INTRODUCTION

Top Abstract Introduction Materials & Methods Results Discussion References

African swine fever virus (ASFV), the only known member of the genus "African swine fever-like viruses" (25), is the causative agent of a severe disease of swine. Besides its ability to infect different species of suids, ASFV infects soft ticks of the Ornithodoros genus (56, 58), which act as vectors for the virus propagation. The viral genome is a single molecule of double-stranded DNA ranging in size from 170 to 190 kbp, depending on the virus strain (9). The analysis of the complete nucleotide sequence of the avirulent isolate BA71V has revealed the existence of 151 putative genes (61). The virus encodes enzymes involved in DNA replication, gene transcription, and protein modification, as well as proteins that may modulate the host immune response against infection. The functions of some of these proteins have been analyzed (61), and the coding sequences for 12 structural proteins have been reported (17, 39, 51, 52, 61). However, the functions of most of the virus-encoded proteins are unknown. The virus particle, which shows a morphology very similar to that of iridoviruses (15), has a diameter of about 200 nm and comprises several concentric domains. The central structure is the viral core, which is composed of a DNA-containing nucleoid surrounded by a thick protein layer, the core shell. The viral core is wrapped by a lipid envelope and an icosahedral capsid (4, 15). Extracellular ASFV particles usually possess an additional membrane acquired by budding through the plasma membrane (11).

In an attempt to facilitate the analysis of the role of individual ASFV genes, we have developed a system for inducible gene expression from ASFV recombinants. In a previous report, we showed that the ASFV genome can be genetically manipulated by homologous recombination (45). Recombinant viruses can be selected by following the expression of either the Escherichia coli lacZ gene, which encodes -galactosidase (-Gal) (45), or the E. coli gusA gene, which encodes -glucuronidase (GUS) (28). Both markers enable ASFV recombinants with multiple genetic modifications to be obtained (42). By using this approach, we have inserted into the ASFV genome an inducible expression system based on the E. coli lac operon. This allows the expression of genes to be conditionally, temporally, and quantitatively regulated, either individually or in combination with other genes.

Enzymes encoded within the lac operon are under the negative control of a repressor which can bind specifically and with high affinity to a sequence of 21 bp representing the functional core of the operator sequence, known as O₁ (8). The lac repressor can also bind to allolactose or to nonmetabolizable derivatives, such as isopropyl -D-thiogalactoside (IPTG), which decrease the affinity of the repressor for the operator. In this manner, IPTG can diminish the repression of lac operon transcription, resulting in an induction of expression. The system has been well characterized and can regulate the expression of transfected and integrated reporter genes in mammalian cells (for a review, see reference 30). This system has also been used to regulate gene expression in cells infected with recombinant vaccinia virus (1, 27, 43), constituting a powerful tool for the analysis of virus morphogenesis (47), transcriptional regulation (62), and virus-host cell interactions (36).

The utility of the system described below is shown by the inducible expression of foreign firefly luciferase (24) and the ASFV major capsid protein p72 (37). A recombinant virus which inducibly expresses the protein p72 (vA72) was absolutely dependent on the addition of the inducer for production of infectious virus. Electron microscopic analysis of vA72-infected cell factories showed that induction of p72 synthesis leads to progressive formation of the capsid on the external surfaces of previously accumulated electron-dense membranous structures. These viral membranes become polyhedral structures which evolve toward the generation of virus particles.

	MATERIALS AND METHODS

Top Abstract Introduction Materials & Methods Results Discussion References

Cells and viruses. Vero cells were grown in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum. The ASFV strain BA71V was propagated and titrated as previously described (26). Virus infections were carried out with DMEM containing 2% fetal bovine serum. Recombinant virus vA72 was grown in the presence of 1.25 mM IPTG.

Antibodies. The monoclonal antibodies 17L.D3 and 19B.A2, and the rat serum against protein p72, have been described previously (14, 29, 48). The rabbit polyclonal anti-p37/p14 serum, which also recognizes the precursor form pp220, has been described before (50). The secondary antibodies for immunoelectron microscopy, rabbit anti-mouse immunoglobulin G (IgG) and IgM and goat anti-rat Ig, were obtained from Dako and Nordic, respectively.

Plasmid construction. (i) pU104GUSREP. A 122-bp DNA fragment containing the promoter sequence of the early ASFV gene U104L (2) was generated by PCR using the primers 5'-GCGCGAATTCGTCGACGGATTTTAATTAGATTTGTGA and 5'-GCGCTCTAGATGTAGTGTTATATTACGAAAA, which contain EcoRI and XbaI restriction endonuclease sites at their 5' ends, respectively. The PCR product was digested with EcoRI and XbaI and was cloned into EcoRI-XbaI-digested pUC119 to generate the plasmid p119pU104. A 398-bp DNA fragment containing the 5' end of the lacI gene of E. coli was obtained by PCR from the pRSV-1 plasmid (32), by using the primers 5'-CGCGAAGCTTCTAGATGAAACCAGTAACGTTATACG and 5'-CCAGCGGATAGTTAATGATCAGC (the former contains HindIII and XbaI sites at the 5' end). The synthetic PCR fragment was cut with HindIII and MluI and was cloned into pRSV-1 digested with HindIII and MluI to generate pREP. A 1.2-kb XbaI fragment from pREP containing the complete lacI coding sequence was cloned into p119pU104 digested with XbaI, generating the plasmid pU104REP. Plasmid pU104REP10T was obtained by cloning a Klenow enzyme-treated 1.3-kb SalI fragment from pU104REP into p119.10T (28) digested with SmaI. A 1.3-kb SalI/EcoRI/Klenow enzyme-treated fragment from pU104REP10T was cloned into SmaI-digested pINSGUS (28), producing the transfer vector pU104GUSREP10T. pINSGUS contains BA71V EcoRI fragment sequences, including the nonessential coding sequence of the thymidine kinase (TK) gene, which had previously been used as a locus for the insertion of foreign genes.

(ii) pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II. A DNA fragment containing the core sequence of the E. coli lac operator O₁ was generated by annealing the partially overlapping oligonucleotides 5'-GATCTAATTGTGAGCGGATAACAATTG and 5'-GATCCAATTGTTATCCGCTCACAATTA (the core sequence of the lac operator is underlined). The resultant hybrid contains one end compatible with BamHI, so that the cloning of one or more copies of the fragment into a BamHI site results in the retention of a single BamHI site in the derivative plasmid. After annealing, the DNA fragment was incubated with T4 polynucleotide kinase and ATP and was ligated into the plasmid p72.4 (28) digested with BamHI. Two plasmids, p72.I and p72.II, containing one and two copies, respectively, of the operator sequence downstream of the viral late p72.4 promoter and upstream of a unique BamHI site, were selected. A 118-bp PCR DNA fragment containing the p72.4 promoter and the core sequence of the operator was generated from the p72.4 plasmid by using the oligonucleotides 5'-CGCGAGATCTTTGTTATTATCAAGATCC and 5'-GCGCGGATCCAATTGTTATCCGCTCACAATTTATATAATGTTATAAAAATAATTT, which contain, respectively, the restriction sites BglII and BamHI at their 5' ends. The PCR product was digested with BamHI and BglII and was then inserted into BamHI-linearized pUC118 to generate the plasmid p72.*I. By following the procedure used to generate p72.I, a second copy of the operator was inserted into the BamHI site of p72.*I to obtain the plasmid p72.*II. A 1.4-kb fragment containing the Photinus pyralis luciferase gene (24) was extracted from pKLuc and cloned into the BamHI sites of plasmids p72.4, p72.I, p72.II, p72.*I, and p72.*II, generating, respectively, p72.4.luc, p72.I.luc, p72.II.luc, p72.*I.luc, and p72.*II.luc. A 3.3-kb XbaI/Klenow enzyme-treated fragment from pINS72-gal (45), which contains the chimeric gene p72-lacZ (p72 promoter and lacZ gene), was cloned into p72.4.luc, p72.I.luc, p72.II.luc, p72.*I.luc, and p72.*II.luc linearized with SalI and 3'-end filled with Klenow enzyme to generate, respectively, pUCgal.luc, pUCgal.luc.I, pUCgal.luc.II, pUCgal.luc.*I, and pUCgal.luc.*II. Transfer vectors pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II were generated by inserting 5.2-kb HindIII/Klenow enzyme/SmaI-treated fragments from pUCgal.luc, pUCgal.luc.I, pUCgal.luc.II, pUCgal.luc.*I, and pUCgal.luc.*II, respectively, into pE'(HdA) linearized with EcoRV. pE'(HdA) was obtained by inserting a HindIII-to-AccI fragment of the EcoRI E' fragment of BA71V DNA into HindIII/AccI-digested pUC119. This fragment contains the CD2 coding sequence, which has previously been used as a locus for insertion of foreign sequences in ASFV recombinants (46).

(iii) pINDp72.I.gal(d) and pINDp72.I.gal(i). A synthetic DNA fragment of 427 bp, which contains the nucleotide sequence from 513 to 111 relative to the translation initiation codon of the ASFV B646L gene encoding the protein p72, was obtained by PCR from purified virus DNA by using the primers 5'-CGCGAATTCTTTATTTATCTTTTAC and 5'-CGCGAGATCTTAATTAACGATCAGC (these primers include EcoRI and BglII restriction sites at their respective 5' ends). pFl1 was generated by inserting this PCR fragment, cut with EcoRI and BglII, into BamHI/EcoRI-treated pUC118. The oligonucleotides 5'-CGCGGATCCATGGCATCAGGAGGAG and 5'-CGCGAGATCTAGCTGACCATGGGCC were used as primers to obtain a 422-bp PCR DNA fragment corresponding to the 5' end (400 bp) of the B646L coding sequence (the primers include, respectively, BamHI and BglII restriction sites at their 5' ends). The PCR fragment was digested with BglII and BamHI and inserted into BamHI-linearized p72.I, producing the plasmid pFl2-p72.I. A 524-bp SmaI-to-XbaI fragment treated with Klenow enzyme from pFl2-p72.I was cloned into pFl1 digested with HindIII and treated with Klenow enzyme, producing the plasmid pINDp72.I. A 3.3-kb fragment obtained by digestion with SmaI and SalI endonucleases and treatment with Klenow enzyme from p72GAL10T (28) was cloned into SalI-linearized and Klenow enzyme-treated pINDp72.I, producing the transfer vectors pINDp72.I.gal(d) and pINDp72.I.gal(i), where the p72-lacZ chimeric gene was inserted in the same or in the opposite transcriptional orientation as the B646L gene, respectively.

Generation of recombinant viruses. Recombinant viruses were generated as previously described (45). The structures of all the recombinant viruses described in this report were confirmed by DNA hybridization analysis (data not shown). The runs of seven or more consecutive thymidylate (T) residues in the coding strand are signals for mRNA 3'-end formation (2, 3). Thus, to minimize the risk of causing transcriptional disturbances when inserting chimeric genes into the virus genome, signals for the 3'-end formation of ASFV mRNAs were placed in transfer vectors. The positions of these signals in the viral genome of ASFV recombinants generated in this report are indicated in Fig. 1, 2A, and 3A.

(i) vGUSREP. Transfer vector pU104GUSREP10T, which contains a copy of the E. coli lacI gene under the control of the early virus promoter pU104 and the chimeric gene p72.4-gusA flanked by BA71V TK DNA sequences, was used to insert the lacI gene into the virus genome. Vero cells were infected with the BA71V strain of ASFV and transfected with pU104GUSREP10T. At 48 h postinfection (hpi), cells were harvested and diluted samples were used to infect Vero cell monolayers. The infected cells were covered with agar, and 4 days later, the GUS substrate 5-bromo-4-chloro-3-indolyl--D-glucuronic acid (X-Gluc) was added to the culture medium. The blue-stained recombinant plaques were selected and used to infect fresh monolayers of Vero cells. In this way, the recombinant virus vGUSREP was purified by three successive rounds of plaque isolation.

(ii) vA2, vA3, vA4, vA5, and vA6. Transfer vectors pRG, pRG.I, pRG.II, pRG.*I, and pRG.*II, containing different p72.4 promoter-operator-luciferase chimeric genes and the gene cassette p72-lacZ, flanked by BA71V CD2 DNA sequences, were used to obtain the recombinant viruses vA2, vA3, vA4, vA5, and vA6, respectively, from the recombinant virus vGUSREP. These recombinants were obtained in a similar way as vGUSREP, but the -Gal substrate X-Gal (5-bromo-4-chloro-3-indolyl--D-galactopyranoside) was used for the selection of the blue-stained recombinant plaques.

(iii) vA72. Transfer vectors pINDp72.I.gal(d) and pINDp72.I.gal(i) were used to generate the vA72 recombinant, in which an operator sequence was inserted between the p72 promoter and the B646L gene, which encodes the protein p72. They contain the gene cassette p72-lacZ and the operator sequence placed 8 bp downstream of the transcription initiation site of the p72.4 promoter. These sequences were flanked by the nucleotide sequence from 513 to 111 relative to the translation start codon of the B646L gene and a 400-bp sequence corresponding to the 5' end of the gene. All the purification steps were carried out in the presence of 1.25 mM IPTG, and the vA72 recombinant was obtained from transfer vector pINDp72.I.gal(i).

Luciferase assay. Vero cell monolayers cultured in 24-well plates were infected at 20 PFU per cell in the presence or in the absence of IPTG. Infected cells were harvested 24 hpi and were processed for luciferase activity determination as previously described (28). Protein levels were determined as described elsewhere (10).

Metabolic labeling and immunoprecipitation analysis. Vero cell cultures were infected at 5 PFU per cell and pulse-labeled for 1 h with [³⁵S]methionine at 16 hpi in methionine-free medium. The radioactive samples were dissociated and immunoprecipitated with the corresponding antibodies and protein A-coated Sepharose (31). For the electrophoretic analysis, whole extracts or immune complexes were solubilized by boiling in Laemmli sample buffer (0.05 M Tris-HCl [pH 6.8], 2% sodium dodecyl sulfate (SDS), 0.1 M dithiothreitol, 10% glycerol) and were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) (7 to 20% polyacrylamide) as previously described (34). Radioactive proteins were detected by fluorography (35).

Electron microscopy. For Epon embedding and postembedding immunolabeling, infected Vero cells were detached from the tissue culture dish at the indicated times by treatment with proteinase K (50 µg/ml) on ice for 2 to 3 min. For conventional Epon embedding, cells were fixed with 2% glutaraldehyde and 2% tannic acid in phosphate-buffered saline at room temperature for 1 h. Postfixing was carried out with 1% OsO₄ in phosphate-buffered saline at 4°C for 30 min. For postembedding immunolabeling, cells were fixed with 8% paraformaldehyde at 4°C for 1 h and processed for Lowicryl embedding as described elsewhere (12). Immunogold labeling was performed as previously described (4) with a rat serum against p72, a goat anti-rat Ig, and protein A-gold complexes (15 nm; BioCell Research Laboratories, Cardiff, United Kingdom).

	RESULTS

Top Abstract Introduction Materials & Methods Results Discussion References

Generation of an ASFV recombinant expressing the lac repressor protein. In order to incorporate into ASFV the inducible expression system based on the E. coli lac operon, we first generated a recombinant virus expressing the lac repressor protein. This virus was obtained by cloning the lacI gene into a transfer vector downstream of the promoter of the ASFV U104L early gene (2). The resulting virus, vGUSREP, possesses the genomic structure shown in Fig. 1, where the coding sequences of lacI and a reporter gene, gusA, are inserted into the nonessential TK gene (45) of the virus strain BA71V. The gusA gene, which encodes GUS, allowed for the selection and purification of vGUSREP by blue staining of the recombinant plaques with the enzyme substrate X-Gluc as previously shown (28). The presence of functional repressor protein in vGUSREP-infected cells was confirmed by gel retardation analysis of a radiolabeled DNA fragment containing the core 21-bp operator O₁ sequence (data not shown).

View larger version (7K): [in this window] [in a new window]   FIG. 1.   Genomic structure of the recombinant virus vGUSREP. The lacI gene fused to the viral promoter pU104 and the gusA gene fused to the viral promoter p72.4 are inserted into the TK locus of the ASFV strain BA71V. Signals for 3'-end mRNA formation are indicated ().

Generation of vGUSREP-derived recombinant viruses with hybrid virus promoters containing the lac operator sequence. To test if the repressor protein was able to control the gene expression from ASFV recombinants, we generated different hybrid virus promoters by fusing the operator sequence to a virus late promoter. One or two copies of the operator O₁ were placed at different locations between the strong promoter p72.4 (28) and the coding sequence of the firefly luciferase gene. This would permit us to ascertain the influence of the position of the operator relative to the promoter and of the number of operators on the degree of the repression and induction of gene activity. Another construct, lacking the operator, was generated as a positive control of the p72.4 promoter activity. All these chimeric genes (a general scheme is shown in Fig. 2B) were inserted into the nonessential region corresponding to the CD2 gene (46). DNA hybridization and PCR analysis were carried out to confirm the genomic structures of the recombinant viruses thus obtained, vA2, vA3, vA4, vA5, and vA6 (data not shown). The genomic structure of vA3, which is generally applicable for all of these, is shown in Fig. 2A.

View larger version (15K): [in this window] [in a new window]   FIG. 2.   (A) Genomic structure of the recombinant virus vA3. The luciferase gene, fused to the lac operator () and the viral promoter p72.4, and the lacZ gene, fused to the viral promoter p72, are inserted into the CD2 locus of vGUSREP. Signals for 3'-end mRNA formation are indicated (). (B) The structures of the different chimeric genes containing the p72.4 promoter-lac operator ()-luciferase gene inserted into the vGUSREP genome are shown on the left. Numbers represent distances (in base pairs) between the different elements of the chimeric genes. The transcription initiation site (arrows) is located from position 2 to 5 relative to the translation initiation codon of the p72 gene (44). The expression of luciferase in cells infected with recombinant viruses containing the chimeric genes in the absence or presence of IPTG is shown on the right. (C) Effect of IPTG concentration on induction level. The expression of luciferase in cell cultures infected with the recombinants vA3 and vA5 was determined with increasing concentrations of IPTG. Luciferase activity in B and C is the average of two experiments and is expressed as relative light units (RLU). In each experiment all infections were carried out in duplicate, and luciferase assays on each sample were carried out in duplicate. The values were adjusted to total protein content.

Construction of an ASFV recombinant inducibly expressing the p72 structural protein. An application of the lac operator-repressor system described above would be the study of the function of ASFV genes through their conditional expression. To test this, we inducibly expressed the B646L gene, which encodes the major capsid protein p72 (18, 37). For this purpose, an operator was inserted between the gene and its promoter into the vGUSREP genome. Since p72 is a major structural protein (13, 57) expressed during the late phase of the infection cycle, we constructed transfer vectors allowing high levels of gene induction. To this end, and based on the results described above (Fig. 2B), we inserted the operator sequence 8 bp downstream from the transcriptional start point in the recombinant vGUSREP. The purification of the resulting recombinant virus was carried out in the presence of IPTG in order to allow the expression of p72 in the presence of the repressor. Thus, the recombinant virus vA72 was obtained by using the transfer plasmid pINDp72.I.gal(i) (Fig. 3A). In this construct, the chimeric gene p72-lacZ is inserted in the transcriptional orientation opposite that of the B646L gene.

View larger version (22K): [in this window] [in a new window]   FIG. 3.   (A) Genomic structure of the recombinant virus vA72. The lacZ gene fused to the viral promoter p72 and the operator () fused to the viral promoter p72.4 are inserted upstream of the B646L gene of recombinant vGUSREP. Signals for 3'-end mRNA formation are indicated (). (B) Plaque size phenotype of vA72. Monolayers of Vero cells were infected in the absence or presence of 1.25 mM IPTG with BA71V or vA72. After 4 days of infection, plaques were visualized with 1% crystal violet. Note the smaller size of the lysis plaques of the recombinant virus vA72 compared to that of the parental virus, BA71V. (C) Growth curves of vA72. Vero cells were infected with BA71V or vA72 at an MOI of 10 PFU per cell in the presence or absence of 1.25 mM IPTG. vA72 was also grown under nonpermissive conditions for the indicated times and then induced with IPTG. At different hours postinfection, samples were collected and titrated by plaque assay on fresh Vero cells in the presence of the inducer.

vA72 is an IPTG-dependent recombinant virus. The ability of recombinant virus vA72 to form plaques under repression or induction conditions was studied. Plaques obtained on vA72-infected cells in the presence of IPTG were smaller than those obtained after infection with the parental BA71V virus (Fig. 3B). This result was not due to toxicity of the inducer, which at 1.25 mM had no effect on plaque formation by the parental virus (Fig. 3B), but to an incomplete induction of the protein p72 (see below). The number of plaques formed in the absence of the inducer was strongly reduced (40- to 50-fold). One-step virus growth curves of vA72 showed that the virus titers do not increase over time in the absence of IPTG, remaining about 3 log units below the titers obtained with the parental virus, BA71V (Fig. 3C). Under permissive conditions, the infectious virus yield of vA72 increased during the infection, but the maximal levels observed were lower, by 0.5 log units, than those found after BA71V infections. We have also tested the ability of vA72-infected cells maintained for different times under nonpermissive conditions to produce infectious virus after the addition of inducer. As shown in Fig. 3C, virus titers increased sharply after the addition of inducer at 16 hpi. When the inducer was added later, virus production increased more slowly. Interestingly, the later the time of IPTG addition, the lower the final virus yield obtained, indicating that restoration of infectivity depends on the time of p72 induction.

Synthesis of the protein p72 is IPTG-dependent. To test whether the expression of protein p72 was dependent on the presence of IPTG, we labeled infected cells with [³⁵S]methionine from 16 to 17 hpi. Similar protein profiles were obtained with parental BA71V and recombinant vA72 viruses in the presence and absence of the inducer, with the exception that a protein band with an electrophoretic mobility of about 115 kDa, representing the -Gal enzyme, was present on vA72-infected cells (Fig. 4A). Since GUS protein comigrates with protein p72, it was not possible to discern in this assay the effect of IPTG on the induction of p72.

View larger version (43K): [in this window] [in a new window]   FIG. 4.   Synthesis of the protein p72. Vero cells were either mock infected (M) or infected for 16 h with BA71V virus (B) or vA72 (V) in the absence or in the presence of 1.25 mM IPTG and were labeled with [35S]methionine for 1 h. (A) SDS-PAGE of the cell lysates. The electrophoretic mobilities of molecular weight markers are indicated in kilodaltons on at the left. (B) Cell lysates were immunoprecipitated with a monoclonal antibody against p72 (17L.D3) and a polyclonal serum against pp220 (anti-p37/p14). The immunoprecipitated polypeptides are shown.

Effect of p72 repression on virus morphogenesis. To analyze the effect of p72 repression on ASFV assembly, we performed electron microscopy studies of infected cells. In general, the virus-induced structures observed in vA72-infected cells in the presence of IPTG (Fig. 5A) were similar to those found in parental BA71V-infected cells (4-6). Assembling virions and irregular and parallel arrangements of membrane-like structures were observed in the replication areas. A recent report has shown that ASFV particles assemble from these viral membranes, which become polyhedral structures after capsid formation on their convex surfaces (4). Interestingly, the analysis of vA72-infected cells in the absence of the inducer showed no production of polyhedral viral structures but a strong accumulation of unusual membranous structures (Fig. 5B). These structures, which have been referred to as "zipper-like" (5, 6), consist of one pair of parallel and extended viral envelopes bound by a thick protein layer structurally similar to the core shell of the virus particle (4) (Fig. 5B). A close inspection revealed two types of zipper-like structures. One of them, referred to as "single," is formed by a copy of the core shell (Fig. 5B, insert a), while a second one, referred to as "double," is composed of two copies (Fig. 5B, insert b). Altogether, both zipper-like structures represent a minor proportion of the virus structures induced in the replication areas of parental BA71V- (5, 6) or vA72-infected cells under permissive conditions (Fig. 5A). However, while the single structures were frequently detected (Fig. 5A), the double structures were rarely seen.

View larger version (135K): [in this window] [in a new window]   FIG. 5.   Ultrathin Epon sections of viral factories in ASFV-infected cells. (A) vA72-infected cell incubated with IPTG up to 16 hpi. Large arrowheads, membrane-like structures; small arrowheads, single zipper-like structures; arrows, assembling virions. (B) vA72-infected cell at 16 hpi in the absence of IPTG. Parallel arrangements of membranous structures accumulate to a great extent in the assembly sites. These structures frequently appeared separated by either one (small arrowhead) or two (large arrowhead) copies of a thick layer symmetrically subdivided by a thin and electron-dense structure. Inserts are high-magnification micrographs of these single (a) and double (b) zipper-like structures. (C) Assembly site in a cell infected with vA72 in the absence of IPTG for 16 hpi and then incubated with the inducer for 4 h. Assembling virus particles (arrow), as well as other virus induced structures, can be seen. Arrowheads indicate single zipper-like structures acquiring polyhedral morphology. Note that single zipper-like structures can also be observed in vA72-infected cells incubated with IPTG (small arrowheads in panel A). Bars, 125 nm.

Effect of p72 expression on virus morphogenesis. To examine the effect of p72 expression on the structures seen in the replication areas constituted under nonpermissive conditions, we analyzed vA72-infected cells maintained during 16 h in the absence of the inducer and then incubated for different periods with IPTG. Major ultrastructural changes were observed in the assembly sites from 4 h postinduction onward (Fig. 5C and 6). Expression of p72 led to the formation of polyhedral structures from the previously accumulated membranous structures either on single (Fig. 6A) and double (Fig. 6B) zipper-like structures or on normal viral envelopes (Fig. 6C). A high-magnification analysis revealed that this transformation was concomitant with the appearance of a new layer about 7 nm thick on the external surfaces of the membrane-like structures (Fig. 6). We conclude that this layer corresponds to the viral capsid, as deduced by the regular array of subunits composing it (Fig. 6A₂) as well as by its effect on the virus shape.

View larger version (118K): [in this window] [in a new window]   FIG. 6.   Capsid formation. Shown are ultrathin Epon sections of cells infected with vA72 that were treated with IPTG at 16 hpi during an 8-h period. Single zipper-like structures (A), double zipper-like structures (B), and normal viral membranous structures (C) acquire polyhedral morphology by the progressive formation over their external surfaces of a thin layer of about 7 nm (arrowheads). This layer is the viral capsid, as deduced by the ordered array of individual capsomers composing it (arrows in panel A2). Bars, 50 nm.

View larger version (174K): [in this window] [in a new window]   FIG. 7.   Assembling virions. Shown are ultrathin Epon sections of cells infected with vA72 in the absence of IPTG up to 16 hpi and later incubated with the inducer for 8 h. (A) Viral intermediates formed from membrane-like structures containing, underneath the capsid, the inner viral envelope and the core shell, showing the normal pathway of ASFV assembly. (B) Capsid formation on double zipper-like structures leads to the separation of both core shell layers (arrowheads), probably giving rise to normal virions. (C) Virus maturation from single zipper-like structures gives rise to a subpopulation of virions containing an additional internal membrane envelope. Numbers at the arrowheads in panel C3 indicate normal inner envelope (1) and additional innermost envelope (2). During the assembly from single zipper-like structures, intermediate forms with two membrane envelopes might lose the innermost one (arrowheads in panel C2), giving rise to normal virions. (D) Intracellular double-enveloped virions containing an electron-dense nucleoid (arrows). (E) Double-enveloped virion (arrowhead) and mature intracellular particles (arrows) in a replication area representing different stages of vA72 maturation. Bars, 150 nm.

View larger version (111K): [in this window] [in a new window]   FIG. 8.   Immunoelectron microscopy of protein p72. (A) Lowicryl sections of vA72-infected cells maintained 16 h in the absence of IPTG (A1) or treated with the inducer at 16 hpi during an 8-h period (A2). The samples were labeled after embedding with a rat anti-p72 serum, a goat anti-rat Ig, and protein A-gold complexes (15 nm). Note that while in the absence of IPTG the replication areas were poorly labeled, in the presence of the inducer the label strongly increased and was mainly associated with zipper-like structures and polyhedral virus particles (arrows). Bars, 200 nm. (B) BA71V-infected cells permeabilized at 20 hpi with streptolysin O. After brief fixation, the cells were incubated with a mixture of anti-p72 monoclonal antibodies (17L.D3 and 19B.A2), and then with protein A-gold (5 nm). Finally, the cells were processed for conventional Epon embedding, and very thin sections (less than 60 nm) were analyzed. Note that the labeling is usually associated with the outer, but not the inner, surfaces of open virus particles (arrowheads in panels B1 and B2) and with one of the two sides of the precursor viral membranes (arrowheads in panel B3). Bars, 200 (B1) and 100 (B2 and B3) nm.

Ultrastructural localization of p72 in the virus particle. Recently, Cobbold et al. (19) have proposed that p72 is externally and internally located in the intracellular virus particles, peripherally bound to both surfaces of the viral envelope. However, the ultrastructural studies described in the present report clearly indicate that the capsid is built exclusively on the outer surface of the viral envelope. To analyze this apparent contradiction, the precise localization of p72 in the virus structure was determined by preembedding labeling experiments with infected cells permeabilized with streptolysin O (as described in Materials and Methods). For this purpose, we infected Vero cells with either the parental virus, BA71V, or recombinant vA72 virus under permissive conditions.

	DISCUSSION

Top Abstract Introduction Materials & Methods Results Discussion References

Inducible expression of genes from ASFV recombinants. A system for the inducible expression of genes from ASFV recombinants is presented. This system is based on the binding of the E. coli lac repressor protein to the operator sequence of an inducible promoter and has been previously transferred successfully to regulate the expression of transfected or integrated reporter genes in mammalian cells (for a review, see reference 30) and vaccinia virus-infected cells (1, 27, 36, 43, 47, 62).

Role of the major capsid protein p72. This report shows, by analysis of the B646L gene, which encodes the major capsid protein p72 (16, 18, 19, 37), the utility of the inducible gene expression system. We considered it preferable to maintain the target gene in its original site and insert the lac operator downstream of the natural promoter. In this way, we obtained the vA72 recombinant, which contains a hybrid promoter similar to that directing the luciferase expression in vA3, thus allowing high levels of induction.