures which are distinct from sites of transcription. de Bruyn
Kops and Knipe (18) as well as other groups (41, 42,
44) described the spatial organization of viral replication structures in HSV-infected cells and suggested that the arrangement of
these structures was defined by preexisting nuclear architecture (18, 44). Similarly, intranuclear HCMV replication
compartments were recently characterized by Sarisky and Hayward, who
characterized the viral proteins associated with the formation of these
sites and for oriLyt-dependent DNA replication
(59). A more complete description of intranuclear
compartmentalization of HSV proteins was recently reported by Ward et
al., who described HSV structures within the nucleus which they termed
assemblons (64). These nuclear subcompartments were reported
to segregate proteins into groups associated with specific functions
including replication of viral DNA and assembly of subviral particles.
The mechanisms driving accumulation of proteins into these structures
are not clear, but they are likely to involve interaction of viral
proteins with the architectural framework of the nucleus, thereby
providing spatial organization to an already temporally regulated
replicative process.
Previous studies of several DNA viruses have also shown that virion
structural proteins localized to the nuclear matrix (5, 7, 37,
66). Recent studies have documented the presence of newly
synthesized adenovirus virions on the core filaments of the nuclear
matrix, suggesting that this nuclear structure may be a site of
adenovirus assembly (66). In this same study, Zhonghe et al.
suggested that newly formed adenovirus particles track along 10-nm core
filaments of the nuclear matrix, providing some evidence that this
filamentous network may also provide a function critical to nuclear
egress of progeny virions. HSV proteins have been reported to associate
with the nuclear matrix (5, 7). In these studies, proteins
comigrating with capsid and DNA-binding proteins of HSV were found in
the nuclear matrix fraction (7). In addition, HSV capsids
were observed in a filamentous network within the nucleus
(5). These findings, together with studies which have shown
that the nuclear matrix is an important site of transcription and
replication, were consistent with a model in which this nuclear
compartment could serve as the site of assembly for viruses which
encapsidate nucleic acid in the nucleus (7, 37, 66). Our
findings were also in agreement with these previous findings in
adenovirus- and HSV-infected cells and suggested that HCMV may also
assemble subviral particles in association with the nuclear matrix of
infected cells. However, finding virion structural proteins associated
with the nuclear matrix does not indicate that in each case there is a
direct interaction between individual viral proteins and proteins of
the nuclear matrix. In some cases the association could have resulted
from virion protein interactions with a limited number of virus-encoded proteins bound to the nuclear matrix; however, the maintenance of this
association following washes in 1 M guanidine hydrochloride suggested a
very stable interaction.
We focused the majority our studies on the tegument protein pp65
because of its abundance in extracellular particles as well as its
nuclear expression shortly after infection of permissive fibroblasts
(36, 61). Previous studies have shown that almost immediately after infection, pp65 is transported to the nucleus of
fibroblasts, where it accumulates until late in infection
(61, data not shown). Targeting of the protein has
been attributed to a bipartite nuclear targeting signal at the extreme
carboxy terminus of the molecule (61) and more recently to a
second signal proximal to this conventional nuclear localization signal (NLS) (26). However, in both of these studies, mutated forms of pp65 which lacked these signals could still be localized to the
nucleus when expressed in recombinant systems, suggesting that there
were other domains mediating nuclear localization of pp65. Such domains
could mediate nuclear retention in addition to nuclear localization
associated with previously described NLS (26, 61). As shown
in Fig. 1, pp65 was observed in subnuclear structures and also in
patches along the periphery of the nucleus. Additional domains within
pp65 could therefore mediate retention on a particular nuclear
structure such as the nuclear lamina. Such protein interactions could
explain the findings of earlier studies which documented the nuclear
accumulation of mutant forms of pp65 which lacked NLS but were of such
a size as to allow passive diffusion into and out of the nucleus
(20, 26, 61).
The nuclear matrix of HCMV-infected fibroblasts was isolated by the
method of Mirkovitch et al., which consisted of high-salt extraction of
DNase-treated nuclei which were initially isolated by nonionic
detergent treatment of viable cells (45). The resulting pellet of nuclear material represented insoluble nuclear proteins and
was essentially devoid of DNA. Western blot analysis of nuclear matrix
material demonstrated the retention of several HCMV structural proteins
which have previously been characterized as nuclear proteins (Fig. 2A).
In addition, the polymerase accessory protein ppUL44 and the associated
products of this open reading frame were also present in the nuclear
matrix pellet. In contrast, the nuclear 72-kDa IE-1 and 86-kDa IE-2
nonstructural proteins were not detected in this assay, suggesting that
the association of HCMV proteins with the nuclear matrix was specific.
Furthermore, we failed to detect two abundant tegument proteins, pp28
(ppUL99) and pp150 (ppUL32), as well as glycoprotein B (gpUL55) in the
nuclear matrix, providing additional evidence for the specificity of
the protein-nuclear matrix interactions that we have described (data
not shown). These results were confirmed by immunofluorescence of in
situ-extracted HCMV-infected cells (Fig. 4). Together, these data
suggested that several proteins which were incorporated into nuclear
subviral particles were sequestered on the nuclear matrix.
Enrichment of pp65 on the nuclear matrix was demonstrated by
quantitative Western blotting (Fig. 3; Table 1). The results from this
experiment suggest that pp65 is strongly associated with the nuclear
matrix. Moreover, the localization of pp65 to the nuclear matrix in the
absence of other HCMV proteins indicated a direct interaction with
components of the nuclear matrix. Although initial studies also
documented the association of pp65 with the nuclear matrix of monkey
cells (Fig. 5) and insect cells (data not shown), we obtained
additional evidence of the direct interaction of pp65 with the nuclear
matrix by performing far-Western blotting with recombinant-derived pp65
and the nuclear matrix of HEp-2 cells (Fig. 6A). The results of this
experiment indicated that pp65 associated with a limited number of
protein constituents of the nuclear matrix. The binding of pp65 to a
restricted set of nuclear matrix proteins underscored the specificity
of the protein-protein interactions and suggested the possibility of a
sequence-specific targeting signal for the localization of pp65 to the
nuclear matrix. Although the identities of the nuclear matrix proteins
detected by far-Western blotting have not been conclusively
established, the higher-molecular-weight bands were similar in
molecular size to lamins a, b, and c, which together represent major
protein components of the nuclear matrix (27, 47). Western
blot analysis of the nuclear matrix protein-containing filter showed
that one of the proteins detected by far-Western blotting comigrated
with lamin B1 (Fig. 6A). Additional biochemical evidence for the
interaction between pp65 and lamins was provided by the coprecipitation
of pp65 and lamins from a soluble extract of nuclear matrix proteins
from HCMV-infected fibroblasts (Fig. 6B). The polymerase accessory
protein ppUL44 was not coprecipitated with pp65 and lamins, suggesting
that this was a specific interaction (Fig. 6B). Thus, the binding of
pp65 to a major constituent of the nuclear matrix and colocalization of
pp65 and lamins (Fig. 7) were consistent with the hypothesis that at
least one step in nuclear tegumentation of the HCMV capsid might
localize to this subnuclear compartment. Finally, we have consistently
observed cytoplasmic vacuole-like structures containing pp65 and
nuclear lamins in cells transfected with pp65 expression plasmids which are similar to those illustrated in Fig. 7D and E. This observation and
the accumulation of pp65 on the nuclear membrane suggest a possible
role of pp65 in focal modifications of the nuclear envelope.
In summary, we have provided biochemical and imaging data of the
association of nuclear tegument and capsid proteins of HCMV with the
nuclear matrix. Together, these findings argued for the nuclear matrix
being a potential site for assembly of subviral particles of HCMV and
suggested that protein-protein interactions between virus-encoded
proteins and this nuclear structure might provide spatial coordination
for the highly regulated and temporally coordinated replication of this
virus.
| |
ACKNOWLEDGMENTS |
We thank Robert Goldman and Nilabh Chaudhary for the generous
gifts of antibody 237 and for the rabbit sera against lamins a/c and b,
respectively. We also thank Amy Sears (Department of Microbiology,
Emory University, Atlanta, Ga.) for assistance with the confocal
microscopic analysis and Scott Swindle and Kenneth Fish for technical
advice and helpful discussions. We thank Dana Pinson for assistance
with preparation of the manuscript.
P.C.A. was supported by training grant NIH T32 AI07150 and by grant NIH
R01 AI20408 to J.A.E. V.S. was supported by a grant supplement to
NIH R01 AI30105 and R01 AI35602 to W.J.B.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: the University
of Alabama at Birmingham, 1600 7th Ave. S., Suite 752, Birmingham, AL 35233. Phone: (205) 939-6677. Fax: (205) 975-6549. E-mail:
wbritt{at}peds.uab.edu.
| |
REFERENCES |
| 1.
|
Andreoni, M.,
M. Faircloth,
L. Vugler, and W. Britt.
1989.
A rapid microneutralization assay for the measurement of neutralizing antibody reactive with human cytomegalovirus.
J. Virol. Methods
23:157-168[Medline].
|
| 2.
|
Angeletti, P. C., and J. A. Engler.
1996.
Tyrosine kinase dependent release of an adenovirus preterminal protein complex from the nuclear matrix.
J. Virol.
70:3060-3067[Abstract].
|
| 3.
|
Baldick, C. J., and T. Shenk.
1996.
Proteins associated with purified human cytomegalovirus particles.
J. Virol.
70:6097-6105[Abstract].
|
| 4.
|
Benko, D. M., and W. Gibson.
1986.
Primate cytomegalovirus glycoproteins: lectin-binding properties and sensitivities to glycosidases.
J. Virol.
59:703-713[Abstract/Free Full Text].
|
| 5.
|
Ben-Ze'Ev, A.,
R. Abulafia, and S. Bratosin.
1983.
Herpes simplex virus and protein transport are associated with the cytoskeletal framework and the nuclear matrix in infected BSC-1 cells.
Virology
129:501-507[Medline].
|
| 6.
|
Berezney, R.,
M. J. Mortillaro,
H. Ma,
X. Wei, and J. Samarandu.
1995.
The nuclear matrix: a structural milieu of genomic function.
Int. Rev. Cytol.
162A:1-65.
|
| 7.
|
Bibor-Hardy, V.,
M. Pouchelet,
E. St-Pierre,
M. Herzberg, and R. Simard.
1982.
The nuclear matrix is involved in herpes simplex virogenesis.
Virology
121:296-306[Medline].
|
| 8.
|
Blencowe, B. J.,
R. Issner,
J. Kim,
P. McCaw, and P. A. Sharp.
1995.
New proteins related to the ser-arg family of splicing factors.
RNA
1:852-865[Abstract].
|
| 9.
|
Boppana, S. B., and W. J. Britt.
1996.
Recognition of human cytomegalovirus gene products by HCMV-specific cytotoxic T cells.
Virology
222:293-296[Medline].
|
| 10.
|
Bridge, E.,
M. Carmo-Fonseca,
A. Lamond, and U. Petterson.
1993.
Nuclear organization of splicing small nuclear ribonucleoproteins in adenovirus-infected cells.
J. Virol.
67:5792-5802[Abstract/Free Full Text].
|
| 11.
|
Britt, W. J., and D. Auger.
1986.
Synthesis and processing of the envelope gp55-116 complex of human cytomegalovirus.
J. Virol.
58:185-191[Abstract/Free Full Text].
|
| 12.
|
Britt, W. J., and L. Vugler.
1987.
Structural and immunological characterization of the intracellular forms of an abundant 68,000 Mr human cytomegalovirus protein.
J. Gen. Virol.
68:1897-1907[Abstract/Free Full Text].
|
| 13.
|
Britt, W. J.,
L. Vugler,
E. J. Butfiloski, and E. B. Stephens.
1990.
Cell surface expression of human cytomegalovirus (HCMV) gp55-116 (gB): use of HCMV-recombinant vaccinia virus infected cells in analysis of the human neutralizing antibody response.
J. Virol.
64:1079-1085[Abstract/Free Full Text].
|
| 14.
|
Carvalho, T.,
J.-S. Seeler,
K. Ohman,
P. Jordan,
U. Petterson,
G. Akusjarvi,
M. Carmo-Fonseca, and A. Dejean.
1995.
Targeting of adenovirus E1A and E4-ORF3 proteins to nuclear matrix-associated PML bodies.
J. Cell Biol.
131:45-56[Abstract/Free Full Text].
|
| 15.
|
Chabot, B.,
S. Bisotto, and M. Vincent.
1995.
The nuclear matrix phosphoprotein p255 associates with splicing complexes as part of the [U4/U6.U5] tri-snRNP particle.
Nucleic Acids Res.
23:3206-3213[Abstract/Free Full Text].
|
| 16.
|
Chang, Y. E., and B. Roizman.
1993.
The product of the UL31 gene of herpes simplex virus 1 is a nuclear phosphoprotein which partitions with the nuclear matrix.
J. Virol.
67:6348-6356[Abstract/Free Full Text].
|
| 17.
|
Chaudhary, N., and J.-C. Courvalin.
1993.
Stepwise reassembly of the nuclear envelope at the end of mitosis.
J. Cell Biol.
122:295-306[Abstract/Free Full Text].
|
| 18.
|
de Bruyn Kops, A., and D. M. Knipe.
1994.
Preexisting nuclear architecture defines the intranuclear location of herpesvirus DNA replication structures.
J. Virol.
68:3512-3526[Abstract/Free Full Text].
|
| 19.
|
Di Lazzaro, C.,
G. Campadelli-Fiume, and M. R. Torrisi.
1995.
Intermediate forms of glycoconjugates are present in the envelope of herpes simplex virions during their transport along the exocytic pathway.
Virology
214:619-623[Medline].
|
| 20.
|
Dingwall, C., and R. A. Laskey.
1986.
Protein import into the cell nucleus.
Annu. Rev. Cell Biol.
2:367-390.
|
| 21.
|
Doucas, V.,
A. M. Ishov,
A. Romo,
H. Juguilon,
M. D. Weitzman,
R. M. Evans, and G. G. Maul.
1996.
Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.
Genes Dev.
10:196-207[Abstract/Free Full Text].
|
| 22.
|
Durfee, T.,
M. A. Mancini,
D. Jones,
S. J. Elledge, and W.-H. Lee.
1994.
The amino-terminal region of the retinoblastoma gene product binds a novel nuclear matrix protein that colocalizes to centers for RNA-processing.
J. Cell Biol.
127:609-622[Abstract/Free Full Text].
|
| 23.
|
Fey, E. G., and S. Penman.
1988.
Nuclear matrix proteins reflect cell type of origin in cultured human cells.
Proc. Natl. Acad. Sci. USA
85:121-125[Abstract/Free Full Text].
|
| 24.
| Fish, K. N., and J. A. Nelson.
Unpublished results.
|
| 25.
|
Fredman, J. N., and J. A. Engler.
1993.
Adenovirus precursor to terminal protein interacts with the nuclear matrix in vivo and in vitro.
J. Virol.
67:3384-3395[Abstract/Free Full Text].
|
| 26.
|
Gallina, A.,
E. Percivalle,
L. Simoncini,
M. G. Revello,
G. Gerna, and G. Milanesi.
1996.
Human cytomegalovirus pp65 lower matrix phosphoprotein harbours two transplantable nuclear localization signals.
J. Gen. Virol.
77:1151-1157[Abstract/Free Full Text].
|
| 27.
|
Gerace, L., and B. Burke.
1988.
Functional organization of the nuclear envelope.
Annu. Rev. Cell Biol.
4:335-374.
|
| 28.
|
Getzenberg, R. H.
1994.
Nuclear matrix and the regulation of gene expression: tissue specificity.
J. Cell. Biochem.
55:22-31[Medline].
|
| 29.
|
Goldman, A. E.,
R. D. Moir,
M. Montag-Lowy,
M. Stewart, and R. D. Goldman.
1992.
Pathway of incorporation of microinjected lamin A into the nuclear envelope.
J. Cell Biol.
119:725-735[Abstract/Free Full Text].
|
| 30.
|
Granzow, H.,
F. Weiland,
A. Jons,
B. G. Klupp,
A. Karger, and T. C. Mettenleiter.
1997.
Ultrastructural analysis of the replication cycle of pseudorabies virus in cell culture: a reassessment.
J. Virol.
71:2072-2082[Abstract].
|
| 31.
|
Greenfield, I.,
J. Nickerson,
S. Penman, and M. Stanley.
1991.
Human papillomavirus 16 E7 protein is associated with the nuclear matrix.
Proc. Natl. Acad. Sci. USA
88:11217-11221[Abstract/Free Full Text].
|
| 32.
|
Guo, B.,
P. R. Odgren,
A. J. Van Wijnen,
T. J. Last,
J. Nickerson,
S. Penman,
J. B. Lian,
J. L. Stein, and G. S. Stein.
1995.
The nuclear matrix protein NMP-1 is the transcription factor YY1.
Proc. Natl. Acad. Sci. USA
92:10526-10530[Abstract/Free Full Text].
|
| 33.
|
He, D.,
J. A. Nickerson, and S. Penman.
1990.
Core filaments of the nuclear matrix.
J. Cell Biol.
110:569-580[Abstract/Free Full Text].
|
| 34.
|
Hensel, G.,
H. Meyer,
S. Gärtner,
G. Brand, and H. F. Kern.
1995.
Nuclear localization of the human cytomegalovirus tegument protein pp150 (UL32).
J. Gen. Virol.
76:1591-1601[Abstract/Free Full Text].
|
| 35.
|
Hozac, P.,
A. B. Hassan,
D. A. Jackson, and P. R. Cook.
1993.
Visualization of replication factories attached to a nucleoskeleton.
Cell
73:361-373[Medline].
|
| 36.
|
Irmiere, A., and W. Gibson.
1983.
Isolation and characterization of a noninfectious virion-like particle released from cells infected with human strains of cytomegalovirus.
Virology
30:118-133.
|
| 37.
|
Khittoo, G.,
L. Delorme,
C. V. Dery,
M. L. Tremblay,
J. M. Weber,
V. Bibor-Hardy, and R. Simard.
1986.
Role of the nuclear matrix in adenovirus maturation.
Virus Res.
5:391-403[Medline].
|
| 38.
|
Landini, M. P.,
B. Severi,
G. Furlini, and L. Badiali De Giorgi.
1987.
Human cytomegalovirus structural components: intracellular and intraviral localization of p28 and p65-69 by immunoelectron microscopy.
Virus Res.
8:15-23[Medline].
|
| 39.
|
Lauber, A. H.,
N. P. Sandhu,
M. Schuchard,
M. Subramanian, and T. C. Spelsberg.
1995.
Nuclear matrix acceptor binding sites for steroid hormone receptors: a candidate nuclear matrix acceptor protein.
Int. Rev. Cytol.
162B:337-375.
|
| 40.
|
Liao, H.,
R. J. Winkfein,
G. Mack,
J. B. Rattner, and T. J. Yen.
1995.
CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis.
J. Cell Biol.
130:507-518[Abstract/Free Full Text].
|
| 41.
|
Liptak, L.,
S. L. Uprichard, and D. M. Knipe.
1996.
Functional order of assembly of herpes simplex virus DNA replication proteins into prereplicative site structures.
J. Virol.
70:1759-1767[Abstract].
|
| 42.
|
Lukonis, C. J., and S. K. Weller.
1996.
Characterization of nuclear structures in cells infected with herpes simplex virus type 1 in the absence of viral DNA replication.
J. Virol.
70:1751-1758[Abstract].
|
| 43.
|
Mancini, M.,
B. Shan,
J. A. Nickerson,
S. Penman, and W.-H. Lee.
1994.
The retinoblastoma gene product is a cell cycle-dependent, nuclear matrix-associated protein.
Proc. Natl. Acad. Sci. USA
91:418-422[Abstract/Free Full Text].
|
| 44.
|
Maul, G. G.,
A. M. Ishov, and R. D. Everett.
1996.
Nuclear domain 10 as preexisting potential replication start site of herpes simplex virus type-1.
Virology
217:67-75[Medline].
|
| 45.
|
Mirkovitch, J.,
M. E. Mirault, and U. K. Laemmli.
1984.
Organization of the higher-order chromatin loop: specific DNA attachment sites on the nuclear scaffold.
Cell
39:223-232[Medline].
|
| 46.
|
Mocarski, E. S.
1996.
Cytomegaloviruses and their replication, p. 2447-2492. In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Strauss (ed.), Fields virology, 3rd ed.
Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 47.
|
Newport, J. W., and D. J. Forbes.
1987.
The nucleus: structure, function, and dynamics.
Annu. Rev. Biochem.
56:535-565[Medline].
|
| 48.
|
Nickerson, J. A.,
B. Blencowe, and S. Penman.
1995.
The architectural organization of nuclear metabolism.
Int. Rev. Cytol.
162A:67-123.
|
| 49.
|
Pienta, K. J., and C. N. Hoover.
1994.
Coupling of cell structure to cell metabolism and function.
J. Cell. Biochem.
55:16-21[Medline].
|
| 50.
|
Plachter, B.,
W. Britt,
R. Vornhagen,
T. Stamminger, and G. Jahn.
1993.
Analysis of proteins encoded by IE regions 1 and 2 of human cytomegalovirus using monoclonal antibodies generated against recombinant antigens.
Virology
193:642-652[Medline].
|
| 51.
|
Pombo, A.,
J. Ferreira,
E. Bridge, and M. Carmo-Fonseca.
1994.
Adenovirus replication and transcription sites are spatially separated in the nucleus of infected cells.
EMBO J.
13:5075-5085[Medline].
|
| 52.
|
Radha, V.,
S. Nambirajan, and G. Swarup.
1996.
Association of Lyn tyrosine kinase with the nuclear matrix and cell cycle-dependent changes in matrix-associated tyrosine kinase activity.
Eur. J. Biochem.
23:352-359.
|
| 53.
|
Roffman, E.,
J. P. Albert,
J. P. Goff, and N. Frenkel.
1990.
Putative site for the acquisition of human herpesvirus 6 virion tegument.
J. Virol.
64:6308-6313[Abstract/Free Full Text].
|
| 54.
|
Roizman, B.
1996.
Herpesviridae, p. 2221-2230. In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Strauss (ed.), Fields virology, 3rd ed.
Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 55.
|
Roizman, B., and D. Furlong.
1974.
The replication of herpesviruses, p. 229-403. In
H. Fraenkel-Conrat, and R. R. Wagner (ed.), Comprehensive virology, vol. 3.
Plenum Press, New York, N.Y.
|
| 56.
|
Roizman, B., and A. E. Sears.
1996.
Herpes simplex viruses and their replication, p. 2231-2295. In
B. N. Fields, D. M. Knipe, P. M. Howley, R. M. Chanock, J. L. Melnick, T. P. Monath, B. Roizman, and S. E. Strauss (ed.), Fields virology, 3rd ed.
Lippincott-Raven Publishers, Philadelphia, Pa.
|
| 57.
|
Rose, J. K.,
L. Buonocore, and M. A. Whitt.
1991.
A new liposome reagent mediating nearly quantitative transfection of animal cells.
Bio/Technology
10:520-525.
|
| 58.
|
Sanchez, V.,
K. Greis,
Y. Akimoto,
G. Hart, and W. J. Britt.
1996.
Assembly of HCMV tegument occurs in different cellular compartments..
Abstracts from the 21st Herpesvirus Workshop
.
|
| 59.
|
Sarisky, R. T., and G. S. Hayward.
1996.
Evidence that the UL84 gene product of human cytomegalovirus is essential for promoting oriLyt-dependent DNA replication and formation of replication compartments in cotransfection assays.
J. Virol.
70:7398-7413[Abstract].
|
| 60.
|
Schirmbeck, R., and W. Deppert.
1989.
Nuclear subcompartmentalization of simian virus 40 large T antigen: evidence for in vivo regulation of biochemical activities.
J. Virol.
63:2308-2316[Abstract/Free Full Text].
|
| 61.
|
Schmolke, S.,
P. Drescher,
G. Jahn, and B. Placter.
1995.
Nuclear targeting of the tegument protein pp65 (UL83) of human cytomegalovirus: an unusual bipartite nuclear localization signal functions with other portions of the protein to mediate its efficient nuclear transport.
J. Virol.
69:1071-1078[Abstract].
|
| 62.
|
Stein, G. S.,
A. J. van Wijnen,
J. L. Stein,
J. B. Lian,
J. P. Bidwell, and M. Montecino.
1994.
Nuclear architecture supports integration of physiological regulatory signals for transcription of cell growth and tissue-specific genes during osteoblast differentiation.
J. Cell. Biochem.
55:4-15[Medline].
|
| 63.
|
Ward, P. L.,
D. E. Barker, and B. Roizman.
1996.
A novel herpes simplex virus 1 gene, UL43.5, maps antisense to the UL43 gene and encodes a protein which colocalizes in nuclear structures with capsid proteins.
J. Virol.
70:2684-2690[Abstract].
|
| 64.
|
Ward, P. L.,
W. O. Ogle, and B. Roizman.
1996.
Assemblons: nuclear structures defined by aggregation of immature capsids and some tegument proteins of herpes simplex virus 1.
J. Virol.
70:4623-4631[Abstract].
|
| 65.
|
Winkler, M.,
S. A. Rice, and T. Stamminger.
1994.
UL69 of human cytomegalovirus, an open reading frame with homology to ICP27 of herpes simplex virus, encodes a transactivator of gene expression.
J. Virol.
68:3943-3954[Abstract/Free Full Text].
|
| 66.
|
Zhonghe, Z.,
J. A. Nickerson,
G. Krochmalnic, and S. Penman.
1987.
Alterations in nuclear matrix structure after adenovirus infection.
J. Virol.
61:1007-1018[Abstract/Free Full Text].
|
J Virol, April 1998, p. 3321-3329, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Bentz, G. L., Jarquin-Pardo, M., Chan, G., Smith, M. S., Sinzger, C., Yurochko, A. D.
(2006). Human Cytomegalovirus (HCMV) Infection of Endothelial Cells Promotes Naive Monocyte Extravasation and Transfer of Productive Virus To Enhance Hematogenous Dissemination of HCMV. J. Virol.
80: 11539-11555
[Abstract]
[Full Text]
-
AuCoin, D. P., Smith, G. B., Meiering, C. D., Mocarski, E. S.
(2006). Betaherpesvirus-Conserved Cytomegalovirus Tegument Protein ppUL32 (pp150) Controls Cytoplasmic Events during Virion Maturation.. J. Virol.
80: 8199-8210
[Abstract]
[Full Text]
-
Shimamura, M., Mach, M., Britt, W. J.
(2006). Human Cytomegalovirus Infection Elicits a Glycoprotein M (gM)/gN-Specific Virus-Neutralizing Antibody Response. J. Virol.
80: 4591-4600
[Abstract]
[Full Text]
-
Yue, Y., Kaur, A., Zhou, S. S., Barry, P. A.
(2006). Characterization and immunological analysis of the rhesus cytomegalovirus homologue (Rh112) of the human cytomegalovirus UL83 lower matrix phosphoprotein (pp65).. J. Gen. Virol.
87: 777-787
[Abstract]
[Full Text]
-
Prichard, M. N., Britt, W. J., Daily, S. L., Hartline, C. B., Kern, E. R.
(2005). Human Cytomegalovirus UL97 Kinase Is Required for the Normal Intranuclear Distribution of pp65 and Virion Morphogenesis. J. Virol.
79: 15494-15502
[Abstract]
[Full Text]
-
Iversen, A.-C., Norris, P. S., Ware, C. F., Benedict, C. A.
(2005). Human NK Cells Inhibit Cytomegalovirus Replication through a Noncytolytic Mechanism Involving Lymphotoxin-Dependent Induction of IFN-{beta}. J. Immunol.
175: 7568-7574
[Abstract]
[Full Text]
-
Marschall, M., Marzi, A., Siepen, P. a. d., Jochmann, R., Kalmer, M., Auerochs, S., Lischka, P., Leis, M., Stamminger, T.
(2005). Cellular p32 Recruits Cytomegalovirus Kinase pUL97 to Redistribute the Nuclear Lamina. J. Biol. Chem.
280: 33357-33367
[Abstract]
[Full Text]
-
Terhune, S. S., Schroer, J., Shenk, T.
(2004). RNAs Are Packaged into Human Cytomegalovirus Virions in Proportion to Their Intracellular Concentration. J. Virol.
78: 10390-10398
[Abstract]
[Full Text]
-
McGregor, A., Liu, F., Schleiss, M. R.
(2004). Molecular, Biological, and In Vivo Characterization of the Guinea Pig Cytomegalovirus (CMV) Homologs of the Human CMV Matrix Proteins pp71 (UL82) and pp65 (UL83). J. Virol.
78: 9872-9889
[Abstract]
[Full Text]
-
Maglova, L. M., Crowe, W. E., Russell, J. M.
(2004). Perinuclear localization of Na-K-Cl-cotransporter protein after human cytomegalovirus infection. Am. J. Physiol. Cell Physiol.
286: C1324-C1334
[Abstract]
[Full Text]
-
Sanchez, V., McElroy, A. K., Spector, D. H.
(2003). Mechanisms Governing Maintenance of Cdk1/Cyclin B1 Kinase Activity in Cells Infected with Human Cytomegalovirus. J. Virol.
77: 13214-13224
[Abstract]
[Full Text]
-
Silva, M. C., Yu, Q.-C., Enquist, L., Shenk, T.
(2003). Human Cytomegalovirus UL99-Encoded pp28 Is Required for the Cytoplasmic Envelopment of Tegument-Associated Capsids. J. Virol.
77: 10594-10605
[Abstract]
[Full Text]
-
Homman-Loudiyi, M., Hultenby, K., Britt, W., Soderberg-Naucler, C.
(2003). Envelopment of Human Cytomegalovirus Occurs by Budding into Golgi-Derived Vacuole Compartments Positive for gB, Rab 3, Trans-Golgi Network 46, and Mannosidase II. J. Virol.
77: 3191-3203
[Abstract]
[Full Text]
-
Lai, L., Britt, W. J.
(2003). The Interaction between the Major Capsid Protein and the Smallest Capsid Protein of Human Cytomegalovirus Is Dependent on Two Linear Sequences in the Smallest Capsid Protein. J. Virol.
77: 2730-2735
[Abstract]
[Full Text]
-
Blankenship, C. A., Shenk, T.
(2002). Mutant Human Cytomegalovirus Lacking the Immediate-Early TRS1 Coding Region Exhibits a Late Defect. J. Virol.
76: 12290-12299
[Abstract]
[Full Text]
-
Dal Monte, P., Pignatelli, S., Zini, N., Maraldi, N. M., Perret, E., Prevost, M. C., Landini, M. P.
(2002). Analysis of intracellular and intraviral localization of the human cytomegalovirus UL53 protein. J. Gen. Virol.
83: 1005-1012
[Abstract]
[Full Text]
-
Sanchez, V., Clark, C. L., Yen, J. Y., Dwarakanath, R., Spector, D. H.
(2002). Viable Human Cytomegalovirus Recombinant Virus with an Internal Deletion of the IE2 86 Gene Affects Late Stages of Viral Replication. J. Virol.
76: 2973-2989
[Abstract]
[Full Text]
-
Ren, X., Harms, J. S., Splitter, G. A.
(2001). Tyrosine Phosphorylation of Bovine Herpesvirus 1 Tegument Protein VP22 Correlates with the Incorporation of VP22 into Virions. J. Virol.
75: 9010-9017
[Abstract]
[Full Text]
-
Benz, C., Reusch, U., Muranyi, W., Brune, W., Atalay, R., Hengel, H.
(2001). Efficient downregulation of major histocompatibility complex class I molecules in human epithelial cells infected with cytomegalovirus. J. Gen. Virol.
82: 2061-2070
[Abstract]
[Full Text]
-
Sanchez, V., Sztul, E., Britt, W. J.
(2000). Human Cytomegalovirus pp28 (UL99) Localizes to a Cytoplasmic Compartment Which Overlaps the Endoplasmic Reticulum-Golgi-Intermediate Compartment. J. Virol.
74: 3842-3851
[Abstract]
[Full Text]
-
Sanchez, V., Greis, K. D., Sztul, E., Britt, W. J.
(2000). Accumulation of Virion Tegument and Envelope Proteins in a Stable Cytoplasmic Compartment during Human Cytomegalovirus Replication: Characterization of a Potential Site of Virus Assembly. J. Virol.
74: 975-986
[Abstract]
[Full Text]
-
Sun, Q., Pollok, K. E., Burton, R. L., Dai, L. J., Britt, W., Emanuel, D. J., Lucas, K. G.
(1999). Simultaneous Ex Vivo Expansion of Cytomegalovirus and Epstein-Barr Virus-Specific Cytotoxic T Lymphocytes Using B-Lymphoblastoid Cell Lines Expressing Cytomegalovirus pp65. Blood
94: 3242-3250
[Abstract]
[Full Text]
-
Beuken, E., Grauls, G., Bruggeman, C. A., Vink, C.
(1999). The rat cytomegalovirus R32 gene encodes a virion-associated protein that elicits a strong humoral immune response in infected rats. J. Gen. Virol.
80: 2719-2728
[Abstract]
[Full Text]
-
Zini, N., Battista, M. C., Santi, S., Riccio, M., Bergamini, G., Landini, M. P., Maraldi, N. M.
(1999). The Novel Structural Protein of Human Cytomegalovirus, pUL25, Is Localized in the Viral Tegument. J. Virol.
73: 6073-6075
[Abstract]
[Full Text]
-
Benedict, C. A., Butrovich, K. D., Lurain, N. S., Corbeil, J., Rooney, I., Schneider, P., Tschopp, J., Ware, C. F.
(1999). Cutting Edge: A Novel Viral TNF Receptor Superfamily Member in Virulent Strains of Human Cytomegalovirus. J. Immunol.
162: 6967-6970
[Abstract]
[Full Text]
-
Battista, M. C., Bergamini, G., Boccuni, M. C., Campanini, F., Ripalti, A., Landini, M. P.
(1999). Expression and Characterization of a Novel Structural Protein of Human Cytomegalovirus, pUL25. J. Virol.
73: 3800-3809
[Abstract]
[Full Text]
-
Gallina, A., Simoncini, L., Garbelli, S., Percivalle, E., Pedrali-Noy, G., Lee, K. S., Erikson, R. L., Plachter, B., Gerna, G., Milanesi, G.
(1999). Polo-Like Kinase 1 as a Target for Human Cytomegalovirus pp65 Lower Matrix Protein. J. Virol.
73: 1468-1478
[Abstract]
[Full Text]
-
Angeletti, P. C., Engler, J. A.
(1998). Adenovirus Preterminal Protein Binds to the CAD Enzyme at Active Sites of Viral DNA Replication on the Nuclear Matrix. J. Virol.
72: 2896-2904
[Abstract]
[Full Text]
Top
Abstract
Introduction
