This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García-Escudero, R.
Right arrow Articles by Viñuela, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García-Escudero, R.
Right arrow Articles by Viñuela, E.

 Previous Article  |  Next Article 

J Virol, April 1998, p. 3185-3195, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Inducible Gene Expression from African Swine Fever Virus Recombinants: Analysis of the Major Capsid Protein p72

Ramón García-Escudero, Germán Andrés, Fernando Almazán,dagger and Eladio Viñuela*

Centro de Biología Molecular "Severo Ochoa" (Consejo Superior de Investigaciones Científicas---Universidad Autónoma de Madrid), Facultad de Ciencias, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain

Received 17 October 1997/Accepted 11 December 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

A method to study the function of individual African swine fever virus (ASFV) gene products utilizing the Escherichia coli lac repressor-operator system has been developed. Recombinant viruses containing both the lacI gene encoding the lac repressor and a strong virus late promoter modified by the insertion of one or two copies of the lac operator sequence at various positions were constructed. The ability of each modified promoter to regulate expression of the firefly luciferase gene was assayed in the presence and in the absence of the inducer isopropyl beta -D-thiogalactoside (IPTG). Induction and repression of gene activity were dependent on the position(s) of the operator(s) with respect to the promoter and on the number of operators inserted. The ability of this system to regulate the expression of ASFV genes was analyzed by constructing a recombinant virus inducibly expressing the major capsid protein p72. Electron microscopy analysis revealed that under nonpermissive conditions, electron-dense membrane-like structures accumulated in the viral factories and capsid formation was inhibited. Induction of p72 expression allowed the progressive building of the capsid on these structures, leading to assembly of ASFV particles. The results of this report demonstrate that the transferred inducible expression system is a powerful tool for analyzing the function of ASFV genes.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

African swine fever virus (ASFV), the only known member of the genus "African swine fever-like viruses" (25), is the causative agent of a severe disease of swine. Besides its ability to infect different species of suids, ASFV infects soft ticks of the Ornithodoros genus (56, 58), which act as vectors for the virus propagation. The viral genome is a single molecule of double-stranded DNA ranging in size from 170 to 190 kbp, depending on the virus strain (9). The analysis of the complete nucleotide sequence of the avirulent isolate BA71V has revealed the existence of 151 putative genes (61). The virus encodes enzymes involved in DNA replication, gene transcription, and protein modification, as well as proteins that may modulate the host immune response against infection. The functions of some of these proteins have been analyzed (61), and the coding sequences for 12 structural proteins have been reported (17, 39, 51, 52, 61). However, the functions of most of the virus-encoded proteins are unknown. The virus particle, which shows a morphology very similar to that of iridoviruses (15), has a diameter of about 200 nm and comprises several concentric domains. The central structure is the viral core, which is composed of a DNA-containing nucleoid surrounded by a thick protein layer, the core shell. The viral core is wrapped by a lipid envelope and an icosahedral capsid (4, 15). Extracellular ASFV particles usually possess an additional membrane acquired by budding through the plasma membrane (11).

In an attempt to facilitate the analysis of the role of individual ASFV genes, we have developed a system for inducible gene expression from ASFV recombinants. In a previous report, we showed that the ASFV genome can be genetically manipulated by homologous recombination (45). Recombinant viruses can be selected by following the expression of either the Escherichia coli lacZ gene, which encodes beta -galactosidase (beta -Gal) (45), or the E. coli gusA gene, which encodes beta -glucuronidase (GUS) (28). Both markers enable ASFV recombinants with multiple genetic modifications to be obtained (42). By using this approach, we have inserted into the ASFV genome an inducible expression system based on the E. coli lac operon. This allows the expression of genes to be conditionally, temporally, and quantitatively regulated, either individually or in combination with other genes.

Enzymes encoded within the lac operon are under the negative control of a repressor which can bind specifically and with high affinity to a sequence of 21 bp representing the functional core of the operator sequence, known as O1 (8). The lac repressor can also bind to allolactose or to nonmetabolizable derivatives, such as isopropyl beta -D-thiogalactoside (IPTG), which decrease the affinity of the repressor for the operator. In this manner, IPTG can diminish the repression of lac operon transcription, resulting in an induction of expression. The system has been well characterized and can regulate the expression of transfected and integrated reporter genes in mammalian cells (for a review, see reference 30). This system has also been used to regulate gene expression in cells infected with recombinant vaccinia virus (1, 27, 43), constituting a powerful tool for the analysis of virus morphogenesis (47), transcriptional regulation (62), and virus-host cell interactions (36).

The utility of the system described below is shown by the inducible expression of foreign firefly luciferase (24) and the ASFV major capsid protein p72 (37). A recombinant virus which inducibly expresses the protein p72 (vA72) was absolutely dependent on the addition of the inducer for production of infectious virus. Electron microscopic analysis of vA72-infected cell factories showed that induction of p72 synthesis leads to progressive formation of the capsid on the external surfaces of previously accumulated electron-dense membranous structures. These viral membranes become polyhedral structures which evolve toward the generation of virus particles.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Cells and viruses. Vero cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. The ASFV strain BA71V was propagated and titrated as previously described (26). Virus infections were carried out with DMEM containing 2% fetal bovine serum. Recombinant virus vA72 was grown in the presence of 1.25 mM IPTG.

Antibodies. The monoclonal antibodies 17L.D3 and 19B.A2, and the rat serum against protein p72, have been described previously (14, 29, 48). The rabbit polyclonal anti-p37/p14 serum, which also recognizes the precursor form pp220, has been described before (50). The secondary antibodies for immunoelectron microscopy, rabbit anti-mouse immunoglobulin G (IgG) and IgM and goat anti-rat Ig, were obtained from Dako and Nordic, respectively.

Plasmid construction. (i) pU104GUSREP. A 122-bp DNA fragment containing the promoter sequence of the early ASFV gene U104L (2) was generated by PCR using the primers 5'-GCGCGAATTCGTCGACGGATTTTAATTAGATTTGTGA and 5'-GCGCTCTAGATGTAGTGTTATATTACGAAAA, which contain EcoRI and XbaI restriction endonuclease sites at their 5' ends, respectively. The PCR product was digested with EcoRI and XbaI and was cloned into EcoRI-XbaI-digested pUC119 to generate the plasmid p119pU104. A 398-bp DNA fragment containing the 5' end of the lacI gene of E. coli was obtained by PCR from the pRSV-1 plasmid (32), by using the primers 5'-CGCGAAGCTTCTAGATGAAACCAGTAACGTTATACG and 5'-CCAGCGGATAGTTAATGATCAGC (the former contains HindIII and XbaI sites at the 5' end). The synthetic PCR fragment was cut with HindIII and MluI and was cloned into pRSV-1 digested with HindIII and MluI to generate pREP. A 1.2-kb XbaI fragment from pREP containing the complete lacI coding sequence was cloned into p119pU104 digested with XbaI, generating the plasmid pU104REP. Plasmid pU104REP10T was obtained by cloning a Klenow enzyme-treated 1.3-kb SalI fragment from pU104REP into p119.10T (28) digested with SmaI. A 1.3-kb SalI/EcoRI/Klenow enzyme-treated fragment from pU104REP10T was cloned into SmaI-digested pINSGUS (28), producing the transfer vector pU104GUSREP10T. pINSGUS contains BA71V EcoRI fragment sequences, including the nonessential coding sequence of the thymidine kinase (TK) gene, which had previously been used as a locus for the insertion of foreign genes.

(ii) pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II. A DNA fragment containing the core sequence of the E. coli lac operator O1 was generated by annealing the partially overlapping oligonucleotides 5'-GATCTAATTGTGAGCGGATAACAATTG and 5'-GATCCAATTGTTATCCGCTCACAATTA (the core sequence of the lac operator is underlined). The resultant hybrid contains one end compatible with BamHI, so that the cloning of one or more copies of the fragment into a BamHI site results in the retention of a single BamHI site in the derivative plasmid. After annealing, the DNA fragment was incubated with T4 polynucleotide kinase and ATP and was ligated into the plasmid p72.4 (28) digested with BamHI. Two plasmids, p72.I and p72.II, containing one and two copies, respectively, of the operator sequence downstream of the viral late p72.4 promoter and upstream of a unique BamHI site, were selected. A 118-bp PCR DNA fragment containing the p72.4 promoter and the core sequence of the operator was generated from the p72.4 plasmid by using the oligonucleotides 5'-CGCGAGATCTTTGTTATTATCAAGATCC and 5'-GCGCGGATCCAATTGTTATCCGCTCACAATTTATATAATGTTATAAAAATAATTT, which contain, respectively, the restriction sites BglII and BamHI at their 5' ends. The PCR product was digested with BamHI and BglII and was then inserted into BamHI-linearized pUC118 to generate the plasmid p72.*I. By following the procedure used to generate p72.I, a second copy of the operator was inserted into the BamHI site of p72.*I to obtain the plasmid p72.*II. A 1.4-kb fragment containing the Photinus pyralis luciferase gene (24) was extracted from pKLuc and cloned into the BamHI sites of plasmids p72.4, p72.I, p72.II, p72.*I, and p72.*II, generating, respectively, p72.4.luc, p72.I.luc, p72.II.luc, p72.*I.luc, and p72.*II.luc. A 3.3-kb XbaI/Klenow enzyme-treated fragment from pINS72-beta gal (45), which contains the chimeric gene p72-lacZ (p72 promoter and lacZ gene), was cloned into p72.4.luc, p72.I.luc, p72.II.luc, p72.*I.luc, and p72.*II.luc linearized with SalI and 3'-end filled with Klenow enzyme to generate, respectively, pUCgal.luc, pUCgal.luc.I, pUCgal.luc.II, pUCgal.luc.*I, and pUCgal.luc.*II. Transfer vectors pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II were generated by inserting 5.2-kb HindIII/Klenow enzyme/SmaI-treated fragments from pUCgal.luc, pUCgal.luc.I, pUCgal.luc.II, pUCgal.luc.*I, and pUCgal.luc.*II, respectively, into pE'(HdA) linearized with EcoRV. pE'(HdA) was obtained by inserting a HindIII-to-AccI fragment of the EcoRI E' fragment of BA71V DNA into HindIII/AccI-digested pUC119. This fragment contains the CD2 coding sequence, which has previously been used as a locus for insertion of foreign sequences in ASFV recombinants (46).

(iii) pINDp72.I.beta gal(d) and pINDp72.I.beta gal(i). A synthetic DNA fragment of 427 bp, which contains the nucleotide sequence from -513 to -111 relative to the translation initiation codon of the ASFV B646L gene encoding the protein p72, was obtained by PCR from purified virus DNA by using the primers 5'-CGCGAATTCTTTATTTATCTTTTAC and 5'-CGCGAGATCTTAATTAACGATCAGC (these primers include EcoRI and BglII restriction sites at their respective 5' ends). pFl1 was generated by inserting this PCR fragment, cut with EcoRI and BglII, into BamHI/EcoRI-treated pUC118. The oligonucleotides 5'-CGCGGATCCATGGCATCAGGAGGAG and 5'-CGCGAGATCTAGCTGACCATGGGCC were used as primers to obtain a 422-bp PCR DNA fragment corresponding to the 5' end (400 bp) of the B646L coding sequence (the primers include, respectively, BamHI and BglII restriction sites at their 5' ends). The PCR fragment was digested with BglII and BamHI and inserted into BamHI-linearized p72.I, producing the plasmid pFl2-p72.I. A 524-bp SmaI-to-XbaI fragment treated with Klenow enzyme from pFl2-p72.I was cloned into pFl1 digested with HindIII and treated with Klenow enzyme, producing the plasmid pINDp72.I. A 3.3-kb fragment obtained by digestion with SmaI and SalI endonucleases and treatment with Klenow enzyme from p72GAL10T (28) was cloned into SalI-linearized and Klenow enzyme-treated pINDp72.I, producing the transfer vectors pINDp72.I.beta gal(d) and pINDp72.I.beta gal(i), where the p72-lacZ chimeric gene was inserted in the same or in the opposite transcriptional orientation as the B646L gene, respectively.

Generation of recombinant viruses. Recombinant viruses were generated as previously described (45). The structures of all the recombinant viruses described in this report were confirmed by DNA hybridization analysis (data not shown). The runs of seven or more consecutive thymidylate (T) residues in the coding strand are signals for mRNA 3'-end formation (2, 3). Thus, to minimize the risk of causing transcriptional disturbances when inserting chimeric genes into the virus genome, signals for the 3'-end formation of ASFV mRNAs were placed in transfer vectors. The positions of these signals in the viral genome of ASFV recombinants generated in this report are indicated in Fig. 1, 2A, and 3A.

(i) vGUSREP. Transfer vector pU104GUSREP10T, which contains a copy of the E. coli lacI gene under the control of the early virus promoter pU104 and the chimeric gene p72.4-gusA flanked by BA71V TK DNA sequences, was used to insert the lacI gene into the virus genome. Vero cells were infected with the BA71V strain of ASFV and transfected with pU104GUSREP10T. At 48 h postinfection (hpi), cells were harvested and diluted samples were used to infect Vero cell monolayers. The infected cells were covered with agar, and 4 days later, the GUS substrate 5-bromo-4-chloro-3-indolyl-beta -D-glucuronic acid (X-Gluc) was added to the culture medium. The blue-stained recombinant plaques were selected and used to infect fresh monolayers of Vero cells. In this way, the recombinant virus vGUSREP was purified by three successive rounds of plaque isolation.

(ii) vA2, vA3, vA4, vA5, and vA6. Transfer vectors pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II, containing different p72.4 promoter-operator-luciferase chimeric genes and the gene cassette p72-lacZ, flanked by BA71V CD2 DNA sequences, were used to obtain the recombinant viruses vA2, vA3, vA4, vA5, and vA6, respectively, from the recombinant virus vGUSREP. These recombinants were obtained in a similar way as vGUSREP, but the beta -Gal substrate X-Gal (5-bromo-4-chloro-3-indolyl-beta -D-galactopyranoside) was used for the selection of the blue-stained recombinant plaques.

(iii) vA72. Transfer vectors pINDp72.I.beta gal(d) and pINDp72.I.beta gal(i) were used to generate the vA72 recombinant, in which an operator sequence was inserted between the p72 promoter and the B646L gene, which encodes the protein p72. They contain the gene cassette p72-lacZ and the operator sequence placed 8 bp downstream of the transcription initiation site of the p72.4 promoter. These sequences were flanked by the nucleotide sequence from -513 to -111 relative to the translation start codon of the B646L gene and a 400-bp sequence corresponding to the 5' end of the gene. All the purification steps were carried out in the presence of 1.25 mM IPTG, and the vA72 recombinant was obtained from transfer vector pINDp72.I.beta gal(i).

Luciferase assay. Vero cell monolayers cultured in 24-well plates were infected at 20 PFU per cell in the presence or in the absence of IPTG. Infected cells were harvested 24 hpi and were processed for luciferase activity determination as previously described (28). Protein levels were determined as described elsewhere (10).

Metabolic labeling and immunoprecipitation analysis. Vero cell cultures were infected at 5 PFU per cell and pulse-labeled for 1 h with [35S]methionine at 16 hpi in methionine-free medium. The radioactive samples were dissociated and immunoprecipitated with the corresponding antibodies and protein A-coated Sepharose (31). For the electrophoretic analysis, whole extracts or immune complexes were solubilized by boiling in Laemmli sample buffer (0.05 M Tris-HCl [pH 6.8], 2% sodium dodecyl sulfate (SDS), 0.1 M dithiothreitol, 10% glycerol) and were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) (7 to 20% polyacrylamide) as previously described (34). Radioactive proteins were detected by fluorography (35).

Electron microscopy. For Epon embedding and postembedding immunolabeling, infected Vero cells were detached from the tissue culture dish at the indicated times by treatment with proteinase K (50 µg/ml) on ice for 2 to 3 min. For conventional Epon embedding, cells were fixed with 2% glutaraldehyde and 2% tannic acid in phosphate-buffered saline at room temperature for 1 h. Postfixing was carried out with 1% OsO4 in phosphate-buffered saline at 4°C for 30 min. For postembedding immunolabeling, cells were fixed with 8% paraformaldehyde at 4°C for 1 h and processed for Lowicryl embedding as described elsewhere (12). Immunogold labeling was performed as previously described (4) with a rat serum against p72, a goat anti-rat Ig, and protein A-gold complexes (15 nm; BioCell Research Laboratories, Cardiff, United Kingdom).

For preembedding immunolabeling, cells were processed as previously described (53). In general, Vero cells were permeabilized with 4 U of the bacterial toxin streptolysin O (Sigma)/ml and fixed with 4% paraformaldehyde for 5 min on ice. Cells were sequentially incubated with a rat serum against p72 or a mixture of monoclonal antibodies (17L.D3 and 19B.A2), anti-p72 (48), and protein A-gold complexes (5 nm), and were postfixed in 1% glutaraldehyde. Finally, cells were stained with 1% OsO4-1.5% K3Fe(CN)6 for 60 min, followed by 1% magnesium uranyl acetate for 60 min, and were processed for conventional Epon embedding.

Specimens were viewed with a JEOL 1010 or a JEOL 1200× electron microscope.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Generation of an ASFV recombinant expressing the lac repressor protein. In order to incorporate into ASFV the inducible expression system based on the E. coli lac operon, we first generated a recombinant virus expressing the lac repressor protein. This virus was obtained by cloning the lacI gene into a transfer vector downstream of the promoter of the ASFV U104L early gene (2). The resulting virus, vGUSREP, possesses the genomic structure shown in Fig. 1, where the coding sequences of lacI and a reporter gene, gusA, are inserted into the nonessential TK gene (45) of the virus strain BA71V. The gusA gene, which encodes GUS, allowed for the selection and purification of vGUSREP by blue staining of the recombinant plaques with the enzyme substrate X-Gluc as previously shown (28). The presence of functional repressor protein in vGUSREP-infected cells was confirmed by gel retardation analysis of a radiolabeled DNA fragment containing the core 21-bp operator O1 sequence (data not shown).


View larger version (7K):
[in this window]
[in a new window]
 
FIG. 1.   Genomic structure of the recombinant virus vGUSREP. The lacI gene fused to the viral promoter pU104 and the gusA gene fused to the viral promoter p72.4 are inserted into the TK locus of the ASFV strain BA71V. Signals for 3'-end mRNA formation are indicated (bullet |).

Generation of vGUSREP-derived recombinant viruses with hybrid virus promoters containing the lac operator sequence. To test if the repressor protein was able to control the gene expression from ASFV recombinants, we generated different hybrid virus promoters by fusing the operator sequence to a virus late promoter. One or two copies of the operator O1 were placed at different locations between the strong promoter p72.4 (28) and the coding sequence of the firefly luciferase gene. This would permit us to ascertain the influence of the position of the operator relative to the promoter and of the number of operators on the degree of the repression and induction of gene activity. Another construct, lacking the operator, was generated as a positive control of the p72.4 promoter activity. All these chimeric genes (a general scheme is shown in Fig. 2B) were inserted into the nonessential region corresponding to the CD2 gene (46). DNA hybridization and PCR analysis were carried out to confirm the genomic structures of the recombinant viruses thus obtained, vA2, vA3, vA4, vA5, and vA6 (data not shown). The genomic structure of vA3, which is generally applicable for all of these, is shown in Fig. 2A.


View larger version (15K):
[in this window]
[in a new window]
 
FIG. 2.   (A) Genomic structure of the recombinant virus vA3. The luciferase gene, fused to the lac operator (bullet ) and the viral promoter p72.4, and the lacZ gene, fused to the viral promoter p72, are inserted into the CD2 locus of vGUSREP. Signals for 3'-end mRNA formation are indicated (bullet |). (B) The structures of the different chimeric genes containing the p72.4 promoter-lac operator (bullet )-luciferase gene inserted into the vGUSREP genome are shown on the left. Numbers represent distances (in base pairs) between the different elements of the chimeric genes. The transcription initiation site (arrows) is located from position -2 to -5 relative to the translation initiation codon of the p72 gene (44). The expression of luciferase in cells infected with recombinant viruses containing the chimeric genes in the absence or presence of IPTG is shown on the right. (C) Effect of IPTG concentration on induction level. The expression of luciferase in cell cultures infected with the recombinants vA3 and vA5 was determined with increasing concentrations of IPTG. Luciferase activity in B and C is the average of two experiments and is expressed as relative light units (RLU). In each experiment all infections were carried out in duplicate, and luciferase assays on each sample were carried out in duplicate. The values were adjusted to total protein content.

Vero cells were infected with the recombinants described above at 20 PFU per cell, and the luciferase activity was determined at 24 hpi in the presence or absence of IPTG (Fig. 2B). The spacing between the operator and the transcription initiation site was found to be important for the level of repression. Distances of 8 (vA3) or 2 (vA5) bp resulted in expression levels of 6 and 1%, respectively. The presence of a second operator reinforced the tightness of repression. Two tandem operators located 8 (vA4) or 2 (vA6) bp from the RNA start site allowed levels of luciferase activity less than 0.4% of the control level. The level of IPTG-induced luciferase expression is also dependent on the number of the operators and on their location. Thus, the gene activity in cells infected with viruses containing one operator placed at 8 (vA4) or 2 (vA5) bp reached values of 75 and 37%, respectively. On the other hand, the activity in cells infected with viruses containing tandem operators was only about 6%. Similar induction/repression rates of luciferase expression were obtained for all recombinants at different multiplicities of infection (MOI) (0.1 to 20 PFU per cell) (data not shown).

The effect of IPTG concentration on induction of luciferase expression was studied in cells infected with recombinant viruses vA3 and vA5. A stepwise increase of the IPTG concentration in the medium up to 1.25 mM gradually increased the gene activity (Fig. 2C). Thus, the transferred inducible expression system will allow the quantitative regulation of expression for a target gene. Moreover, maximum levels of gene activity were obtained with an IPTG concentration of 1.25 mM, which has no effect on infectious virus yield or on plaque formation (see below).

Construction of an ASFV recombinant inducibly expressing the p72 structural protein. An application of the lac operator-repressor system described above would be the study of the function of ASFV genes through their conditional expression. To test this, we inducibly expressed the B646L gene, which encodes the major capsid protein p72 (18, 37). For this purpose, an operator was inserted between the gene and its promoter into the vGUSREP genome. Since p72 is a major structural protein (13, 57) expressed during the late phase of the infection cycle, we constructed transfer vectors allowing high levels of gene induction. To this end, and based on the results described above (Fig. 2B), we inserted the operator sequence 8 bp downstream from the transcriptional start point in the recombinant vGUSREP. The purification of the resulting recombinant virus was carried out in the presence of IPTG in order to allow the expression of p72 in the presence of the repressor. Thus, the recombinant virus vA72 was obtained by using the transfer plasmid pINDp72.I.beta gal(i) (Fig. 3A). In this construct, the chimeric gene p72-lacZ is inserted in the transcriptional orientation opposite that of the B646L gene.


View larger version (22K):
[in this window]
[in a new window]
 
FIG. 3.   (A) Genomic structure of the recombinant virus vA72. The lacZ gene fused to the viral promoter p72 and the operator (bullet ) fused to the viral promoter p72.4 are inserted upstream of the B646L gene of recombinant vGUSREP. Signals for 3'-end mRNA formation are indicated (bullet |). (B) Plaque size phenotype of vA72. Monolayers of Vero cells were infected in the absence or presence of 1.25 mM IPTG with BA71V or vA72. After 4 days of infection, plaques were visualized with 1% crystal violet. Note the smaller size of the lysis plaques of the recombinant virus vA72 compared to that of the parental virus, BA71V. (C) Growth curves of vA72. Vero cells were infected with BA71V or vA72 at an MOI of 10 PFU per cell in the presence or absence of 1.25 mM IPTG. vA72 was also grown under nonpermissive conditions for the indicated times and then induced with IPTG. At different hours postinfection, samples were collected and titrated by plaque assay on fresh Vero cells in the presence of the inducer.

vA72 is an IPTG-dependent recombinant virus. The ability of recombinant virus vA72 to form plaques under repression or induction conditions was studied. Plaques obtained on vA72-infected cells in the presence of IPTG were smaller than those obtained after infection with the parental BA71V virus (Fig. 3B). This result was not due to toxicity of the inducer, which at 1.25 mM had no effect on plaque formation by the parental virus (Fig. 3B), but to an incomplete induction of the protein p72 (see below). The number of plaques formed in the absence of the inducer was strongly reduced (40- to 50-fold). One-step virus growth curves of vA72 showed that the virus titers do not increase over time in the absence of IPTG, remaining about 3 log units below the titers obtained with the parental virus, BA71V (Fig. 3C). Under permissive conditions, the infectious virus yield of vA72 increased during the infection, but the maximal levels observed were lower, by 0.5 log units, than those found after BA71V infections. We have also tested the ability of vA72-infected cells maintained for different times under nonpermissive conditions to produce infectious virus after the addition of inducer. As shown in Fig. 3C, virus titers increased sharply after the addition of inducer at 16 hpi. When the inducer was added later, virus production increased more slowly. Interestingly, the later the time of IPTG addition, the lower the final virus yield obtained, indicating that restoration of infectivity depends on the time of p72 induction.

Synthesis of the protein p72 is IPTG-dependent. To test whether the expression of protein p72 was dependent on the presence of IPTG, we labeled infected cells with [35S]methionine from 16 to 17 hpi. Similar protein profiles were obtained with parental BA71V and recombinant vA72 viruses in the presence and absence of the inducer, with the exception that a protein band with an electrophoretic mobility of about 115 kDa, representing the beta -Gal enzyme, was present on vA72-infected cells (Fig. 4A). Since GUS protein comigrates with protein p72, it was not possible to discern in this assay the effect of IPTG on the induction of p72.


View larger version (43K):
[in this window]
[in a new window]
 
FIG. 4.   Synthesis of the protein p72. Vero cells were either mock infected (M) or infected for 16 h with BA71V virus (B) or vA72 (V) in the absence or in the presence of 1.25 mM IPTG and were labeled with [35S]methionine for 1 h. (A) SDS-PAGE of the cell lysates. The electrophoretic mobilities of molecular weight markers are indicated in kilodaltons on at the left. (B) Cell lysates were immunoprecipitated with a monoclonal antibody against p72 (17L.D3) and a polyclonal serum against pp220 (anti-p37/p14). The immunoprecipitated polypeptides are shown.

Therefore, to analyze the expression of p72, cell lysates were immunoprecipitated with a p72-specific antibody. As shown in Fig. 4B, a strong reduction of p72 levels was observed in the absence of the inducer. A densitometric quantification of the autoradiography showed that p72 expression in cells infected with vA72 in the absence and in the presence of IPTG was 5 and 60%, respectively, of that obtained in cells infected with the parental virus, BA71V. Immunoprecipitation with a serum against the ASFV polyprotein pp220 (50) was used as an internal control to verify that equivalent amounts of extract had been analyzed.

Effect of p72 repression on virus morphogenesis. To analyze the effect of p72 repression on ASFV assembly, we performed electron microscopy studies of infected cells. In general, the virus-induced structures observed in vA72-infected cells in the presence of IPTG (Fig. 5A) were similar to those found in parental BA71V-infected cells (4-6). Assembling virions and irregular and parallel arrangements of membrane-like structures were observed in the replication areas. A recent report has shown that ASFV particles assemble from these viral membranes, which become polyhedral structures after capsid formation on their convex surfaces (4). Interestingly, the analysis of vA72-infected cells in the absence of the inducer showed no production of polyhedral viral structures but a strong accumulation of unusual membranous structures (Fig. 5B). These structures, which have been referred to as "zipper-like" (5, 6), consist of one pair of parallel and extended viral envelopes bound by a thick protein layer structurally similar to the core shell of the virus particle (4) (Fig. 5B). A close inspection revealed two types of zipper-like structures. One of them, referred to as "single," is formed by a copy of the core shell (Fig. 5B, insert a), while a second one, referred to as "double," is composed of two copies (Fig. 5B, insert b). Altogether, both zipper-like structures represent a minor proportion of the virus structures induced in the replication areas of parental BA71V- (5, 6) or vA72-infected cells under permissive conditions (Fig. 5A). However, while the single structures were frequently detected (Fig. 5A), the double structures were rarely seen.


View larger version (135K):
[in this window]
[in a new window]
 
FIG. 5.   Ultrathin Epon sections of viral factories in ASFV-infected cells. (A) vA72-infected cell incubated with IPTG up to 16 hpi. Large arrowheads, membrane-like structures; small arrowheads, single zipper-like structures; arrows, assembling virions. (B) vA72-infected cell at 16 hpi in the absence of IPTG. Parallel arrangements of membranous structures accumulate to a great extent in the assembly sites. These structures frequently appeared separated by either one (small arrowhead) or two (large arrowhead) copies of a thick layer symmetrically subdivided by a thin and electron-dense structure. Inserts are high-magnification micrographs of these single (a) and double (b) zipper-like structures. (C) Assembly site in a cell infected with vA72 in the absence of IPTG for 16 hpi and then incubated with the inducer for 4 h. Assembling virus particles (arrow), as well as other virus induced structures, can be seen. Arrowheads indicate single zipper-like structures acquiring polyhedral morphology. Note that single zipper-like structures can also be observed in vA72-infected cells incubated with IPTG (small arrowheads in panel A). Bars, 125 nm.

Effect of p72 expression on virus morphogenesis. To examine the effect of p72 expression on the structures seen in the replication areas constituted under nonpermissive conditions, we analyzed vA72-infected cells maintained during 16 h in the absence of the inducer and then incubated for different periods with IPTG. Major ultrastructural changes were observed in the assembly sites from 4 h postinduction onward (Fig. 5C and 6). Expression of p72 led to the formation of polyhedral structures from the previously accumulated membranous structures either on single (Fig. 6A) and double (Fig. 6B) zipper-like structures or on normal viral envelopes (Fig. 6C). A high-magnification analysis revealed that this transformation was concomitant with the appearance of a new layer about 7 nm thick on the external surfaces of the membrane-like structures (Fig. 6). We conclude that this layer corresponds to the viral capsid, as deduced by the regular array of subunits composing it (Fig. 6A2) as well as by its effect on the virus shape.


View larger version (118K):
[in this window]
[in a new window]
 
FIG. 6.   Capsid formation. Shown are ultrathin Epon sections of cells infected with vA72 that were treated with IPTG at 16 hpi during an 8-h period. Single zipper-like structures (A), double zipper-like structures (B), and normal viral membranous structures (C) acquire polyhedral morphology by the progressive formation over their external surfaces of a thin layer of about 7 nm (arrowheads). This layer is the viral capsid, as deduced by the ordered array of individual capsomers composing it (arrows in panel A2). Bars, 50 nm.

Interestingly, capsid formation gave rise to different assembling virions depending on the type of precursor membranous structures. Thus, typical polyhedral virions were assembled from normal viral membranes (Fig. 7A). On the other hand, capsid formation on double zipper-like structures seemed to lead to separation between the two copies of the core shell, thus resulting in the assembly of apparently normal particles (Fig. 7B). These observations are in good accordance with the restoration of vA72 infectivity observed after the addition of the inducer at 16 hpi (Fig. 3C). Finally, capsid formation on single zipper-like structures led to the generation of a subpopulation of assembling virions morphologically distinct from normal particles. This type of intermediate form, rarely observed in infections with normal ASFV, incorporated two membrane envelopes encompassing the core shell (Fig. 7C and E). These double-enveloped particles likely represent aberrant forms of ASFV. However, we cannot discard the possibility that these viral forms eventually evolve to normal virus by segregation of the innermost envelope, as is suggested in Fig. 7C2. Additionally, we detected double-enveloped virions with an electron-dense nucleoid (Fig. 7D). Whether this nucleoid has a composition identical to that of normal virus particles remains to be answered.


View larger version (174K):
[in this window]
[in a new window]
 
FIG. 7.   Assembling virions. Shown are ultrathin Epon sections of cells infected with vA72 in the absence of IPTG up to 16 hpi and later incubated with the inducer for 8 h. (A) Viral intermediates formed from membrane-like structures containing, underneath the capsid, the inner viral envelope and the core shell, showing the normal pathway of ASFV assembly. (B) Capsid formation on double zipper-like structures leads to the separation of both core shell layers (arrowheads), probably giving rise to normal virions. (C) Virus maturation from single zipper-like structures gives rise to a subpopulation of virions containing an additional internal membrane envelope. Numbers at the arrowheads in panel C3 indicate normal inner envelope (1) and additional innermost envelope (2). During the assembly from single zipper-like structures, intermediate forms with two membrane envelopes might lose the innermost one (arrowheads in panel C2), giving rise to normal virions. (D) Intracellular double-enveloped virions containing an electron-dense nucleoid (arrows). (E) Double-enveloped virion (arrowhead) and mature intracellular particles (arrows) in a replication area representing different stages of vA72 maturation. Bars, 150 nm.

To verify that capsid formation was a consequence of p72 expression, we performed immunogold labeling on ultrathin sections of vA72-infected cells with specific antibodies. Viral factories of cells infected for 16 hpi in the absence of inducer were poorly labeled (Fig. 8A1). In contrast, in infected cells induced for a 8-h period beginning at 16 hpi, strong labeling was detected in the replication areas (Fig. 8A2) on zipper-like structures and polyhedral virus particles.


View larger version (111K):
[in this window]
[in a new window]
 
FIG. 8.   Immunoelectron microscopy of protein p72. (A) Lowicryl sections of vA72-infected cells maintained 16 h in the absence of IPTG (A1) or treated with the inducer at 16 hpi during an 8-h period (A2). The samples were labeled after embedding with a rat anti-p72 serum, a goat anti-rat Ig, and protein A-gold complexes (15 nm). Note that while in the absence of IPTG the replication areas were poorly labeled, in the presence of the inducer the label strongly increased and was mainly associated with zipper-like structures and polyhedral virus particles (arrows). Bars, 200 nm. (B) BA71V-infected cells permeabilized at 20 hpi with streptolysin O. After brief fixation, the cells were incubated with a mixture of anti-p72 monoclonal antibodies (17L.D3 and 19B.A2), and then with protein A-gold (5 nm). Finally, the cells were processed for conventional Epon embedding, and very thin sections (less than 60 nm) were analyzed. Note that the labeling is usually associated with the outer, but not the inner, surfaces of open virus particles (arrowheads in panels B1 and B2) and with one of the two sides of the precursor viral membranes (arrowheads in panel B3). Bars, 200 (B1) and 100 (B2 and B3) nm.

Ultrastructural localization of p72 in the virus particle. Recently, Cobbold et al. (19) have proposed that p72 is externally and internally located in the intracellular virus particles, peripherally bound to both surfaces of the viral envelope. However, the ultrastructural studies described in the present report clearly indicate that the capsid is built exclusively on the outer surface of the viral envelope. To analyze this apparent contradiction, the precise localization of p72 in the virus structure was determined by preembedding labeling experiments with infected cells permeabilized with streptolysin O (as described in Materials and Methods). For this purpose, we infected Vero cells with either the parental virus, BA71V, or recombinant vA72 virus under permissive conditions.

As shown in Fig. 8B for the parental virus, gold particles strongly decorated the external layers, i.e., the capsids, of the intracellular virions and "open" virus structures (Fig. 8B1 and B2). Interestingly, labeling was virtually absent from the inner side of the envelope in these open particles. Moreover, most of the labeling associated with the precursor viral envelopes was located only on one of their two faces (Fig. 8B3), probably the side on which the capsid would be assembled. A similar labeling pattern was obtained with the recombinant vA72 virus (data not shown).

These results, together with the ultrastructural analysis of recombinant vA72-infected cells, argue in favor of an exclusively external location of p72 in the intracellular virus particles.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Inducible expression of genes from ASFV recombinants. A system for the inducible expression of genes from ASFV recombinants is presented. This system is based on the binding of the E. coli lac repressor protein to the operator sequence of an inducible promoter and has been previously transferred successfully to regulate the expression of transfected or integrated reporter genes in mammalian cells (for a review, see reference 30) and vaccinia virus-infected cells (1, 27, 36, 43, 47, 62).

The E. coli lacI gene, encoding the repressor protein, was inserted into the virus genome of the ASFV strain BA71V under the transcriptional control of the promoter of the virus early gene U104L, generating the recombinant virus vGUSREP. Gel retardation analysis showed that the repressor was present late in infection and thus was available for regulating any virus late promoter containing the operator sequence. Five different hybrid promoters were inserted into the vGUSREP genome, and the luciferase activity for each construct in the presence and in the absence of the inducer IPTG was determined. The results showed that both the distance between the promoter and the operator and the number of operators inserted were critical for the repression and induction activities. Thus, maximal levels of gene induction were obtained with the recombinants vA3 and vA5, which contained one operator sequence. However, these levels were lower than those obtained with the p72.4 promoter in the control recombinant vA2 lacking the operator. This reduced induction could be due to the presence of the palindromic operator sequence, which can reduce the translatability of mRNA because of its ability to form hairpin structures (33). A similar mechanism would explain the strong decrease of activity in vA4 and vA6 in the presence of IPTG, where the combined effects of two tandem operators can further reduce mRNA translation. On the other hand, the repression of the different constructs ranged between 94 and >99% of the total activity. Previously, it has been reported that the repressor-operator interaction blocks either RNA polymerase transcription initiation in E. coli (55) or transcriptional elongation by E. coli RNA polymerase (21) and eukaryotic RNA polymerase II (22). Whether the repression effect in ASFV recombinants is due to blocking of transcriptional initiation and/or polymerase elongation remains to be ascertained.

As shown in Fig. 2C, the inducer concentration would allow the expression of the analyzed gene to be adjusted to defined levels. This possibility will further our understanding of the function of ASFV proteins under the control of this inducible system, since the amount of target protein expressed can define the phenotype of the mutant virus.

The system described may be a useful and easy way to study the precise function of structural proteins during ASFV morphogenesis.

Role of the major capsid protein p72. This report shows, by analysis of the B646L gene, which encodes the major capsid protein p72 (16, 18, 19, 37), the utility of the inducible gene expression system. We considered it preferable to maintain the target gene in its original site and insert the lac operator downstream of the natural promoter. In this way, we obtained the vA72 recombinant, which contains a hybrid promoter similar to that directing the luciferase expression in vA3, thus allowing high levels of induction.

The essentiality of the protein p72 was demonstrated by the fact that the mutant virus is IPTG dependent. The yield of vA72 under one-step growth conditions in the absence of the inducer was reduced more than 99% compared to that of the parental BA71V. The very few plaques produced by vA72 in these conditions, which were similar in size to those observed in the presence of IPTG, were most likely produced by lacI repression escape mutants, as has been proposed for conditional-lethal recombinant vaccinia viruses (63). Small amounts of the protein could be detected in the absence of the inducer, indicating that the repression of p72 was not complete. However, since p72 is a major structural protein, large quantities are presumably needed for normal function, and therefore suppression of most of the synthesis of p72 was sufficient to study its function.

Interestingly, the ultrastructural analysis of replication areas of vA72-infected cells revealed that repression of protein p72 synthesis gives rise to accumulation of either single or double zipper-like structures. Both types of viral intermediates consist of pairs of parallel viral envelopes bound by one or two protein layers structurally similar to the core shell of the virion (4-6).

Synthesis of p72 leads to the progressive building of the capsid on the external surfaces of normal viral envelopes as well as zipper-like structures, which became polyhedral forms. Consistent with this, antibodies to p72 labeled the external surfaces of intracellular virus particles. In this context, Cobbold et al. (19) have recently suggested that p72 is externally and internally located in the intracellular virus, likely bound to both faces of an endoplasmic reticulum cisterna which is incorporated by wrapping to the virus structure. Such double localization was proposed from trypsin protection assays in which most of the membrane-associated p72 was resistant to the protease. Our ultrastructural and immunocytochemical analyses argue in favor of an exclusively external location of both the capsid layer and protein p72 in the intracellular particles.

Interestingly, the thickness of the capsid, about 7 nm, was found to be similar to that of iridoviruses, approximately 6 to 9 nm (7, 23, 54), but in some conflict with the 13 nm previously reported for ASFV capsomers (15). Thus, our data strengthen the similarities observed between ASFV and iridoviruses in virus shape (15), capsid protein sequences (38, 49), and capsomeric disposition in a closely packed hexagonal array (20, 23, 59, 60).

Very little is known about the mechanism of virion assembly and the protein interactions involved in this process (4, 19, 41). Most probably, the correct assembly pathway requires the temporally regulated presence of all the needed factors in the replication area. In relation to this, the absence of a major structural component of the capsid in vA72-infected cells under nonpermissive conditions likely explains the accumulation of zipper-like structures. The fine analysis of viral intermediates suggested that a certain proportion of the mature virions could be obtained after IPTG addition from double structures, which were rarely found in normal infections. Therefore, these membranous structures may be aberrant forms which would switch to normal ASFV assembly, constituting an alternative morphogenesis pathway originating as a consequence of capsid formation inhibition. In this sense, it has been reported that different agents can induce aberrant structures during the assembly of viruses. Thus, the drug rifampin prevents the formation of vaccinia virus particles and causes the appearance of characteristic inclusion bodies in the cytoplasm of infected cells. The block can be rapidly reversed by removal of the drug, allowing the assembly of normal vaccinia virus (40, 63).

On the other hand, a subpopulation of ASFV particles with two inner envelopes, some of them with an electron-dense central nucleoid, was observed after induction, most probably developed by capsid acquisition on single zipper-like structures (5, 6). Further experiments must be undertaken in order to determine whether these virions are infectious or not.

In conclusion, we have demonstrated that the E. coli lac operator-repressor system provides a powerful tool for studying the role of ASFV genes involved in the virus assembly, making it possible to correlate molecular with morphogenetic events. Similarly, conditional expression of virus genes would allow for the understanding of transcriptional regulation mechanisms, as well as the molecular interactions involved in the virus-host relationship, such as virus infectivity or immune response modulation. Extension of inducible expression to additional ASFV genes is in progress.

    ACKNOWLEDGMENTS

We thank F. J. Rodriguez for invaluable help in setting up the inducible expression system in ASFV and for critical reading of the manuscript. We thank M. L. Salas and J. Salas for critical reading of the manuscript. We also thank M. Rejas for technical assistance.

This work was supported by grants from the Dirección General de Investigación Científica y Técnica (PB93-0160-C02-01), the European Community (AIR-CT93-1332), and Fundación Ramón Areces. Ramón García-Escudero was a fellow of the Ministerio de Educación y Ciencia, and Germán Andrés was a fellow of Fundación Rich.

    FOOTNOTES

* Corresponding author. Mailing address: Centro de Biología Molecular "Severo Ochoa," Facultad de Ciencias, Universidad Autónoma de Madrid, Cantoblanco, 28049 Madrid, Spain. Phone: 34 1 397 84 36. Fax: 34 1 397 84 90. E-mail: Evinuela{at}mvax.cbm.uam.es.

dagger Present address: Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, United Kingdom.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Alexander, W. A., B. Moss, and T. R. Fuerst. 1992. Regulated expression of foreign genes in vaccinia virus under the control of bacteriophage T7 RNA polymerase and the Escherichia coli lac repressor. J. Virol. 66:2934-2942[Abstract/Free Full Text].
2. Almazán, F., J. M. Rodríguez, G. Andrés, R. Pérez, E. Viñuela, and J. F. Rodriguez. 1992. Transcriptional analysis of multigene family 110 of African swine fever virus. J. Virol. 66:6649-6654[Abstract/Free Full Text].
3. Almazán, F., J. M. Rodríguez, A. Angulo, E. Viñuela, and J. F. Rodriguez. 1993. Transcriptional mapping of a late gene coding for the p12 attachment protein of African swine fever virus. J. Virol. 67:553-556[Abstract/Free Full Text].
4. Andrés, G., C. Simón-Mateo, and E. Viñuela. 1997. Assembly of African swine fever virus: role of polyprotein pp220. J. Virol. 71:2331-2341[Abstract].
5. Andrés, G. Unpublished data.
6. Andrés, G. 1995. . Ph.D. thesis. Universidad Autónoma de Madrid, Madrid, Spain.
7. Berthiaume, L., R. Alain, and J. Robin. 1984. Morphology and ultrastructure of lymphocystis disease virus, a fish iridovirus, grown in tissue culture. Virology 135:10-19[Medline].
8. Betz, J. L., and J. R. Sadler. 1981. Variants of a cloned synthetic operator. I. A palindromic dimer lactose operator derived from one strand of the cloned 40-base pair operator. Gene 13:1-12[Medline].
9. Blasco, R., M. Agüero, J. M. Almendral, and E. Viñuela. 1989. Variable and constant regions in African swine fever virus DNA. Virology 168:330-338[Medline].
10. Bradford, M. M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-254[Medline].
11. Breese, S. S., Jr., and C. J. DeBoer. 1966. Electron microscope observation of African swine fever virus in tissue culture cells. Virology 28:420-428[Medline].
12. Carlemalm, E., R. M. Garavito, and W. Wiliger. 1981. Resin development for electron microscopy and an analysis of embedding at low temperature. J. Microsc. 126:123-143.
13. Carrascosa, A. L., M. del Val, J. F. Santarén, and E. Viñuela. 1985. Purification and properties of African swine fever virus. J. Virol. 54:337-344[Abstract/Free Full Text].
14. Carrascosa, A. L., I. Sastre, and E. Viñuela. 1991. African swine fever virus attachment protein. J. Virol. 65:2283-2289[Abstract/Free Full Text].
15. Carrascosa, J. L., J. M. Carazo, A. L. Carrascosa, N. García, A. Santisteban, and E. Viñuela. 1984. General morphology and capsid fine structure of African swine fever virus particles. Virology 132:160-172[Medline].
16. Carrascosa, J. L., P. Gonzalez, A. L. Carrascosa, B. García-Barreno, L. Enjuanes, and E. Viñuela. 1986. Localization of structural proteins in African swine fever virus particles by immunoelectron microscopy. J. Virol. 58:377-84[Abstract/Free Full Text].
17. Chacón, M. R., F. Almazán, M. L. Nogal, E. Viñuela, and J. F. Rodriguez. 1995. The African swine fever virus IAP homolog is a late structural polypeptide. Virology 214:670-674[Medline].
18. Cistué, C., and E. Tabarés. 1992. Expression in vivo and in vitro of the major structural protein (VP 73) of African swine fever virus. Arch. Virol. 123:111-124[Medline].
19. Cobbold, C., J. T. Whittle, and T. Wileman. 1996. Involvement of the endoplasmic reticulum in the assembly and envelopment of African swine fever virus. J. Virol. 70:8382-8390[Abstract].
20. Darcy-Tripier, F., M. V. Nermut, J. Braunwald, and L. D. Williams. 1984. The organization of frog virus 3 as revealed by freeze-etching. Virology 138:287-299[Medline].
21. Deuschle, U., R. Gentz, and H. Bujard. 1986. lac repressor blocks transcribing RNA polymerase and terminates transcription. Proc. Natl. Acad. Sci. USA 83:4134-4137[Abstract/Free Full Text].
22. Deuschle, U., R. A. Hipskind, and H. Bujard. 1990. RNA polymerase II transcription blocked by Escherichia coli lac repressor. Science 248:480-483[Abstract/Free Full Text].
23. Devauchelle, G. 1977. Ultrastructural characterization of an iridovirus from the marine worm Nereis diversicolor (O. F. Müller). Virology 81:237-246[Medline].
24. DeWet, J. R., K. V. Wood, D. R. Helinsky, and M. DeLuca. 1985. Cloning of firefly luciferase cDNA and the expression of active luciferase in Escherichia coli. Proc. Natl. Acad. Sci. USA 82:7870-7873[Abstract/Free Full Text].
25. Dixon, L. K., D. L. Rock, and E. Viñuela. 1995. African swine fever-like viruses.. Virus taxonomy: classification and nomenclature of viruses. Arch. Virol. 10(Suppl.):92-94 .
26. Enjuanes, L., A. L. Carrascosa, M. A. Moreno, and E. Viñuela. 1976. Titration of African swine fever virus. J. Gen. Virol. 32:471-477[Abstract/Free Full Text].
27. Fuerst, T. R., M. P. Fernández, and B. Moss. 1989. Transfer of the inducible lac repressor/operator system from Escherichia coli to a vaccinia virus expression vector. Proc. Natl. Acad. Sci. USA 86:2549-2553[Abstract/Free Full Text].
28. García, R., F. Almazán, J. M. Rodríguez, M. Alonso, E. Viñuela, and J. F. Rodriguez. 1995. Vectors for the genetic manipulation of African swine fever virus. J. Biotechnol. 40:121-131[Medline].
29. García-Barreno, B., A. Sanz, M. L. Nogal, E. Viñuela, and L. Enjuanes. 1986. Monoclonal antibodies of African swine fever virus: antigenic differences among field virus isolates and viruses passaged in cell culture. J. Virol. 58:385-392[Abstract/Free Full Text].
30. Gossen, M., A. L. Bonin, and H. Bujard. 1993. Control of gene activity in higher eukaryotic cells by prokaryotic regulatory elements. Trends Biochem. Sci. 18:471-475[Medline].
31. Harlow, E., and D. Lane. 1988. . Antibodies: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
32. Hu, M. C. H., and N. Davidson. 1987. The inducible lac operator-repressor system is functional in mammalian cells. Cell 48:555-566[Medline].
33. Kozak, M. 1986. Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proc. Natl. Acad. Sci. USA 83:2850-2854[Abstract/Free Full Text].
34. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[Medline].
35. Laskey, R. A., and A. D. Mills. 1975. Quantitative film detection of 3H and 14C in polyacrylamide gels by fluorography. Eur. J. Biochem. 56:335-341[Medline].
36. Lee, S. B., Z. Melkova, W. Yan, B. R. Williams, A. G. Hovanessian, and M. Esteban. 1993. The interferon-induced double-stranded RNA-activated human p68 protein kinase potently inhibits protein synthesis in cultured cells. Virology 192:380-385[Medline].
37. López-Otín, C., J. M. P. Freije, F. Parra, E. Méndez, and E. Viñuela. 1990. Mapping and sequence of the gene encoding for p72, the major capsid protein of African swine fever virus. Virology 175:477-484[Medline].
38. Mao, J., N. Thamm, G. A. Gentry, A. Aubertin, and V. G. Chincar. 1996. Cloning, sequence analysis and expression of the major capsid protein of the iridovirus frog 3 virus. Virology 216:431-436[Medline].
39. Martínez-Pomares, L., C. Simón-Mateo, C. López-Otín, and E. Viñuela. 1997. Characterization of the African swine fever virus protein p14.5: a DNA binding protein. Virology 229:201-211[Medline].
40. Moss, B., E. N. Rosenblum, E. Katz, and P. M. Grimley. 1969. Rifampicin: a specific inhibitor of vaccinia virus assembly. Nature (London) 224:1280-1284[Medline].
41. Moura Nunes, J. F., J. D. Vigario, and A. M. Terrinha. 1975. Ultrastructural study of African swine fever virus replication in cultures of swine bone marrow cells. Arch. Virol. 49:59-66[Medline].
42. Rodriguez, F., V. Ley, P. Gómez-Puertas, R. García, J. F. Rodriguez, and J. M. Escribano. 1996. The structural protein p54 is essential for African swine fever virus viability. Virus Res. 40:161-167[Medline].
43. Rodriguez, J. F., and G. L. Smith. 1990. Inducible expression from vaccinia virus expression vectors. Virology 177:239-250[Medline].
44. Rodríguez, J. M. Personal communication.
45. Rodríguez, J. M., F. Almazán, E. Viñuela, and J. F. Rodriguez. 1992. Genetic manipulation of African swine fever virus: construction of recombinant viruses expressing the beta -galactosidase gene. Virology 188:67-76[Medline].
46. Rodríguez, J. M., R. J. Yáñez, F. Almazán, E. Viñuela, and J. F. Rodriguez. 1993. African swine fever virus encodes a CD2 homolog responsible for the adhesion of erythrocytes to infected cells. J. Virol. 67:5312-5320[Abstract/Free Full Text].
47. Rodriguez, J. R., C. Risco, J. L. Carrascosa, M. Esteban, and D. Rodríguez. 1997. Characterization of early stages in vaccinia virus membrane biogenesis: implications of the 21-kilodalton protein and a newly identified 15-kilodalton envelope protein. J. Virol. 71:1821-1833[Abstract].
48. Sanz, A., B. García-Barreno, M. L. Nogal, E. Viñuela, and L. Enjuanes. 1985. Monoclonal antibodies specific for African swine fever virus proteins. J. Virol. 54:199-206[Abstract/Free Full Text].
49. Schnitzler, P., and G. Darai. 1993. Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus. J. Gen. Virol. 74:2143-2150[Abstract/Free Full Text].
50. Simón-Mateo, C., G. Andrés, and E. Viñuela. 1993. Polyprotein processing in African swine fever virus: a novel gene expression strategy for a DNA virus. EMBO J. 12:2977-2987[Medline].
51. Simón-Mateo, C., J. M. P. Freije, G. Andrés, C. López-Otín, and E. Viñuela. 1995. Mapping and sequence of the gene encoding protein p17, a major African swine fever virus structural protein. Virology 206:1140-1144[Medline].
52. Simón-Mateo, C., G. Andrés, F. Almazán, and E. Viñuela. 1997. Proteolytic processing in African swine fever virus: evidence for a new structural polyprotein, pp62. J. Virol. 71:5799-5804[Abstract].
53. Sodeik, B., R. W. Doms, M. Ericsson, G. Hiller, C. E. Machamer, W. von't Hof, G. van Meer, B. Moss, and G. Griffiths. 1993. Assembly of vaccinia virus: role of the intermediate compartment between the endoplasmic reticulum and the Golgi stacks. J. Cell Biol. 121:521-541[Abstract/Free Full Text].
54. Stolz, D. 1973. The structure of icosahedral cytoplasmic deoxyriboviruses. II. An alternative model. J. Ultrastruct. Res. 43:58-74[Medline].
55. Straney, S. B., and D. M. Crothers. 1987. Lac repressor is a transient gene-activating protein. Cell 51:699-707[Medline].
56. Viñuela, E. 1987. Molecular biology of African swine fever virus, p. 31-49. In Y. Becker (ed.), African swine fever. Martinus Nijhoff Publishing, Boston, Mass.
57. Whyard, T. C., S. H. Wool, and G. J. Letchworth. 1986. Monoclonal antibodies against African swine fever viral antigens. Virology 142:416-420.
58. Wilkinson, P. J. 1989. African swine fever virus, p. 17. In M. B. Pensaert (ed.), Virus infections of porcines. Elsevier Sciences Publishers, B. V., Amsterdam, The Netherlands.
59. Wrigley, N. G. 1969. An electron microscope study of the structure of Sericesthis iridescent virus. J. Gen. Virol. 5:123-134[Abstract/Free Full Text].
60. Wrigley, N. G. 1970. An electron microscope study of the structure of Tipula iridescent virus. J. Gen. Virol. 6:169-173[Abstract/Free Full Text].
61. Yáñez, R. J., J. M. Rodríguez, M. L. Nogal, L. Yuste, C. Enríquez, J. F. Rodriguez, and E. Viñuela. 1995. Analysis of the complete nucleotide sequence of African swine fever virus. Virology 208:249-278[Medline].
62. Zhang, Y., J. G. Keck, and B. Moss. 1992. Transcription of viral late genes is dependent on expression of the viral intermediate gene G8R in cells infected with an inducible conditional-lethal mutant vaccinia virus. J. Virol. 66:6470-6479[Abstract/Free Full Text].
63. Zhang, Y., and B. Moss. 1992. Immature viral envelope formation is interrupted at the same stage by lac operator-mediated repression of the vaccinia virus D13L gene and the drug rifampicin. Virology 187:643-653[Medline].


J Virol, April 1998, p. 3185-3195, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Hawes, P. C., Netherton, C. L., Wileman, T. E., Monaghan, P. (2008). The Envelope of Intracellular African Swine Fever Virus Is Composed of a Single Lipid Bilayer. J. Virol. 82: 7905-7912 [Abstract] [Full Text]  
  • Epifano, C., Krijnse-Locker, J., Salas, M. L., Rodriguez, J. M., Salas, J. (2006). The African Swine Fever Virus Nonstructural Protein pB602L Is Required for Formation of the Icosahedral Capsid of the Virus Particle. J. Virol. 80: 12260-12270 [Abstract] [Full Text]  
  • Epifano, C., Krijnse-Locker, J., Salas, M. L., Salas, J., Rodriguez, J. M. (2006). Generation of Filamentous Instead of Icosahedral Particles by Repression of African Swine Fever Virus Structural Protein pB438L. J. Virol. 80: 11456-11466 [Abstract] [Full Text]  
  • Rodriguez, J. M., Garcia-Escudero, R., Salas, M. L., Andres, G. (2004). African Swine Fever Virus Structural Protein p54 Is Essential for the Recruitment of Envelope Precursors to Assembly Sites. J. Virol. 78: 4299-4313 [Abstract] [Full Text]  
  • Alejo, A., Andres, G., Salas, M. L. (2003). African Swine Fever Virus Proteinase Is Essential for Core Maturation and Infectivity. J. Virol. 77: 5571-5577 [Abstract] [Full Text]  
  • Heath, C. M., Windsor, M., Wileman, T. (2003). Membrane Association Facilitates the Correct Processing of pp220 during Production of the Major Matrix Proteins of African Swine Fever Virus. J. Virol. 77: 1682-1690 [Abstract] [Full Text]  
  • Andres, G., Alejo, A., Salas, J., Salas, M. L. (2002). African Swine Fever Virus Polyproteins pp220 and pp62 Assemble into the Core Shell. J. Virol. 76: 12473-12482 [Abstract] [Full Text]  
  • Andres, G., Garcia-Escudero, R., Salas, M. L., Rodriguez, J. M. (2002). Repression of African Swine Fever Virus Polyprotein pp220-Encoding Gene Leads to the Assembly of Icosahedral Core-Less Particles. J. Virol. 76: 2654-2666 [Abstract] [Full Text]  
  • Andres, G., Garcia-Escudero, R., Vinuela, E., Salas, M. L., Rodriguez, J. M. (2001). African Swine Fever Virus Structural Protein pE120R Is Essential for Virus Transport from Assembly Sites to Plasma Membrane but Not for Infectivity. J. Virol. 75: 6758-6768 [Abstract] [Full Text]  
  • García-Escudero, R., Viñuela, E. (2000). Structure of African Swine Fever Virus Late Promoters: Requirement of a TATA Sequence at the Initiation Region. J. Virol. 74: 8176-8182 [Abstract] [Full Text]  
  • Cobbold, C., Brookes, S. M., Wileman, T. (2000). Biochemical Requirements of Virus Wrapping by the Endoplasmic Reticulum: Involvement of ATP and Endoplasmic Reticulum Calcium Store during Envelopment of African Swine Fever Virus. J. Virol. 74: 2151-2160 [Abstract] [Full Text]  
  • Alejo, A., Andres, G., Vinuela, E., Salas, M. L. (1999). The African Swine Fever Virus Prenyltransferase Is an Integral Membrane trans-Geranylgeranyl-diphosphate Synthase. J. Biol. Chem. 274: 18033-18039 [Abstract] [Full Text]  
  • Andres, G., Garcia-Escudero, R., Simon-Mateo, C., Vinuela, E. (1998). African Swine Fever Virus Is Enveloped by a Two-Membraned Collapsed Cisterna Derived from the Endoplasmic Reticulum. J. Virol. 72: 8988-9001 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by García-Escudero, R.
Right arrow Articles by Viñuela, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by García-Escudero, R.
Right arrow Articles by Viñuela, E.