Previous Article | Next Article 
J Virol, April 1998, p. 3107-3116, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Bombyx mori Nucleopolyhedrovirus Encodes
a DNA-Binding Protein Capable of Destabilizing Duplex DNA
Victor S.
Mikhailov,1,2,*
Alla L.
Mikhailova,2
Masashi
Iwanaga,2
Sumiko
Gomi,2 and
Susumu
Maeda2,3
N. K. Koltzov Institute of Developmental
Biology, Moscow, Russia1;
Laboratory of
Molecular Entomology and Baculovirology, The Institute of Physical
and Chemical Research (RIKEN), Wako,
Japan2; and
Department of Entomology,
University of California, Davis, California 956163
Received 21 October 1997/Accepted 12 December 1997
 |
ABSTRACT |
A DNA-binding protein (designated DBP) with an apparent molecular
mass of 38 kDa was purified to homogeneity from BmN cells (derived from
Bombyx mori) infected with the B. mori
nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of
the isolated protein with Achromobacter protease I were
partially or completely sequenced. The determined amino acid sequences
indicated that DBP was encoded by an open reading frame (ORF16) located
at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank
accession no. L33180). This ORF (designated dbp) is a
homolog of Autographa californica multicapsid NPV ORF25,
whose product has not been identified. BmNPV DBP is predicted to
contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to
have an isoelectric point of 7.8. DBP showed a tendency to
multimerization in the course of purification and was found to bind
preferentially to single-stranded DNA. When bound to oligonucleotides,
DBP protected them from hydrolysis by phage T4 DNA
polymerase-associated 3'
5' exonuclease. The sizes of the protected
fragments indicated that a binding site size for DBP is about 30 nt per
protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding
partial DNA duplexes in an in vitro system. This helix-destabilizing
ability is consistent with the prediction that DBP functions as a
single-stranded DNA binding protein in virus replication.
 |
INTRODUCTION |
Nucleopolyhedroviruses (NPVs) have
large (80- to 180-kb) circular double-stranded DNA (dsDNA) genomes,
which replicate in nuclei of infected cells. Despite the widespread use
of NPVs for the expression of foreign genes and their potential for
pest control, little is known about the mechanism of their replication
and the properties of their replication factors. The most widely
studied baculovirus, Autographa californica multicapsid NPV
(AcMNPV), has the potential to encode about 150 proteins
(3), including factors required for virus DNA replication.
The products of nine viral genes (ie-1, ie-2,
lef-1, lef-2, lef-3,
dnahel, dnapol, p35, and
lef-7 or pe-38) are necessary and sufficient for
efficient replication of transfected plasmid DNAs containing a putative baculovirus replication origin (16, 22). It is likely that DNA polymerase and DNA helicase, which are encoded by the viral genes
dnapol and dnahel, respectively (20,
35), form a core of the virus DNA replication machinery. The
roles of other factors are less obvious. Single-stranded DNA binding
(SSB) protein function was proposed for the protein LEF-3, which binds
specifically single-stranded DNA (ssDNA) (10, 14). However,
direct proof for the SSB function of LEF-3 in viral DNA replication is
lacking. In addition, SSB function was also suggested for LEF-7 on the
basis of its predicted amino acid sequence (22). It was
recently demonstrated that LEF-1 forms a complex with LEF-2 and may
serve as a DNA primase (9). The function of IE-1, IE-2, and
PE-38 may result from their ability to activate in trans
expression of other genes required for virus replication. The
transactivator IE-1 may also participate in the initiation of DNA
replication, due to its ability to bind putative replication origins
(7, 13, 17, 33). P35 is an inhibitor of apoptosis and may
not be involved directly in DNA replication. Its stimulatory effect in
the transient-replication assay may result from inhibition of
virus-induced apoptosis in cells transfected with the replication
genes. Several genes required for DNA replication (six essential and
three stimulatory) were also identified in the genome of Orgyia
pseudotsugata NPV (1). Homology of these genes to
those required for replication of AcMNPV suggests
similar replication mechanisms for the two viruses. The genome
organization of the Bombyx mori NPV (BmNPV) closely
resembles that of AcMNPV. Nineteen homologs of the
AcMNPV late expression factor genes (lef genes)
were identified in BmNPV (12). At least three of these,
ie-2, lef7, and p35, are not essential
for virus DNA replication as demonstrated by deletion analysis
(12). Because the daughter DNA molecules synthesized under
control of the nine essential viral genes appear to be synthesized as
concatemers (16, 22, 31, 32), factors required for
maturation of nascent DNA and its further processing are still unknown.
Although the nine AcMNPV factors were sufficient for
efficient DNA replication in Sf cells, an additional viral gene,
designated hcf-1, was essential for replication in TN-368
cells (21), indicating dependence of the transient assay on
host cell-specific factors. Few proteins involved in NPV DNA
replication have been purified from infected cells and characterized in
cell-free systems. Among them are AcMNPV DNA polymerase
(28, 37), BmNPV DNA polymerase (27),
AcMNPV DNA helicase (19), and AcMNPV
LEF-3 (10, 14). Isolation of other replication proteins of
NPVs is still anticipated.
In this report we describe the purification of a viral DNA-binding
protein (designated DBP) from BmNPV-infected cells. DBP binds
preferentially to ssDNA and is capable of unwinding duplex DNA. The
BmNPV open reading frame (ORF) encoding DBP (dbp gene) is a
homolog of AcMNPV ORF25, whose product has not been
identified so far.
 |
MATERIALS AND METHODS |
Purification of DBP.
Monolayers of BmN (silkworm B. mori) cells were cultured as described earlier (23,
24). The cells (5 × 108) were infected with
BmNPV (isolate T3) (23) at a multiplicity of infection of 10 in TC-100 Insect medium (Sigma) supplemented with 10% fetal bovine
serum and harvested 26 h postinfection. Infected cells were
collected by centrifugation, washed three times with phosphate-buffered
saline and once with hypotonic buffer A containing 20 mM HEPES (pH
7.5), 5 mM KCl, 1.5 mM MgCl2, 1 mM dithiothreitol (DTT),
and a set of protease inhibitors (0.2 mM phenylmethylsulfonyl fluoride,
1 µM pepstatin, 5 µg of leupeptin per ml, 5 µg of aprotinin per
ml, 2 µg of E64 per ml, and 2 mM benzamidine), and centrifuged again.
The cells were resuspended in an equal volume of buffer A, allowed to
swell on ice for 10 min, and then lysed by 15 strokes of a
tight-fitting pestle in a Wheaton Dounce homogenizer. The homogenate
was centrifuged at 2,000 × g for 10 min to pellet
nuclei. The nuclei were resuspended in an equal volume of buffer A
containing 3.4 M NaCl, transferred into a 4-ml centrifuge tube, and
then incubated on ice for 1 h. The extract was centrifuged at
100,000 × g for 1 h, and the supernatant was
dialyzed for 2.5 h against two changes of buffer B (20 mM HEPES
[pH 7.5], 10% glycerol, 0.1 M NaCl, 5 mM KCl, 1.5 mM
MgCl2, 1 mM DTT, and the set of protease inhibitors). The
extract was clarified by centrifugation at 100,000 × g
for 15 min, adjusted to 10 mM EDTA, and loaded onto a 2-ml column of
ssDNA cellulose (Sigma) equilibrated with buffer C (10 mM HEPES [pH
7.5], 10% glycerol, 0.1 M NaCl, 1 mM EDTA, 1 mM DTT, and the set of
protease inhibitors). The column was washed with 10 ml of buffer C and then successively processed with 10-ml portions of buffer C containing NaCl at final concentrations of 0.2, 0.4, 0.6, 0.7, 0.8, 1.0, 1.4, and
2.0 M. Proteins from each fraction were analyzed by sodium dodecyl
sulfate-12% polyacrylamide gel electrophoresis (SDS-12% PAGE)
followed by staining with Coomassie brilliant blue or by Western
blotting. After analysis of the protein pattern, the fractions collected were either directly used for experiments or the protein was
purified further. In the latter case, the samples were dialyzed against
an excess of buffer containing 10 mM Tris-HCl (pH 8.5), 10% glycerol,
1 mM EDTA, 1 mM DTT, 0.4 mM phenylmethylsulfonyl fluoride, and 2 mM
benzamidine and were loaded onto a DEAE-Toyopearl 650 (Tosoh) column
(0.5 by 2.7 cm) equilibrated with the same buffer. Proteins were eluted
from the column by using an NaCl gradient in the buffer, and fractions
containing DBP were collected at 30 to 50 mM NaCl. The samples were
dialyzed against buffer D (10 mM Tris-HCl [pH 7.5], 50% glycerol,
0.1 mM EDTA, 1 mM DTT, and the set of protease inhibitors) and stored
at
20°C. Protein concentrations were determined by SDS-PAGE of
portions from the samples followed by optical densitometry of the gel
stained with Coomassie brilliant blue. Bovine serum albumin (Bio-Rad)
loaded in different amounts on separate lanes of the same gel was used for generation of the calibration curve.
Purification of LEF-3.
The fraction collected at 0.6 M NaCl
in the course of chromatography of the high-salt extract from
BmNPV-infected BmN cells on ssDNA cellulose (see above) was used as a
source of BmNPV LEF-3. It was dialyzed against buffer C and loaded onto
an ssDNA agarose column (0.5 by 3.8 cm) equilibrated with the same
buffer. The column was washed with 8 ml of buffer C containing 0.4 M
NaCl and then successively processed with 2.4-ml portions of buffer C
containing NaCl in final concentrations of 0.5, 0.6, 0.7, 0.8, and 1.0 M. Each portion was collected into three fractions. Proteins from each
fraction were analyzed by SDS-12% PAGE followed by staining with
Coomassie brilliant blue. LEF-3 was eluted by 0.6 to 0.8 M NaCl.
Fractions enriched in LEF-3 were combined and dialyzed against buffer
containing 10 mM Tris-HCl (pH 7.5), 10% glycerol, 1 mM EDTA, 1 mM DTT,
0.4 mM phenylmethylsulfonyl fluoride, and 2 mM benzamidine and loaded
onto a DEAE-Toyopearl column (0.5 by 2.7 cm) equilibrated with the same
buffer. The column was processed with an NaCl gradient in the buffer,
and fractions containing LEF-3 were collected at 0.16 to 0.2 M NaCl.
The sample was dialyzed against buffer D and stored at
20°C.
PAGE and Western blotting.
SDS-12% PAGE was performed as
described by Laemmli (18). Gels were either fixed and
stained with Coomassie brilliant blue or electrophoretically
transferred to Clear-blot membrane-p by using a semidry-blot apparatus
(Atto) according to the manufacturer's guidelines. Western blots were
probed with a 1:3,000 dilution of rabbit polyclonal antiserum to
AcMNPV LEF-3 (10) (a gift from George F. Rohrmann), washed, incubated with a 1:5,000 dilution of goat
anti-rabbit immunoglobulin G conjugated to horseradish peroxidase (ICN
Pharmaceuticals), and developed by using an ECL detection system
(Amersham) according to the manufacturer's instructions.
Protein sequencing.
Protein bands corresponding to DBP were
identified by staining with Coomassie brilliant blue after SDS-12%
PAGE of the purified protein (5.6 µg). Pieces of the gel containing
the desired band were excised, transferred to a 1.5-ml Eppendorf tube,
and soaked in 0.15 ml of buffer containing 0.1 M Tris-HCl (pH 9.0), 2 mM EDTA, and 0.1% SDS. The protein was digested by treatment with 0.5 µg of Achromobacter protease I for 16 h at 37°C.
The sample was clarified by centrifugation in a Suprec-01 filter unit
(Takara) and adjusted to pH 2 to 3 by the addition of 70% formic acid. It was then fractionated by high-pressure liquid chromatography on a
DEAE column (2 by 30 mm; Senshu Scientific), followed in tandem by a
PEGASIL-300 C8 column (2 by 100 mm; Senshu Scientific), with an HP 1100 chromatographic system (Hewlett-Packard). The columns were processed by
using a linear gradient of 0 to 60% solvent B (80% acetonitrile,
0.069% trifluoroacetic acid) mixed with solvent A (0.075%
trifluoroacetic acid) at a flow rate of 0.2 ml/min for 48 min. The
purified peptides were subjected to sequence analysis on a 473A protein
sequencer (Applied Biosystems) according to the manufacturer's
instructions. Matrix-assisted laser desorption/ionization
time-of-flight (MALDI-TOF) mass spectral analysis was performed with a
MALDI-TOF REFLEX mass spectrometer (Bruker) with
alpha-cyano-4-hydroxycinnamic acid (Sigma) as a matrix.
Mobility shift assay and unwinding assay.
The following
oligonucleotides were used as the substrates in binding reactions:
17-mer (TGCCGGGATCATAGAAG), 36-mer
(GCAGTGTAGCCACACAGAGTGCCGGGATCATAGAAG), 51-mer(a)
(AAGCGGAGTGTATGTGCAGTGTAGCCACACAGAGTGCCGGGATCATAGAAG), 51-mer(b)
(CTTCTATGATCCCGGCACTCTGTGTGGCTACACTGCACATACACTCCGCTT), and
64-mer
(GATTTCATCTAGCCTTCTATGATCCCGGCACTCTGTGTGGCTACACTGCACATACACTCCGCTT). The oligonucleotides were labeled at the 5' ends with
32P by using T4 polynucleotide kinase (Takara) and
[
-32P]ATP (ICN Radiochemicals). Unless noted
otherwise, binding reactions were carried out in buffer E (10 mM
Tris-HCl [pH 8.0], 0.15 M NaCl, 2 mM DTT, 100 µg of bovine serum
albumin per ml). Reaction mixtures of 10 µl contained 0.001 to 0.15 pmol of 32P-labeled oligonucleotide probe and 3 µl of
protein sample in buffer D. After mixing of the components at 0°C,
reaction mixtures were incubated for 15 min at 23°C. Half of each
reaction mixture was loaded onto a 6% polyacrylamide
(acrylamide-bisacrylamide, 60:1) slab gel (6 by 10 by 0.075 cm)
prepared in a buffer containing 20 mM HEPES (pH 8.0) and 0.1 mM EDTA.
Electrophoresis was performed and autoradiographs were obtained as
previously described (26).
For unwinding assays, DNA duplexes were prepared by annealing of the
labeled 17-mer or 36-mer to a 1.2-fold molar excess of the unlabeled
51-mer(b) (*17:51-mer and *36:51-mer duplexes) or by annealing of the
labeled 51-mer(a) to a 1.2-fold molar excess of the unlabeled 64-mer
(*51:64-mer duplex). Unwinding reactions were carried out in buffer E
without NaCl. Reaction mixtures of 10 µl contained 0.005 pmol of the
DNA duplex and 3 µl of protein sample in buffer D. After incubation
at 23°C, reaction mixtures were treated with 1% SDS and 0.5 mg of
proteinase K per ml for 20 min at 23°C and analyzed by
electrophoresis in 6% polyacrylamide gels as described above.
Sedimentation in glycerol gradients.
Linear 15 to 30%
glycerol gradients were prepared in buffer F (10 mM Tris-HCl [pH
7.5], 0.4 M NaCl, 1 mM EDTA, 1 mM DTT, 0.2 mM phenylmethylsulfonyl
fluoride). Protein samples (0.15 ml), after dialysis against buffer F
containing 10% glycerol, were layered over 4.0 ml of a glycerol
gradient prepared in nitrocellulose tubes for an SW 60.Ti rotor
(Beckman). Ovalbumin (45 kDa, 3.6S) and aldolase (158 kDa, 7.4S) (0.2 mg of each) were centrifuged in individual tubes as sedimentation
standards. After centrifugation in the SW 60.Ti rotor at 55,000 rpm and
4°C for 24 h, the gradients were fractionated from the bottom
with a peristaltic pump.
 |
RESULTS |
Purification of DBP.
In a search for BmNPV products essential
for virus DNA replication, we analyzed for viral proteins possessing a
high affinity for ssDNA. The DNA-binding proteins were detected in
high-salt extracts of nuclei from BmNPV-infected BmN cells by using
chromatography on ssDNA cellulose (Fig.
1). Most of the proteins that bound to ssDNA were eluted from the column at NaCl concentrations lower than 0.6 M. An abundant protein of 44 kDa eluted by 0.6 M NaCl was identified as
BmNPV LEF-3 by Western blotting with polyclonal antiserum against
AcMNPV LEF-3 (Fig. 1B). The antiserum specifically recognized a protein with an apparent molecular mass of 44 kDa that
appeared predominantly in the 0.6 M NaCl fraction (Fig. 1A). One major
protein (designated DBP) was present in fractions that eluted at NaCl
concentrations higher than 1.0 M (Fig. 1A). It migrated with an
apparent molecular mass of 38 kDa. As shown by optical densitometry of
the Coomassie blue-stained polyacrylamide gel, ~97% of the protein
in the 1.4 M NaCl fraction and ~93% of the protein in the 2.0 M NaCl
fraction was associated with this single 38-kDa polypeptide band. The
total yield of DBP in both fractions from 5 × 108
cells was about 30 µg. For further purification of DBP, the fractions collected after chromatography on ssDNA cellulose were subjected to
chromatography on DEAE-Toyopearl. The protein showed a low affinity for
the DEAE-resin, but most was retained on the column after loading in
the absence of monovalent salt. DBP was eluted by 30 to 50 mM NaCl, and
based on SDS-PAGE, it was purified to a homogeneous state (Fig. 1C,
lane 1). To compare DBP with a known viral protein also possessing high
affinity for ssDNA, we purified LEF-3 from BmNPV-infected BmN cells to
a homogeneous state as described in Materials and Methods (Fig. 1C,
lane 2). The molecular mass of BmNPV LEF-3 estimated by SDS-PAGE, 44 kDa, corresponds well to the calculated value of 44.8 kDa for the
polypeptide predicted to be encoded by BmNPV ORF55, the BmNPV
lef-3 gene (12) (GenBank accession no. L33180).

View larger version (65K):
[in this window]
[in a new window]
|
FIG. 1.
Purification of DNA-binding proteins of BmNPV. (A and B)
ssDNA cellulose chromatography of nuclear extract from BmNPV-infected
BmN cells. The flowthrough (FT) and fractions eluted at the indicated
molar concentrations of NaCl were analyzed by SDS-12% PAGE followed
by staining with Coomassie brilliant blue (A) or by Western blotting
with antiserum to LEF-3 (B). (C) Proteins DBP and LEF-3 after final
purification on DEAE-Toyopearl. DBP (0.6 µg) (lane 1) and LEF-3 (0.6 µg) (lane 2) were analyzed by SDS-12% PAGE followed by staining
with Coomassie brilliant blue. The migration of molecular size markers
(in kilodaltons) is shown in lanes M in panels A and C and on the right
side of the blot in panel B. The asterisks show the position of LEF-3
in panel A.
|
|
The 38-kDa DNA-binding protein has not been previously identified in
insect cells infected with NPVs. The absence of this
polypeptide from
extracts of uninfected cells suggested that it
was of viral origin
(data not shown). Therefore, we decided to
obtain additional
information about this protein presumably encoded
by the virus genome.
Identification of DBP as a product of the BmNPV genome.
To
identify the source of the 38-kDa DNA-binding protein, we partially or
completely sequenced six peptides obtained after digestion with
Achromobacter protease I, which cleaves proteins at lysines.
All of them were shown to belong to a polypeptide predicted to be
encoded by BmNPV ORF16, located at nucleotides (nt) 16189 to 17139 in
the BmNPV (isolate T3) genome (GenBank accession no. L33180) (Fig.
2). This ORF was designated the dbp gene. The molecular masses of three other peptides (Fig.
2) were determined by mass spectrometry (MALDI). The values obtained by
MALDI were in agreement with molecular masses predicted for digestion
products of DBP. The BmNPV dbp gene is predicted to encode a
protein of 317 amino acids (36.7 kDa) with an isoelectric point of 7.8. The apparent molecular mass of 38 kDa estimated for DBP by SDS-PAGE
corresponds to the mass predicted from the BmNPV dbp gene.
The nucleotides surrounding the start codon ATG are consistent with the
Kozak rule (AXXATG[A/G]). A putative RNA polymerase II promoter
(TATA) is present at nt
69, and a sequence (CAAT) similar to the
baculovirus early start site (CAGT) is found 28 nt downstream (Fig. 2).
This suggests that dbp may be expressed as an early gene. An
ORF homologous to BmNPV dbp in the genome of the closely
related virus AcMNPV, ORF25, was described earlier (3). AcMNPV ORF25 potentially encodes a protein
of 316 amino acids, which showed 95.9% identity with BmNPV DBP. A
similar ORF, ORF43, was also found in the O. pseudotsugata
MNPV (2). To date, the mRNA species and protein
products encoded by these ORFs have not been identified in NPV-infected
cells. BmNPV DBP does not show high homology to any nonbaculovirus
protein in the gene bank.

View larger version (59K):
[in this window]
[in a new window]
|
FIG. 2.
DBP is encoded by the BmNPV genome. The nucleotide
sequence of BmNPV (isolate T3) dbp (from GenBank; accession
no. L33180) is shown. The predicted amino acid sequence of DBP is shown
above the nucleotide sequence. Stop codons are indicated by the
asterisks. The numbers on the right are amino acid positions. Six
peptides were subjected to protein sequencing, and the molecular masses
of three peptides were estimated by mass spectrometry (MALDI). The
determined amino acid sequences are underlined with thick lines, and
those determined by MALDI are underlined with thin lines.
|
|
Mobility shift assay of the interaction of DBP with DNA.
Binding of DBP to ssDNA (Fig. 1A) might reflect the biological function
of this protein. To study the interaction of DBP with DNA in detail, we
used electrophoretic mobility shift analysis. The protein was incubated
with 5'-end-labeled 51-mer or 64-mer oligonucleotides, and the products
were subjected to nondenaturing PAGE (see Materials and Methods).
Before beginning the mobility shift experiments, preparations of DBP
were tested for endonucleolytic activity. For this assay, the protein
(2.5 µg/ml) was incubated with M13mp7 ssDNA (10 µg/ml) or with
pSK+ dsDNA (10 µg/ml) in a reaction mixture containing 20 mM Tris-HCl (pH 7.5), 10 mM MgCl2, and 2 mM DTT for 1 h at 37°C. DNA was then extracted with phenol and phenol-chloroform
(1:1), precipitated with ethanol, and analyzed by electrophoresis in a
0.7% agarose gel. No degradation of M13 DNA or conversion of
pSK+ DNA from replicative form I (RFI) into RFII (or RFIII)
was observed (data not shown).
In the first series of binding reactions, we used DBP from the 1.4 M
NaCl elution fraction after chromatography on ssDNA cellulose
(Fig.
1A). Binding of DBP to the 64-mer in the absence of monovalent
salt
resulted in the appearance of three major shifted species
(Fig.
3A, lanes 2 to 5). Similar retardation
patterns were observed
after binding reactions with the 51-mer(b)
oligonucleotide (data
not shown), and these oligonucleotides were used
interchangeably.
The first species migrating above free oligonucleotide
may be
a complex of the oligonucleotide with a monomer of DBP, whereas
the slowly migrating band in the upper part of the gel may result
from
binding of the oligonucleotide to a large protein aggregate.
Evidence
for this interpretation was provided by glycerol gradient
fractionation
of the DBP sample before the mobility shift assay
(Fig.
3C). The
protein fraction that cosedimented with ovalbumin
(45 kDa, 3.6S)
interacted to form the first band above the free
oligonucleotide in the
mobility shift assay (Fig.
3C, lane 9),
suggesting that the respective
complexes contain monomers of DBP.
The DBP fraction that sedimented
ahead of aldolase (158 kDa, 7.4
S) provided the slowly migrating band
in the gel (Fig.
3C, lanes
1 to 4), indicating that the respective
complexes are formed by
the oligonucleotide binding to DBP multimers.
The fractionation
procedure altered the proportions of different
oligomeric forms
of DBP, because after centrifugation, the second band
above the
free oligonucleotides was not visible, whereas the relative
amount
of slowly migrating complexes was increased. The DBP multimers
were presumably due to protein-protein interactions, because
pretreatment
of the DBP sample prior to centrifugation with an
equimolar amount
of DNase I did not change the protein sedimentation
pattern in
glycerol gradients (data not shown). The proportion of DBP
oligomers
in the DBP preparations was also influenced by the
purification
procedures. The DBP sample collected after chromatography
on DEAE-Toyopearl
contained predominantly protein multimers. Only one,
slowly migrating
band was formed in the absence of salt (Fig.
3B, lanes
1 to 5).
Addition of NaCl to the reaction decreased the amount of
oligonucleotides
bound to the protein aggregates and caused the
appearance of the
faster-migrating species. Thus, after overnight
incubation of
the DBP sample at 0.5 M NaCl and subsequent binding in
0.15 M
NaCl, complexes of oligonucleotides with protein monomers and
higher oligomers were detectable (Fig.
3B, lanes 6 to 9). The
inhibition effect of NaCl on generation of the slowly migrating
complexes was less pronounced with the DBP sample collected after
DEAE-Toyopearl chromatography than with that purified by using
ssDNA
cellulose (compare Fig.
3A and B). In the latter case, addition
of 0.15 M NaCl to the binding mixture precluded the appearance
of the slowly
migrating species (Fig.
3A, lanes 6 to 9). Therefore,
multimerization
of DBP and stability of DBP multimers appeared
to depend on the
concentration of monovalent salts, but this question
was not
investigated further. The presence of DBP multimers hampered
the
quantitative estimation of the molar concentration of active
protein in
the mobility shift assay. Saturation of the oligonucleotide
substrates
with protein was observed in the presence of a molar
excess of DBP.

View larger version (75K):
[in this window]
[in a new window]
|
FIG. 3.
Electrophoretic mobility shift assay of DNA-binding
activity of DBP. Reaction mixtures (10 µl) containing
5'-32P-labeled oligonucleotide probe and purified DBP (see
Materials and Methods) were incubated for 15 min at 23°C. Portions (5 µl) of reaction mixtures were analyzed by electrophoresis in 6%
polyacrylamide gels. (A) Binding of ssDNA cellulose-purified DBP to the
64-mer. Reaction mixtures contained 0.004 pmol of 64-mer and the
following amounts of DBP: lanes 2 and 6, 1.7 ng; lanes 3 and 7, 5.2 ng;
lanes 4 and 8, 10.4 ng, and lanes 5 and 9, 20.7 ng. No protein was
added to the reaction shown in lane 1. Reaction mixtures were incubated
in the absence of NaCl (lanes 1 to 5) or in the presence of 0.15 M NaCl
(lanes 6 to 9). (B) Binding of DBP collected after chromatography on
DEAE-Toyopearl to the 64-mer. Reaction mixtures contained 0.01 pmol of
64-mer and the following amounts of DBP: lanes 2 and 6, 3.6 ng; lanes 3 and 7, 10.6 ng; lanes 4 and 8, 21.4 ng; and lanes 5 and 9, 43 ng. No
protein was added to the reaction shown in lane 1. Reaction mixtures
were incubated in the absence of NaCl (lanes 1 to 5), or the protein
was preincubated for 16 h in the presence of 0.5 M NaCl before
addition to the reaction mixtures (final concentration, 0.15 M NaCl)
(lanes 6 to 9). (C) Glycerol gradient fractionation of DBP oligomers.
DBP (1 µg in 150 µl) collected after chromatography on ssDNA
cellulose was layered over 4.0 ml of a gradient of 15 to 30% glycerol
in buffer containing 10 mM Tris-HCl (pH 7.5), 0.4 M NaCl, 1 mM EDTA, 1 mM DTT, and 0.2 mM phenylmethylsulfonyl fluoride and was centrifuged in
an SW 60.Ti rotor at 55,000 rpm and 4°C for 24 h. The gradient
was fractionated from the bottom into 16 fractions, and DNA-binding
activity in 5-µl portions was determined for each fraction added to
the reaction mixtures containing 0.001 pmol of 5'-labeled 51-mer(b).
The positions of the standards centrifuged in separate tubes are shown
by arrows: aldolase, 158 kDa, 7.4S (fraction 3.5); ovalbumin, 45 kDa,
3.6S (fraction 9.3). No protein was added to the reaction shown in lane
0.
|
|
To verify the binding specificity of DBP for ssDNA, we compared the
efficiencies of M13 ssDNA and pSK
+ dsDNA (RFII) as
competitors in binding reactions with the 5'-end-labeled
oligonucleotide (Fig.
4A and C). The
ssDNA appeared to be at least
1 order of magnitude more efficient a
competitor than dsDNA, indicating
much higher affinity of DBP for ssDNA
than for dsDNA. The higher
affinity of DBP for ssDNA was confirmed by a
direct comparison
of DBP binding to the single-stranded 51-mer
oligonucleotide versus
the 51-mer duplex (Fig.
4B and D). The
preference for binding
to ssDNA was demonstrated for preparations of
DBP with different
proportions of oligomeric forms, including the
sample collected
after chromatography on ssDNA cellulose, which
contained monomers
and higher oligomers (data not shown).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 4.
DBP binds preferentially to ssDNA. Reaction mixtures (10 µl) containing 5'-32P-labeled oligonucleotide probe and
DBP collected after chromatography on DEAE-Toyopearl (see Materials and
Methods) were incubated in the presence of 0.15 M NaCl for 15 min at
23°C. Portions (5 µl) of reaction mixtures were analyzed by
electrophoresis in 6% polyacrylamide gels. (A and C) Competition
analysis of DBP with ssDNA and dsDNA. (A) Reaction mixtures contained
0.047 pmol (1 ng) of 64-mer, 30 ng of DBP, and competitor DNA (M13mp9
ssDNA [lanes 3 to 6] or pSK+ dsDNA [RFII] [lanes 7 to
10]) added in the following amounts: lanes 3 and 7, 2 ng; lanes 4 and
8, 5 ng; lanes 5 and 9, 10 ng; and lanes 6 and 10, 20 ng. No competitor
was added to the reaction shown in lane 2; no protein was added to the
reaction shown in lane 1. (C) Amounts of the bound 64-mers estimated by
optical densitometry of an autoradiograph of the gel in panel A. The
amount of the bound 64-mers in the absence of competitor (lane 2 in
panel A) was taken as 100%. (B and D) Comparison of DBP binding to the
single-stranded 51-mer and to the 51-mer duplex. (B) Reaction mixtures
contained 0.006 pmol of 51-mer(a) (lanes 1 to 5) or 0.006 pmol of
51-mer duplex obtained by annealing of 51-mer(a) to complementary
51-mer(b) (lanes 6 to 10) and the following amounts of DBP: lanes 2 and
7, 9.5 ng; lanes 3 and 8, 19 ng; lanes 4 and 9, 38 ng; and lanes 5 and
10, 57 ng. No protein was added to the reactions shown in lanes 1 and
6. (D) Amounts of the unbound 51-mers estimated by optical densitometry
of an autoradiograph of the gel in panel B.
|
|
In similar experiments, we studied binding of BmNPV LEF-3 to
5'-end-labeled oligonucleotides. In agreement with data published
previously for Ac
MNPV LEF-3 (
14), BmNPV LEF-3
showed specific
binding to ssDNA (data not shown).
Protection by DBP against exonucleolytic digestion of
oligonucleotides.
Tightly bound proteins are capable of
dramatically changing the capacity of DNA molecules to participate in
biological reactions. One of the known effects of SSB proteins is to
protect against exonucleolytic digestion of the bound polynucleotide.
The size of the DNA fragment protected by the protein monomer provides an estimate of the binding site size for the protein (26).
In our study of the biochemical properties of BmNPV DBP, we analyzed the effect of this protein on exonucleolytic digestion of
oligonucleotides. Phage T4 DNA polymerase, possessing a potent 3'
5'
exonucleolytic activity specific for ssDNA, was used as the source of
exonuclease. To eliminate the effects of oligonucleotide sequence
content on the digestion reaction, we used a set of
oligo(dT)n with n varying from 12 to
~100 nt for the DNA substrate. The experimental design was similar to
that described previously (26). In the absence of DBP, phage
T4 DNA polymerase efficiently digested
oligo(dT)n fragments from 3' ends (Fig.
5A,
lanes 2 to 6). No fragments longer than 17 nt persisted in the reaction
after a 5-min incubation. In the second reaction,
oligo(dT)n was preincubated before the addition
of phage T4 DNA polymerase with the preparation of DBP collected after
chromatography on ssDNA cellulose and contained monomers and higher
oligomers. The retardation pattern for complexes of the 64-mers with
the DBP sample used in this experiment is shown in Fig. 3A. Saturation
of oligo(dT)n with DBP markedly decreased the
digestion rate and revealed two sets of oligonucleotides most
efficiently protected. One set of protected fragments was about 66 nt
in length. It was visible for about 60 min and disappeared later.
Another set of protected fragments was about 30 nt. Although the amount
of protected fragments progressively decreased in the course of
reaction, the protection pattern was still visible after 80 min. During
the last 60 min of the reaction (Fig. 5A, lanes 11 to 15), the mean
size of the protected fragments in this set was reduced by only 6 nt,
from 33 to 27 nt (Fig. 5B). The data obtained suggests that monomers of
DBP are capable of protecting about 30 nt of DNA. This suggests that
the binding site size for the DBP monomer is about 30 nt.

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 5.
DBP protects bound DNA against exonucleolytic
hydrolysis. (A) Time course of digestion of dT12-100 with
3' 5' exonuclease associated with phage T4 DNA polymerase. Two
reaction mixtures contained 6 pmol (total nucleotides) of
5'-32P-labeled dT12-100 in a final volume of
50 µl of 10 mM Tris-HCl (pH 7.5)-5 mM MgCl2-0.15 M
NaCl-2 mM DTT-100 µg of bovine serum albumin per ml. After
incubation for 15 min at 23°C in the absence of DBP (reaction I) or
in the presence of 180 ng of DBP (reaction II), 5-µl portions were
removed to serve as starting points (lanes 2 and 7, respectively), and
then the reaction mixtures were transferred to 30°C and 1 µl (0.8 U) of phage T4 DNA polymerase was added. At the indicated times of
incubation, 5-µl portions from the reaction mixtures were transferred
onto ice and mixed with 3.5 µl of loading buffer. Portions (4 µl) from each sample were subjected to
electrophoresis in a 10% polyacrylamide-8 M urea gel. Migration of
the standards, 5'-32P-labeled 51-mer(b) and 64-mer
oligonucleotides, is shown in lanes 1 and 16. DBP was collected after
chromatography on ssDNA cellulose. (B) Changes in the average sizes of
dTn oligonucleotides in two groups of fragments
protected by DBP in the course of digestion with 3' 5' exonuclease
associated with phage T4 DNA polymerase. Values calculated for the gel
shown in panel A were used for generation of curves 1 and 2.
|
|
Destabilization effect of DBP on duplex DNA.
The SSB proteins
belong to the group of proteins known as helix-destabilizing proteins.
SSB proteins are capable of unwinding DNA duplexes in an
ATP-independent manner in in vitro systems (4, 8, 11, 15, 29, 34,
36, 39). To elucidate a possible role for DBP in viral DNA
replication, we assayed a destabilization effect of DBP in reaction
mixtures containing a partial duplex DNA as the substrate. The first
substrate was prepared by annealing a 17-mer oligonucleotide, labeled
at 5' end with 32P, to the unlabeled 51-mer(b)
oligonucleotide (see Materials and Methods). In this *17:51-mer, the
34-nt single-stranded region provided a site for binding of proteins.
LEF-3, another viral protein specifically binding ssDNA, was used in
parallel experiments. Because the melting effect of SSB proteins is
extremely sensitive to monovalent salts and MgCl2
(11), the binding reactions were performed in the absence of
NaCl. The proteins, DBP and LEF-3, efficiently bound both the free
17-mer oligonucleotide and the 17:51-mer partial duplex, as revealed in
the mobility shift assay (Fig. 6A). The
electrophoretic mobility of the complexes with free 17-mer did not
differ significantly from the mobility of the complexes with 17:51-mer,
because both proteins bind DNA as high-molecular-mass oligomers (see
above and reference 10). To determine whether the
17-mer was still bound by hydrogen bonds to the 51-mer after binding of
the protein to the 17:51-mer, the proteins were inactivated prior to
the electrophoresis by treatment with 1% SDS and 0.5 mg of proteinase
K per ml (Fig. 6B). Saturation of the 17:51-mer with LEF-3 did not
cause detachment of the 17-mer from the complementary 51-mer (Fig. 6B,
lanes 5 to 7). The amount of LEF-3 added to the reaction shown in lanes
5 was enough to saturate most 17:51-mers; however, even a fourfold
increase in the LEF-3 concentration did not produce any melting (lanes
7). In contrast, binding of DBP to 17:51-mers resulted in detachment of
17-mers (Fig. 6B, lanes 8 to 10). To test for the ability of DBP to
melt more stable duplexes, the unwinding reactions were performed with
the *36:51-mer and *51:64-mer partial duplexes (Fig.
7). In the *36:51-mer, the
single-stranded region for DBP binding was 15 nt in length, and it was
adjacent to the 5' end of the 36-mer. In the *51:64-mer, the
single-stranded region was only 13 nt in length, and it was adjacent to
the 3' end of the 51-mer. DBP caused unwinding of both partial duplexes
in a dose-dependent manner (Fig. 7A and B). The unwound products were
accumulated at a low rate in the reaction carried out at 23°C (Fig.
7C). Therefore, DBP could unwind partial DNA duplexes with either 3' or
5' single-stranded tails. This suggests that the helix-destabilizing
effect of DBP is nonpolar with respect to the orientation of the
single-stranded tail.

View larger version (38K):
[in this window]
[in a new window]
|
FIG. 6.
DBP destabilizes duplex DNA. Reaction mixtures (10 µl)
containing free 5'-32P-labeled 17-mer oligonucleotide or
this oligonucleotide annealed to a 51-mer(b) oligonucleotide and other
components (see Materials and Methods) were incubated with LEF-3 or DBP
for 15 min at 23°C. Lanes 1 to 3 contained 0.005 pmol of 17-mer mixed
with 0.006 pmol of noncomplementary 51-mer(a); lanes 4 to 10 contained
0.005 pmol of 17-mer annealed to 0.006 pmol of complementary 51-mer(b).
No protein was added to the reactions shown in lanes 1 and 4. Other
lanes contained LEF-3 at 8 ng (lane 5), 20 ng (lane 6), and 34 ng
(lanes 2, 7) and DBP at 14 ng (lane 8), 34 ng (lane 9), and 57 ng
(lanes 3, 10). LEF-3 and DBP were collected after chromatography on
DEAE-Toyopearl. Portions (5 µl) of reaction mixtures were analyzed by
electrophoresis in 6% polyacrylamide gels without additional treatment
(A) or after incubation with 1% SDS and 0.5 mg of proteinase K per ml
for 20 min at 23°C (B). The sequence of the *17:51-mer is shown at
the bottom. The asterisk indicated the radioactive label.
|
|

View larger version (30K):
[in this window]
[in a new window]
|
FIG. 7.
DBP unwinds the 36:51-mer and 51:64-mer partial
duplexes. (A and B) Dose dependence of the unwinding reaction. Reaction
mixtures (10 µl) containing 0.005 pmol of 32P-labeled
*36:51-mer (A) or *51:64-mer (B) and other components of the unwinding
assay (see Materials and Methods) were incubated with DBP for 30 min at
23°C. No protein was added to the reactions shown in lanes 1. Other
reaction mixtures contained the following amounts of DBP collected
after chromatography on DEAE-Toyopearl: lanes 2, 2.9 ng, lanes 3, 7.6 ng, and lanes 4, 19 ng. After treatment with 1% SDS and 0.5 mg of
proteinase K per ml for 20 min at 23°C, 5-µl portions of reaction
mixtures were analyzed by electrophoresis in a 6% polyacrylamide gel.
(C) Time course of unwinding of the 51:64-mer partial duplex. A 49-µl
reaction mixture containing 0.035 pmol of 32P-labeled
*51:64-mer and other components of the unwinding assay was assembled. A
7-µl portion was removed to serve as a starting point (lane 1), and
then 18 µl of DBP (114 ng) collected after chromatography on
DEAE-Toyopearl was added and the reaction mixture was incubated at
23°C. At the indicated times, 10-µl portions from the reaction
mixture were removed and treated with 1% SDS and 0.5 mg of proteinase
K per ml for 20 min at 23°C. Portions (5 µl) from the samples were
analyzed by electrophoresis in a 6% polyacrylamide gel. The sequences
of the *36:51-mer and *51:64-mer are shown at the bottom. The asterisk
indicated the radioactive label.
|
|
 |
DISCUSSION |
We have described a method for the purification of two
viral DNA-binding proteins, DBP and LEF-3, from nuclear extracts of BmNPV-infected BmN cells. Purification of AcMNPV LEF-3 was
carried out earlier in two laboratories (10, 14). Some
modifications were employed in this study. The treatment of the
isolated protein with DNase I and the concentration of diluted samples
at steps in the purification protocol were not used. At a final stage, we performed chromatography on an anion-exchange resin. Use of the DEAE
column permitted us to obtain both proteins in a homogeneous state, as
well as to remove possible traces of DNA and to concentrate the
samples. The preparation of DBP collected after fractionation of
high-salt extracts on ssDNA cellulose contained monomers and higher-order oligomers, whereas after subsequent chromatography on
DEAE-Toyopearl, the protein was present only as multimers. The capacity
to form multimers in the absence of DNA is not a unique feature among
DNA-binding proteins. ICP8, the SSB protein of herpes simplex virus
type 1, forms long filaments in solution (30). Phage T4 gene
32 protein forms oligomers due to self-association of monomers
(5). The adenovirus DNA-binding protein, DBP, has a
C-terminal extension that interacts with another monomer, resulting in
the formation of long protein chains (8). Basic and aromatic amino acids of DNA-binding proteins are thought to participate in
interaction with DNA substrates. BmNPV DBP contains a motif, K18-R21-Y33-F41-Y53-R64-W71-K80,
which presents a perfect match to the consensus sequence,
K/RX2-5K/RX4-12F/YX2-14F/YX6-13F/YX1-19K/RX3-26F/Y/WX6-11R/K, found in all SSB proteins from prokaryotic and eukaryotic organisms (38). An additional motif in DBP,
K159-K162-F168-Y173-F183-R189-F195-H206, has a single conservative change (R/K
H) at residue 206. The protein does not contain other known motifs such as zinc fingers
(C/HX2-5C/HX11-13C/HX2,5C/H), leucine zippers ([LX6] 3L), and nucleoside
triphosphate-binding domains (GXXGXGX15-20K; GXGK[S/T]
[S/T]).
Isolation of a novel baculovirus DNA-binding protein, BmNPV DBP, poses
intriguing question about the possible function of this protein in
virus replication. Its preferential binding to ssDNA (Fig. 4), its
protection of bound DNA against exonucleases (Fig. 5), and its
helix-destabilizing ability (Fig. 6 and 7) are consistent with an SSB
function. These properties might be required for initiation and
elongation stages in viral DNA replication. Upon initiation in diverse
replication systems, SSB proteins accelerate local melting of DNA in an
ori region provided by specific ori-binding factors. During elongation, SSB proteins stabilize parental ssDNA chains, thus facilitating the action of DNA helicases, DNA polymerases, and other replication factors. An SSB function was proposed earlier for
another viral protein, AcMNPV LEF-3, based on its
preferential binding to ssDNA and its abundance in infected cells
(14) and its requirement for transient DNA replication
(16, 22). The amino acid sequence of AcMNPV LEF-3
has 91.7% identity in a 385-amino-acid overlap to that of BmNPV LEF-3,
and both proteins are likely to play the same role in viral DNA
replication (12). BmNPV LEF-3 was, in fact, one of the
abundant viral proteins in infected BmN cells (Fig. 1) and showed
specific binding to ssDNA (data not shown). However, another abundant
viral protein, DBP, which also has binding specificity for ssDNA is
capable of destabilizing duplex DNA. The binding of SSB proteins favors
the production of single-stranded regions resulting from DNA breathing
in dsDNA regions. This destabilizes the duplex structure and reduces
the temperature required for its melting. For this reason, SSB proteins have also been called helix-destabilizing proteins (6, 25). Although the thermal stability of the short 17-bp duplex in the 17:51-mer is rather low, BmNPV LEF-3 did not cause melting of this
duplex upon oversaturation (Fig. 6, lanes 5 to 7). The inability to
unwind partial DNA duplexes in an in vitro system does not conform to
the SSB function of LEF-3, although it does not eliminate the
possibility of this function completely. Because this protein is
required for the transient replication of plasmids containing putative
viral ori regions in transfection assays (1, 16, 22), other essential roles for LEF-3 might be considered. The copurification of LEF-3 with viral DNA helicase (product of the dnahel gene) observed by other groups (10, 19)
corresponds to a role as a possible accessory factor for viral DNA
helicase. In contrast to the case for LEF-3, DBP was not detected among viral factors essential for plasmid replication in the transfection assay (1, 16, 22). Moreover, in contrast to most replication factors, DBP was not listed among 18 late gene expression factors (LEFs) identified earlier (22). A host cell nuclear SSB
protein, RP-A, might substitute for DBP in the transfection assay, and this protein and/or other factors may permit the initiation of viral
DNA replication and may overcome the block to expression of the late
viral genes. To clarify the role of DBP, we attempted to isolate BmNPV
mutants with a deletion in the dbp gene by using homologous
recombination after cotransfection of wild-type BmNPV DNA with a
plasmid carrying a deletion in the dbp locus into BmN cells.
Our attempts to isolate a BmNPV mutant lacking the dbp gene
were unsuccessful, suggesting that dbp is essential for
virus replication (data not shown). Further experiments are required for elucidation of the DBP function in the baculovirus infection cycle.
 |
ACKNOWLEDGMENTS |
We thank George F. Rohrmann for critical reading of the
manuscript and helpful discussion, Jay Evans and George F. Rohrmann for
donation of antiserum against AcMNPV LEF-3, Shogo Matsumoto for advice in protein sequencing, and Evgeny Zemskov for help in
immunological experiments.
This work was supported, in part, by a Japan Society for Promotion of
Science fellowship to V.S.M. and by grants from the CREST (Core
Research for Evolutional Science and Technology) and COE (Center of
Excellence) programs of the Science and Technology Agency and the
Institute of Physical and Chemical Research (RIKEN) to S.M.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Molecular Entomology and Baculovirology, The Institute of Physical and Chemical Research (RIKEN), Waco, Japan. Phone: 81 (48) 467-9584. Fax:
81 (48) 462-4678: E-mail: vsmikha{at}postman.riken.go.jp.
 |
REFERENCES |
| 1.
|
Ahrens, C. H., and G. F. Rohrmann.
1995.
Replication of Orgyia pseudotsugata baculovirus DNA: lef-2 and ie-1 are essential and ie-2, p34, and Op-iap are stimulatory genes.
Virology
212:650-662[Medline].
|
| 2.
|
Ahrens, C. H.,
R. L. Russell,
C. J. Funk,
J. T. Evans,
S. H. Harwood, and G. F. Rohrmann.
1997.
The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome.
Virology
229:381-399[Medline].
|
| 3.
|
Ayres, M. D.,
S. C. Howard,
J. Kuzio,
M. Lopez-Ferber, and R. D. Possee.
1994.
The complete DNA sequence of Autographa californica nuclear polyhedrosis virus.
Virology
202:586-605[Medline].
|
| 4.
|
Boehmer, P. E., and I. R. Lehman.
1993.
Herpes simplex virus type 1 ICP8: helix-destabilizing properties.
J. Virol.
67:711-715[Abstract/Free Full Text].
|
| 5.
|
Carroll, R. B.,
K. Neet, and D. A. Goldthwait.
1975.
Studies of the self-association of bacteriophage T4 gene 32 protein by equilibrium sedimentation.
J. Mol. Biol.
91:275-291[Medline].
|
| 6.
|
Chase, J. W., and K. R. Williams.
1986.
Single-stranded DNA-binding proteins required for DNA replication.
Annu. Rev. Biochem.
55:103-136[Medline].
|
| 7.
|
Choi, J., and L. A. Guarino.
1995.
The baculovirus transactivator IE1 binds to viral enhancer elements in the absence of insect cell factors.
J. Virol.
69:4548-4551[Abstract].
|
| 8.
|
Dekker, J.,
P. N. Kanellopoulos,
A. K. Loonstra,
J. A. W. M. v. Oosterhout,
K. Leonard,
P. A. Tucker, and P. C. v. d. Vliet.
1997.
Multimerization of the adenovirus DNA-binding protein is the driving force for ATP-independent DNA unwinding during strand displacement synthesis.
EMBO J.
16:1455-1463[Medline].
|
| 9.
|
Evans, J. T.,
D. J. Leisy, and G. F. Rohrmann.
1997.
Characterization of the interaction between the baculovirus replication factors LEF-1 and LEF-2.
J. Virol.
71:3114-3119[Abstract].
|
| 10.
|
Evans, J. T., and G. F. Rohrmann.
1997.
The baculovirus single-stranded DNA binding protein, LEF-3, forms a homotrimer in solution.
J. Virol.
71:3574-3579[Abstract].
|
| 11.
|
Georgaki, A.,
B. Strack,
V. Podust, and U. Hubscher.
1992.
DNA unwinding activity of replication protein A.
FEBS Lett.
308:240-244[Medline].
|
| 12.
|
Gomi, S.,
C. E. Zhou,
W. Yih,
K. Majima, and S. Maeda.
1997.
Deletion analysis of four of eighteen late gene expression factor gene homologues of the baculovirus, BmNPV.
Virology
230:35-47[Medline].
|
| 13.
|
Guarino, L. A., and W. Dong.
1991.
Expression of an enhancer-binding protein in insect cells transfected with the Autographa californica nuclear polyhedrosis virus IE1 gene.
J. Virol.
65:3676-3680[Abstract/Free Full Text].
|
| 14.
|
Hang, X.,
W. Dong, and L. A. Guarino.
1995.
The lef-3 gene of Autographa californica nuclear polyhedrosis virus encodes a single-stranded DNA-binding protein.
J. Virol.
69:3924-3928[Abstract].
|
| 15.
|
Hosoda, J.,
B. Takacs, and C. Brack.
1974.
Denaturation of T4 DNA by an in vitro processed gene 32 protein.
FEBS Lett.
47:338-342[Medline].
|
| 16.
|
Kool, M.,
C. H. Ahrens,
R. W. Goldbach,
G. F. Rohrmann, and J. M. Vlak.
1994.
Identification of genes involved in DNA replication of the Autographa californica baculovirus.
Proc. Natl. Acad. Sci. USA
91:11212-11216[Abstract/Free Full Text].
|
| 17.
|
Kovacs, G. R.,
J. Choi,
L. A. Guarino, and M. D. Summers.
1992.
Functional dissection of the Autographa californica nuclear polyhedrosis virus immediate-early 1 transcriptional regulatory protein.
J. Virol.
66:7429-7437[Abstract/Free Full Text].
|
| 18.
|
Laemmli, U. K.
1970.
Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
Nature (London)
227:680-685[Medline].
|
| 19.
|
Laufs, S.,
A. Lu,
K. Arrell, and E. B. Carstens.
1997.
Autographa californica nuclear polyhedrosis virus p143 gene product is a DNA-binding protein.
Virology
228:98-106[Medline].
|
| 20.
|
Lu, A., and E. B. Carstens.
1991.
Nucleotide sequence of a gene essential for viral DNA replication in the baculovirus Autographa californica nuclear polyhedrosis virus.
Virology
181:336-347[Medline].
|
| 21.
|
Lu, A., and L. K. Miller.
1995.
Differential requirements for baculovirus late expression factor genes in two cell lines.
J. Virol.
69:6265-6272[Abstract].
|
| 22.
|
Lu, A., and L. K. Miller.
1995.
The roles of eighteen baculovirus late expression factor genes in transcription and DNA replication.
J. Virol.
69:975-982[Abstract].
|
| 23.
|
Maeda, S.
1989.
Gene transfer vectors of a baculovirus, Bombyx mori, and their use for expression of foreign genes in insect cells, p. 167-181. In
J. Mitsuhashi (ed.), Invertebrate cell system applications, vol. I.
CRC Press, Inc., Boca Raton, Fla.
|
| 24.
|
Maeda, S.,
T. Kawai,
M. Obinata,
H. Fujiwara,
T. Horiuchi,
Y. Saeki,
Y. Sato, and M. Furusawa.
1985.
Production of human alpha-interferon in silkworm using a baculovirus vector.
Nature (London)
315:592-594[Medline].
|
| 25.
|
Meyer, R. R., and P. S. Laine.
1990.
The single-stranded DNA-binding protein of Escherichia coli.
Microbiol. Rev.
54:342-380[Abstract/Free Full Text].
|
| 26.
|
Mikhailov, V. S., and D. F. Bogenhagen.
1996.
Effects of Xenopus laevis mitochondrial single-stranded DNA-binding protein on primer-template binding and 3' 5' exonuclease activity of DNA polymerase .
J. Biol. Chem.
271:18939-18946[Abstract/Free Full Text].
|
| 27.
|
Mikhailov, V. S.,
K. A. Marlyev,
J. O. Ataeva,
P. K. Kullyev, and A. M. Atrazhev.
1986.
Characterization of 3' 5' exonuclease associated with DNA polymerase of silkworm nuclear polyhedrosis virus.
Nucleic Acids Res.
14:3841-3857[Abstract/Free Full Text].
|
| 28.
|
Miller, L. K.,
J. E. Jewell, and D. Browne.
1981.
Baculovirus induction of a DNA polymerase.
J. Virol.
40:305-308[Abstract/Free Full Text].
|
| 29.
|
Monaghan, A.,
A. Webster, and T. Hay.
1994.
Adenovirus DNA binding protein: helix destabilizing properties.
Nucleic Acids Res.
22:742-748[Abstract/Free Full Text].
|
| 30.
|
O'Donnell, M. E.,
P. Elias,
B. E. Funell, and I. R. Lehman.
1987.
Interaction between the DNA polymerase and single-stranded DNA-binding protein (infected cell protein 8) of herpes simplex virus 1.
J. Biol. Chem.
262:4260-4266[Abstract/Free Full Text].
|
| 31.
|
Pearson, M.,
R. Bjornson,
G. Pearson, and G. Rohrmann.
1992.
The Autographa californica baculovirus genome: evidence for multiple replication origins.
Science
257:1382-1384[Abstract/Free Full Text].
|
| 32.
|
Pearson, M. N.,
R. M. Bjornson,
C. Ahrens, and G. F. Rohrmann.
1993.
Identification and characterization of a putative origin of DNA replication in the genome of a baculovirus pathogenic for Orgyia pseudotsugata.
Virology
197:715-725[Medline].
|
| 33.
|
Rodems, S. M., and P. D. Friesen.
1995.
Transcriptional enhancer activity of hr5 requires dual-palindrome half sites that mediate binding of a dimeric form of the baculovirus transregulator IE1.
J. Virol.
69:5368-5375[Abstract].
|
| 34.
|
Soengas, M. S.,
C. Gutierrez, and M. Salas.
1995.
Helix-destabilizing activity of phi29 single-stranded DNA binding protein: effect on the elongation rate during strand displacement DNA replication.
J. Mol. Biol.
253:517-529[Medline].
|
| 35.
|
Tomalski, M. D.,
J. G. Wu, and L. K. Miller.
1988.
The location, sequence, transcription, and regulation of a baculovirus DNA polymerase gene.
Virology
167:591-600[Medline].
|
| 36.
|
Treuner, K.,
U. Ramsperger, and R. Knippers.
1996.
Replication protein A induces the unwinding of long double-stranded DNA regions.
J. Mol. Biol.
259:104-112[Medline].
|
| 37.
|
Wang, X., and D. C. Kelly.
1983.
Baculovirus replication: purification and identification of the Trichoplusia ni nuclear polyhedrosis virus-induced DNA polymerase.
J. Gen. Virol.
64:2229-2236.
|
| 38.
|
Wang, Y., and J. D. Hall.
1990.
Characterization of a major DNA-binding domain in the herpes simplex virus type 1 DNA-binding protein (ICP8).
J. Virol.
64:2082-2089[Abstract/Free Full Text].
|
| 39.
|
Zijderveld, D. C., and P. C. van der Vliet.
1994.
Helix-destabilizing properties of the adenovirus DNA-binding protein.
J. Virol.
68:1158-1164[Abstract/Free Full Text].
|
J Virol, April 1998, p. 3107-3116, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chen, Y.-R., Wu, C.-Y., Lee, S.-T., Wu, Y.-J., Lo, C.-F., Tsai, M.-F., Wang, C.-H.
(2008). Genomic and host range studies of Maruca vitrata nucleopolyhedrovirus. J. Gen. Virol.
89: 2315-2330
[Abstract]
[Full Text]
-
Quadt, I., van Lent, J. W. M., Knebel-Morsdorf, D.
(2007). Studies of the Silencing of Baculovirus DNA Binding Protein. J. Virol.
81: 6122-6127
[Abstract]
[Full Text]
-
Oliveira, J. V. d. C., Wolff, J. L. C., Garcia-Maruniak, A., Ribeiro, B. M., de Castro, M. E. B., de Souza, M. L., Moscardi, F., Maruniak, J. E., Zanotto, P. M. d. A.
(2006). Genome of the most widely used viral biopesticide: Anticarsia gemmatalis multiple nucleopolyhedrovirus.. J. Gen. Virol.
87: 3233-3250
[Abstract]
[Full Text]
-
Chen, Z., Carstens, E. B.
(2005). Identification of Domains in Autographa californica Multiple Nucleopolyhedrovirus Late Expression Factor 3 Required for Nuclear Transport of P143. J. Virol.
79: 10915-10922
[Abstract]
[Full Text]
-
Mikhailov, V. S., Okano, K., Rohrmann, G. F.
(2005). The Redox State of the Baculovirus Single-stranded DNA-binding Protein LEF-3 Regulates Its DNA Binding, Unwinding, and Annealing Activities. J. Biol. Chem.
280: 29444-29453
[Abstract]
[Full Text]
-
de Jong, J. G., Lauzon, H. A. M., Dominy, C., Poloumienko, A., Carstens, E. B., Arif, B. M., Krell, P. J.
(2005). Analysis of the Choristoneura fumiferana nucleopolyhedrovirus genome. J. Gen. Virol.
86: 929-943
[Abstract]
[Full Text]
-
Garcia-Maruniak, A., Maruniak, J. E., Zanotto, P. M. A., Doumbouya, A. E., Liu, J.-C., Merritt, T. M., Lanoie, J. S.
(2004). Sequence Analysis of the Genome of the Neodiprion sertifer Nucleopolyhedrovirus. J. Virol.
78: 7036-7051
[Abstract]
[Full Text]
-
Mainz, D., Quadt, I., Knebel-Morsdorf, D.
(2002). Nuclear IE2 Structures Are Related to Viral DNA Replication Sites during Baculovirus Infection. J. Virol.
76: 5198-5207
[Abstract]
[Full Text]
-
Chen, X., IJkel, W. F. J., Tarchini, R., Sun, X., Sandbrink, H., Wang, H., Peters, S., Zuidema, D., Lankhorst, R. K., Vlak, J. M., Hu, Z.
(2001). The sequence of the Helicoverpa armigera single nucleocapsid nucleopolyhedrovirus genome. J. Gen. Virol.
82: 241-257
[Abstract]
[Full Text]
-
Zemskov, E. A., Kang, W., Maeda, S.
(2000). Evidence for Nucleic Acid Binding Ability and Nucleosome Association of Bombyx mori Nucleopolyhedrovirus BRO Proteins. J. Virol.
74: 6784-6789
[Abstract]
[Full Text]
-
IJkel, W. F. J., van Strien, E. A., Heldens, J. G. M., Broer, R., Zuidema, D., Goldbach, R. W., Vlak, J. M.
(1999). Sequence and organization of the Spodoptera exigua multicapsid nucleopolyhedrovirus genome. J. Gen. Virol.
80: 3289-3304
[Abstract]
[Full Text]
-
Hang, X., Guarino, L. A.
(1999). Purification of Autographa californica nucleopolyhedrovirus DNA polymerase from infected insect cells. J. Gen. Virol.
80: 2519-2526
[Abstract]
[Full Text]
-
Gomi, S, Majima, K, Maeda, S
(1999). Sequence analysis of the genome of Bombyx mori nucleopolyhedrovirus. J. Gen. Virol.
80: 1323-1337
[Abstract]
-
Okano, K., Mikhailov, V. S., Maeda, S.
(1999). Colocalization of Baculovirus IE-1 and Two DNA-Binding Proteins, DBP and LEF-3, to Viral Replication Factories. J. Virol.
73: 110-119
[Abstract]
[Full Text]