Previous Article | Next Article 
J Virol, April 1998, p. 3082-3087, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Type C Retrovirus Released from Porcine Primary
Peripheral Blood Mononuclear Cells Infects Human Cells
Carolyn A.
Wilson,1,*
Susan
Wong,1
Jacqueline
Muller,2
Cynthia E.
Davidson,3
Timothy M.
Rose,3 and
Parris
Burd1
Division of Cellular and Gene
Therapies1 and
Division of Viral
Products,2 Center for Biologics Evaluation
and Research, Food and Drug Administration, Bethesda, Maryland, and
Department of Pathobiology, School of Public Health and
Community Medicine, University of Washington, Seattle,
Washington3
Received 16 October 1997/Accepted 22 December 1997
 |
ABSTRACT |
As part of the evaluation of porcine cells, tissues, and organs
intended for transplantation into humans, we investigated the
conditions required to induce expression and release of porcine endogenous retrovirus (PoEV) from primary cells. Pigs contain endogenous retroviral sequences encoding infectious retrovirus, yet
little is known about the conditions required to activate the
expression and release of PoEV from primary cells. We show here that
mitogenic activation of peripheral blood mononuclear cells (PBMC)
isolated from the National Institutes of Health (NIH) miniature pig and
the Yucatan pig resulted in the activation and release of an infectious
type C retrovirus. Coculture of activated porcine PBMC with pig or
human cell lines resulted in the transfer and expression of
PoEV-specific sequences and the establishment of a productive
infection. Sequence comparison of portions of the PoEV pol
gene expressed in pig cell lines productively infected with virus
derived from NIH miniature pig and Yucatan pig PBMC revealed marked
similarity, suggesting that one or a few loci may be capable of being
activated to yield an infectious virus. These findings demonstrate that
the presence of endogenous viruses in source animals needs to be
carefully considered when the infectious disease potential of
xenotransplantation is being assessed.
 |
INTRODUCTION |
Recent progress in the field of
immunosuppression and the shortage of human organs have led to renewed
interest in the xenotransplantation of cells, tissues, and organs into
humans for the purpose of providing permanent therapeutic benefit or as
a bridging strategy until an appropriate human donor can be found.
However, the source animals for xenotransplants are likely to carry
infectious agents which may not be readily apparent or known to be
pathogenic in the host species but which may be capable of infecting
and progressing to disease in the recipient species. Of particular
concern are endogenous infectious agents which may be latent and
therefore not easily detected in the source animal. Extensive
immunosuppression of the host, required to prevent xenograft rejection,
may facilitate the spread of these agents, which would be eliminated in
an immunocompetent individual.
Porcine xenografts are under evaluation for a variety of
life-threatening and chronic diseases. Pig genomes contain endogenous retroviral sequences encoding infectious type C retroviral particles (2, 11, 15). Established porcine cell lines spontaneously release type C retroviral particles (1, 22, 26), although viral particles have not been observed in primary cultures of porcine
cells (1). Initial reports suggested that the host range of
porcine endogenous retrovirus was restricted to cells of porcine origin
(11, 24), but recently, a type C retrovirus associated with
the porcine kidney cell line PK-15, termed PERV-PK, was reported to
infect human, mink, and porcine cell lines (15). Southern
blot analysis suggested there may be up to 50 copies of this sequence
in the pig genome (15). It is not known whether all of these
loci encode infectious proviral sequences, and the conditions required
for the activation and expression of infectious retrovirus from pig
cells have not been determined. We therefore examined the conditions
required for induction of infectious endogenous retrovirus from primary
porcine cells. Our experiments were based on the observation that
endogenous murine retroviruses can be activated during immune
activation by a graft-versus-host reaction in vivo or by mixed
lymphocyte reaction in vitro (5, 6, 9, 21). We find that
mitogenic activation of porcine peripheral blood mononuclear cells
(PBMC) results in the activation and release of an infectious
retrovirus capable of infecting human cells.
 |
MATERIALS AND METHODS |
Isolation and activation of PBMC.
Acid-citrate
dextrose-treated blood (450 ml) was obtained from National Institutes
of Health (NIH) miniature pigs or Yucatan pigs maintained by the NIH
animal facility at Poolesville, Md. PBMC were isolated by
centrifugation over lymphocyte separation medium (Organon Teknika,
Durham, N.C.). After three washes in phosphate-buffered saline (PBS),
the PBMC were counted and cryopreserved in 90% fetal bovine serum and
10% dimethyl sulfoxide at 107 cells/ml. Thawed PBMC were
mitogenically stimulated in the following medium: Dulbecco's modified
Eagle's medium supplemented with 10% fetal bovine serum, 2 µg of
phytohemagglutinin (PHA) per ml, 10 ng of phorbol
12-myristate-13-acetate per ml, nonessential amino acids, 5 mM
-mercaptoethanol, 10 mM HEPES, 2 mM glutamine, 1 mM sodium pyruvate,
100 U of penicillin per ml, and 100 µg of streptomycin per ml. Where
indicated, 0.2 µM A23187 (a calcium ionophore) was substituted for
PHA in the medium.
Cell lines.
The following cell lines used in these studies
were obtained from the American Type Culture Collection (ATCC) or as
indicated: fetal swine testis ST-IOWA (passage 85 cells kindly provided
by Richard Fister, Tufts University, or passage 117 cells from ATCC CRL-1746), 293 human embryonic kidney (ATCC CRL-1573), HeLa (ATCC CRL-2), mink lung fibroblast (ATCC CCL-64), bat lung fibroblast (ATCC
CCL-88), rat2 fibroblast (ATCC CRL-1746), Mus dunni tail fibroblast (obtained from Olivier Danos), E36 Chinese hamster lung
(obtained from Christine Kozak), and African green monkey kidney COS-7
(ATCC CRL-1650) cells. All cell lines were maintained in standard
medium, i.e., Dulbecco's modified Eagle's medium supplemented with
5% fetal bovine serum-2 mM glutamine-1 mM sodium pyruvate-100 U of
penicillin per ml-100 µg of streptomycin per ml.
Infectivity assays.
Coculture assay for viral infectivity
was performed as follows: 106 live or lethally irradiated
(2,000 rads from a 137Cs source, Nordion GammaCell 100)
virus producer cells were mixed with 5 × 105 target
cells and plated in standard medium in 25-cm2 flasks. The
following day, the cells were washed twice with PBS. Cultures were
maintained by subpassaging 1 to 2 times/week as needed. As cultures
reached confluence, culture medium was removed for reverse
transcriptase assay, and in some cases,
106 cells were
removed for RNA isolation and reverse transcription (RT)-PCR.
Reverse transcriptase assays.
Medium from cultured cells was
precleared by centrifugation at 10,000 × g for 5 min.
The supernatant was then assessed for reverse transcriptase activity as
described previously (27), with modifications based on the
method of Phan-Thanh et al. (16). The solubilized samples
were incubated for 3 h at 37°C with 2× substrate buffer
containing 50 mM Tris (pH 7.5), 10 mM dithiothreitol, 0.6 mM
MnCl2, 10 µg of poly(rA) · poly(dT)12-18 (Pharmacia, Piscataway, N.J.) per ml, and 10 µCi of 3H[TTP] per 25 µl (22 Ci/mmol). All samples
were assayed in triplicate.
Electron microscopy.
Cells were prepared for electron
microscopy as follows. Cells were removed from flasks with
trypsin-EDTA, washed in PBS, and fixed in 2% paraformaldehyde-2%
glutaraldehyde in 0.10 M cacodylate buffer (pH 7.2 to 7.4) for 2 to
3 h at room temperature. Fixed cells were stored in PBS at 4°C
until further processing. Samples were subsequently treated for 1 h with 2% osmium tetroxide, dehydrated with graded alcohols, and
embedded in epoxy resin. Thin sections were stained with uranyl acetate
and lead citrate and examined with a Zeiss EM 912 electron microscope.
Isolation and sequencing of PoEV cDNA.
A portion of the
porcine endogenous retrovirus (PoEV) reverse transcriptase coding
region was isolated from cDNA made from infected cells with degenerate
oligonucleotide primers (Table 1), based on highly conserved regions
among reverse transcriptase genes.
Cellular RNA was isolated following guanidinium thiocyanate lysis and
CsCl centrifugation. cDNA was prepared with avian myeloblastosis virus
reverse transcriptase (10 U; Promega Corp.) in 1× avian myeloblastosis
virus buffer containing 1 mM deoxynucleoside triphosphate, 30 U of
RNasin, and 10 pmol of degenerate oligonucleotide YMDDB in a total
volume of 30 µl. The samples were incubated for 1 h at 42°C
under mineral oil. The cDNA templates (3 µl) were amplified with one
of the degenerate oligonucleotide primer pools (50 pmol), PQGWA, PQGMA,
or PQGFA, with the degenerate primer pool YMDDB (50 pmol).
Hot-start amplifications were performed in 50 µl of 0.067 M Tris
buffer (pH 8.8) containing 4 mM MgCl2, 16 mM
(NH4)2SO4, 10 mM 2-mercaptoethanol,
0.1 mg of bovine serum albumin per ml (12), 100 µM each
deoxynucleoside triphosphate, and Taq polymerase (1 U;
Gibco/BRL) as follows: 35 cycles at 95°C for 1 min, at 55°C for 1 min, and at 72°C for 1 min. Following electrophoresis on a 2.5%
agarose gel, PCR products were visualized by UV irradiation in the
presence of ethidium bromide. The PCR products were cloned into pT7Blue
(Novagen, Madison, Wis.) and sequenced with chain terminators
(20).
RT-PCR assay for detection of PoEV.
Primers based on the
sequence described by Tristem et al. (25) were used to
obtain additional sequences of the reverse transcriptase coding region.
RNA from
106 cells (isolated with RNA stat-60; Tel-test
"B," Inc., Friendswood, Tex.) was converted to cDNA with 2.5 µM
random hexamers and Superscript II (Life Technologies, Gaithersburg,
Md.). cDNA templates were amplified with the PoEV-derived primers PB905
(sense) (5' CCGCAGGGATGGGTTTGGCAAAGCA 3') and PB906
(antisense) (5' ACGTACTGGAGGAGGGTCACCTGA 3') for 30 cycles
at 94°C for 30 s, at 60°C for 30 s, and at 72°C for 1 min. To obtain sequence information, the PCR products were cloned into
the TAII vector (Invitrogen Corporation, San Diego, Calif.). Multiple
clones were sequenced to verify nucleotide differences. To detect
expressed PoEV sequences in cells, the amplification products were
separated on a 1% agarose gel, transferred to Nytran (Schleicher & Schuell, Keene, N.H.), and hybridized with a 32P-labelled
probe (nick translated). The PoEV-specific probe was an amplified
product obtained with PB903, 5' GACGGGTAACCCACTCGTTTCTGGT 3',
and PB906 with the amplification conditions described above. The
membrane was hybridized at 42°C in hybrisol I (Oncor, Gaithersburg, Md.) and stringently washed in 0.1× SSC (1× SSC is 0.15 M NaCl plus
0.015 M sodium citrate)-0.1% sodium dodecyl sulfate at 65°C. To
assess cDNA synthesis, all cDNA preparations were examined for their
ability to amplify G3PDH (GenBank accession no. M32599).
Nucleotide sequence accession numbers.
The GenBank accession
number for the ST-NIH sequence is AF033259, and that for sequence
ST-Yucatan is AF033260.
 |
RESULTS |
Mitogenic stimulation of porcine PBMC releases infectious type C
retrovirus.
To investigate the conditions which would activate
PoEV(s), primary PBMC isolated from the blood of an NIH miniature pig
were exposed to two different combinations of mitogens. Activity of retroviral reverse transcriptase was measured in the medium of stimulated cells. Five days after stimulation, the level of reverse transcriptase activity showed a sharp increase in activity, which returned to baseline levels by 8 days (Fig.
1). Treatment of PBMC with PHA and
phorbol myristate acetate (PMA) or with PMA and the calcium ionophore
A23187 resulted in comparable increases in reverse transcriptase
activity with similar kinetics (Fig. 1). PHA and PMA treatment of PBMC
isolated from blood of a different strain of pig, the Yucatan, also
showed a similar increase in reverse transcriptase activity (data not
shown).

View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Porcine PBMC cultured with two combinations of mitogens
release reverse transcriptase activity. Cell culture medium was removed
at each of the days indicated after porcine PBMC were exposed to either
PHA and PMA (black bars) or PMA and calcium ionophore A23187 (grey
bars), as described in Materials and Methods. The culture medium was
precleared of cell and cellular debris and then assayed for reverse
transcriptase activity. The mean values ± standard deviations of
the mean for counts per minute (cpm) of [3H]TTP
incorporated are shown on the y axis.
|
|
To determine whether the increase in reverse transcriptase activity
following mitogenic stimulation correlated with the presence
of
infectious retrovirus, stimulated PBMC, which were isolated
either from
an NIH miniature pig or a Yucatan pig, were cocultured
with ST-IOWA, a
porcine cell line previously shown to be susceptible
to infection by
PoEV (
11). As shown in Fig.
2,
reverse transcriptase
activity began to increase in ST cells at 14 days
postexposure
to PBMC from both strains of pigs and continued to
increase throughout
the duration of the experiment. The increase in
reverse transcriptase
activity observed over time indicates that
mitogenic activation
of porcine PBMC released an infectious retrovirus
capable of spreading
through the ST-IOWA cell culture.

View larger version (16K):
[in this window]
[in a new window]
|
FIG. 2.
Infectious virus is isolated after coculture of
activated PBMC from the NIH miniature pig or the Yucatan with ST-IOWA
cells. PBMC isolated from the NIH miniature pig or Yucatan pig were
cultured with PHA and PMA for 5 days prior to coculture with ST-IOWA
cells. Cell culture medium was removed at each of the days indicated
and assayed for reverse transcriptase activity. The values for counts
per minute of [3H]TTP incorporated for cells exposed to
NIH miniature pig PBMC are shown by solid black squares, and those for
cells exposed to Yucatan pig PBMC are shown by open circles. Background
values for uninfected ST-IOWA cells have been subtracted from the
values shown. cpm, counts per minute.
|
|
Retroviruses released by porcine cells were previously shown to have a
type C morphology (
1,
13). We examined the ST-IOWA
cells
productively infected with virus from the NIH miniature
pig or the
Yucatan pig (ST-NIH or ST-Y, respectively) by electron
microscopy. As
shown in Fig.
3, the morphology of the
virus associated
with both cell lines is typical of a type C retrovirus
(
23).
No such particles were observed in control uninfected
ST-IOWA
cells. The PoEV obtained from these productively infected ST
cell
lines is referred to as PoEV-NIH or PoEV-Y.

View larger version (97K):
[in this window]
[in a new window]
|
FIG. 3.
ST-IOWA cells productively infected with PoEV release
type C particles. ST-IOWA cells productively infected with PoEV from
the Yucatan pig (top; bar = 100 nm) and the NIH miniature pig
(bottom; bar = 0.25 µm).
|
|
PBMC-derived PoEVs are related to but distinct from pig kidney cell
line-derived PERV-PK.
In order to identify and characterize the
PoEV(s) induced by mitogenic activation of porcine PBMC, we used a PCR
assay developed to identify unknown retroviruses (see Materials and
Methods). This method uses pools of degenerate oligonucleotide primers
containing the sequence possibilities for two regions of highly
conserved amino acid sequences within the reverse transcriptase genes
of different retroviruses. A similar assay was used to identify unknown herpesviruses by targeting the DNA polymerase gene (18).
cDNA synthesis and PCRs were performed on RNA isolated from ST-NIH cells with a single downstream degenerate primer pool, YMDDB, and one
of three different upstream primer pools, each of which targets
different retroviral reverse transcriptase sequences (Table 1). A 150-bp product was observed from
the porcine sample when the upstream primer PQGFA (based on sequence
found in human T-cell leukemia virus type 1) was used but not when the
PQGMA or PQGWA upstream primer (based on sequence identified in mouse
mammary tumor virus or lentiviruses, respectively) was used (Table 1). The 150-bp PCR product was cloned and sequenced. Computer-based sequence comparisons with BLAST demonstrated that this sequence was
highly related to the reverse transcriptase genes of other retroviruses
and showed a high degree of sequence conservation to that previously
reported for an endogenous retrovirus present in the pig genome
(25). Oligonucleotide primers based on this published
sequence were used to amplify a larger, 483-bp portion of the reverse
transcriptase coding region from cDNA made from RNA of ST-NIH and ST-Y
cells. Only one nucleotide difference was detected between the 483-bp
sequences from PoEV-NIH and PoEV-Y (99.8% nucleotide identity; Table
2). These sequences varied by either one
or two nucleotides, respectively, from the published PERV-MP sequence,
obtained from the virus produced in the MPK miniature-pig kidney cell
line (15). Neither nucleotide change altered the encoded
amino acid sequence. Comparison of PoEV-NIH and PoEV-Y nucleotide
sequences with the sequence of the virus identified in the PK(15) pig
kidney cell line, PERV-PK, showed greater nucleotide differences, with
only 95% nucleotide identity with the PERV-PK sequence from this
region (15). Ninety-four percent nucleotide identity was
found in a comparison of this region of PoEV-NIH and PoEV-Y with the
same sequence characterized in the pig genome (25).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Two nucleotide positions distinguish PoEV from the NIH
miniature pig and the Yucatan pig sequences from PERV-MP in the reverse
transcriptase coding region of expressed sequences
|
|
PoEV-NIH and PoEV-Y display tropism for human cells.
To
explore the species tropism of PoEV, cell lines representative of
different species were exposed to PoEV-NIH or PoEV-Y and assessed for
evidence of infection by reverse transcriptase assay (Table
3). Reverse transcriptase activity was
detectable in porcine, mink, and human cell lines after exposure to
PoEV-Y, whereas porcine and human cell lines, but not mink or any of
the other cell lines examined, expressed reverse transcriptase activity after exposure to PoEV-NIH.
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Reverse transcriptase activity in cells exposed to PoEV
isolated from the NIH miniature pig or the Yucatan pig
|
|
Although ST-IOWA cells do not produce retroviral particles, as shown by
electron microscopy analysis and infectivity assays,
they do express
PoEV-specific sequences as detected by RT-PCR
(data not shown). Thus,
the observation that virus produced in
ST-NIH and ST-Y cells infects
human cell lines could be explained
by the presence of a virus
generated either by recombination of
PoEV-NIH or PoEV-Y viral sequences
with endogenous elements present
in ST or by pseudotyping of PoEV-NIH
or PoEV-Y viral proteins
with envelope proteins expressed in ST cells.
Therefore, to determine
whether the virus released from activated
porcine PBMC could directly
infect human cells, we directly cocultured
NIH miniature pig PBMC,
either live or lethally irradiated 6 days after
stimulation with
PHA and PMA, with either ST-IOWA, human embryonic
kidney 293,
or African green monkey COS-7 cells. For each cell line, a
control
culture not exposed to porcine PBMC was also examined.
Infection
was monitored by reverse transcriptase assay and, where
indicated,
by PoEV-specific RT-PCR assay (described in Materials and
Methods).
Reverse transcriptase activity released from ST-IOWA cells
exposed
to either live or lethally irradiated PBMC was initially
detectable
approximately 2 weeks after coculture (Fig.
4A). ST-IOWA cells
could not be monitored
by RT-PCR assay because of expression of
endogenous sequences present
in control cultures (data not shown).
Reverse transcriptase activity
was detected in 293 cells at day
31 and increased by day 55 to the
levels observed in the PBMC-ST-IOWA
cell coculture (Fig.
4A). RT-PCR
assay of 293 cells exposed to
either live (lane a) or irradiated (lane
b) porcine PBMC demonstrated
that expression of PoEV-specific sequences
could be observed as
early as 6 days (Fig.
4B). No evidence of
infection was observed
in any of the cocultures with COS-7 cells with
either reverse
transcriptase or RT-PCR over the course of the
experiment (55
days; data not shown). The results for 293 cells clearly
demonstrate
that PoEV can be directly transferred to human cells from
porcine
PBMC. Further, the increasing levels of reverse transcriptase
activity observed in the 293 cell cultures represent a spreading
and
productive infection by PoEV in human cells.

View larger version (19K):
[in this window]
[in a new window]
|
FIG. 4.
Infectious virus isolated by coculture of activated PBMC
from NIH miniature pig with ST-IOWA or human 293 cells. PBMC isolated
from the NIH miniature pig were activated with PHA and PMA. Six days
after activation, the cells were cocultured with ST-IOWA cells or human
293 cells. (A) Reverse transcriptase activity in cell culture medium
removed at each of the days indicated. The mean values for counts per
minute of [3H]TTP incorporated are shown on the
y axis. The values for ST-IOWA cells cocultured with live
PBMC are shown by closed circles, and those for ST-IOWA cells
cocultured with lethally irradiated PBMC are shown by open circles. The
results for the coculture of 293 cells with live PBMC are shown by
closed squares, and those for 293 cells cocultured with lethally
irradiated PBMC are shown by open squares. cpm, counts per minute. (B)
Assay by RT-PCR followed by Southern blot analysis (described in
Materials and Methods) of RNA obtained from 293 cells at the days
indicated after coculture (numbers across the top) with either live
PBMC (a), lethally irradiated PBMC (b), or control 293 (c) cultures. H,
water only in lieu of cDNA template, a negative control for the PCR.
|
|
 |
DISCUSSION |
We have demonstrated that mitogenic activation of primary PBMC
from two strains of pig, the NIH miniature pig and the Yucatan pig,
results in the release of type C retrovirus that infects human as well
as porcine cells. Limited host range analysis suggested that these
viruses may be distinct, as the Yucatan-derived virus infected mink
cells but the NIH miniature pig-derived virus did not. Although there
is a previous report of a pig kidney cell line, PK(15), which
spontaneously expresses type C particles with a human host range
(15), this is the first demonstration that an endogenous
retrovirus that is directly infectious to human cells can be mobilized
from primary porcine cells.
The pig genome has been estimated to contain approximately 50 loci of
endogenous retroviral sequences, based on hybridization with a probe
derived from the pol region (15). Endogenous
retroviral sequences are typically defective, representing partial,
deleted, or otherwise disabled genomes incapable of encoding infectious retrovirus. Whether the loci which do encode infectious virus are
common to all strains of pigs or unique to the strains tested is not
known. The origins of the NIH miniature pig and the Yucatan pig are
obscure. The Yucatan pig is derived from a herd which roamed wild in
the Yucatan peninsula of Mexico (14). The NIH miniature pig
is derived from crosses which included both feral and domesticated
breeds found within the United States and elsewhere (4, 19).
Sequence comparison of the reverse transcriptase coding regions
revealed a high degree of nucleotide identity (482 of 483 nucleotides)
of these viruses to each other as well as to PERV-MP, a porcine
retrovirus which was reported to infect porcine cells, but not human
cells, while some sequence divergence was observed when this region of
PoEV-NIH and PoEV-Y was compared to the PERV-PK virus, which infects
human cell lines (15). The divergence from PERV-PK may
reflect the presence of more than one locus in the pig genome which
encodes a virus capable of infecting human cells or the genetic
heterogeneity of pig retroviral loci in different breeds. Sequence
comparison of other regions of the retroviral genome such as the long
terminal repeat or envelope may help to elucidate the relationship
among these viruses. Indeed, it was recently reported that at least two
classes of envelope are expressed in cells infected with PK(15)-derived
virus (8).
Live porcine cells are used for therapeutic purposes in a growing
number of clinical trials. Cases in which tissues or organs are
minimally manipulated are likely to transfer leukocytes with the
xenograft into a human recipient. Our findings suggest that subsequent
mitogenic activation of the transferred porcine lymphocytes may release
a retrovirus infectious for the recipient. Further analysis of the
biological characteristics of this virus are needed to determine its
tissue-specific infection properties. One strain of PoEV, PERV-PK, is
reported to infect human cell lines of kidney, lung, muscle, and B- and
T-cell origin (15), suggesting that PoEV(s) may infect a
broad range of human tissues in vivo. Additional information is needed
to determine whether other primary porcine tissues spontaneously
release or can be induced to release infectious retrovirus.
Although it is difficult to predict the clinical outcome of human
infection by PoEV, type C retroviruses closely related to PoEV have
been associated with disease in nonhuman primates. Three of 10 immunosuppressed nonhuman primates developed lymphoma and died after
exposure to a retroviral vector contaminated with high doses of
replicating murine leukemia virus as well as defective endogenous
murine retroviral genomes (3, 17). This experiment inadvertently models one aspect of xenotransplantation, that is, chronic exposure to a retrovirus in an immunosuppressed recipient. A
second relevant example is the development of chronic myelogenous leukemia in normal juvenile gibbon apes after intraperitoneal inoculation with gibbon ape leukemia virus SEATO (7), which may have originated from an endogenous retrovirus of Asian wild mice
(10). This represents another precedent for transmission and
disease induction in a higher-order primate by a type C retrovirus endogenous to a nonprimate mammalian species. Preliminary infectivity studies of African green monkey (COS-7) and Rhesus kidney (FRhK) (15) cell lines suggest that PoEV may not infect monkey
cells, and therefore nonhuman primates may not be suitable for
assessing the safety risk associated with this virus. The absence of a
nonhuman primate animal model and the finding that primary porcine
lymphocytes release retrovirus infectious for human cells underscore
the need for careful screening of porcine xenograft recipients for
transfer of PoEV and potential development of disease. In this regard, the PoEV-specific RT-PCR assay which we have developed may be useful.
 |
ACKNOWLEDGMENTS |
We thank Robin Weiss, Jonathan Stoye, and Maribeth Eiden for
helpful discussions, Eda Bloom and Dennis Klineman for critical evaluation of the manuscript, Marilyn Lundquist for technical assistance in the preparation of samples for electron microscopy, and
Jackie Newell and David Sachs for providing background information on
miniature pig breeds.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Building 29B,
Room 2E12, 8800 Rockville Pike, Bethesda, MD 20892. Phone: (301)
827-0481. Fax: (301) 827-0449. E-mail:
wilsonc{at}A1.cber.fda.gov.
 |
REFERENCES |
| 1.
|
Armstrong, J. A.,
J. S. Porterfield, and A. T. D. Madrid.
1971.
C-type virus particles in pig kidney cell lines.
J. Gen. Virol.
10:195-198[Abstract/Free Full Text].
|
| 2.
|
Benveniste, R. E., and G. J. Todaro.
1975.
Evolution of type C viral genes: preservation of ancestral murine type C viral sequences in pig cellular DNA.
Proc. Natl. Acad. Sci. USA
72:4090-4094[Abstract/Free Full Text].
|
| 3.
|
Donahue, R. E.,
S. W. Kessler,
D. Bodine,
K. McDonagh,
C. Dunbar,
S. Goodman,
B. Agricola,
E. Byrne,
M. Raffeld,
R. Moen,
J. Bacher,
K. M. Zsebo, and A. W. Nienhuis.
1992.
Helper virus induced T cell lymphoma in nonhuman primates after retroviral mediated gene transfer.
J. Exp. Med.
176:1125-1135[Abstract/Free Full Text].
|
| 4.
|
England, D. C., and L. M. Panepinto.
1985.
Conceptual and operational history of the development of miniature swine, p. 17-22. In
M. E. Tumbleson (ed.), Swine in biomedical research, 1st ed., vol. 1.
Plenum Press, New York, N.Y.
|
| 5.
|
Hirsch, M. S.,
P. H. Black,
G. S. Tracy,
S. Leibowitz, and R. S. Schwartz.
1970.
Leukemia virus activation in chronic allogeneic disease.
Proc. Natl. Acad. Sci. USA
67:1914-1917[Abstract/Free Full Text].
|
| 6.
|
Hirsch, M. S.,
S. M. Phillips,
C. Solnik,
P. H. Black,
R. S. Schwartz, and C. B. Carpenter.
1972.
Activation of leukemia viruses by graft-versus-host and mixed lymphocyte reactions in vitro.
Proc. Natl. Acad. Sci. USA
69:1069-1072[Abstract/Free Full Text].
|
| 7.
|
Kawakami, T. G.,
G. V. Kollias, Jr., and C. Holmberg.
1980.
Oncogenicity of gibbon type-C myelogenous leukemia virus.
Int. J. Cancer.
25:641-646[Medline].
|
| 8.
|
Le Tissier, P.,
J. P. Stoye,
Y. Takeuchi,
C. Patience, and R. A. Weiss.
1997.
Two sets of human-tropic pig retroviruses.
Nature
389:681-682[Medline].
|
| 9.
|
Levy, J. A.,
S. K. Datta, and R. S. Schwartz.
1977.
Recovery of xenotropic virus but not ecotropic virus during graft-versus-host reaction in mice.
Clin. Immunol. Immunopathol.
7:262-268[Medline].
|
| 10.
|
Lieber, M.,
C. J. Scherr,
G. J. Todaro,
R. E. Benveniste,
R. Callahan, and H. G. Coon.
1975.
Isolation from the Asian mouse Mus Caroli of an endogenous type C virus related to infectious primate type C viruses.
Proc. Natl. Acad. Sci. USA
72:2315-2319[Abstract/Free Full Text].
|
| 11.
|
Lieber, M. M.,
C. J. Sherr,
R. E. Benveniste, and G. J. Todaro.
1975.
Biologic and immunologic properties of porcine type C viruses.
Virology
66:616-619[Medline].
|
| 12.
|
Lisitsyn, N.,
N. Lisitsyn, and M. Wigler.
1993.
Cloning the differences between two complex genomes.
Science
259:946-951[Abstract].
|
| 13.
|
Moennig, V.,
H. Frank,
G. Hunsmann,
P. Ohms,
H. Schwarz, and W. Schafer.
1974.
C-type particles produced by a permanent cell line from a leukemic pig.
Virology
57:179-188[Medline].
|
| 14.
|
Panepinto, L. M., and R. L. Kroc.
1995.
History, genetic origins, and care of Yucatan miniature and micro pigs.
Lab. Anim.
June:31-34.
|
| 15.
|
Patience, C.,
Y. Takeuchi, and R. A. Weiss.
1997.
Infection of human cells by an endogenous retrovirus of pigs.
Nat. Med.
3:282-286[Medline].
|
| 16.
|
Phan-Thanh, L.,
B. Kaeffer, and E. Bottreau.
1992.
Porcine retrovirus: optimal conditions for its biochemical detection.
Arch. Virol.
123:255-265[Medline].
|
| 17.
|
Purcell, D. F. J.,
C. M. Broscius,
E. F. Vanin,
C. E. Buckler,
A. W. Nienhuis, and M. A. Martin.
1996.
An array of murine leukemia virus-related elements is transmitted and expressed in a primate recipient of retroviral gene transfer.
J. Virol.
70:887-897[Abstract].
|
| 18.
|
Rose, T. M.,
K. B. Strand,
E. R. Schultz,
G. Schaefer,
G. W. Rankin, Jr.,
M. E. Thouless,
C.-C. Tsai, and M. L. Bosch.
1997.
Identification of two homologs of the Kaposi's sarcoma-associated herpesvirus (human herpesvirus 8) in retroperitoneal fibromatosis of different macaque species.
J. Virol.
71:4138-4144[Abstract].
|
| 19.
|
Sachs, D. H.,
G. Leight,
J. Cone,
S. Schwarz,
L. Stuart, and S. Rosenberg.
1976.
Transplantation in miniature swine. I. Fixation of the major histocompatibility complex.
Transplantation
22:559-567[Medline].
|
| 20.
|
Sanger, F.,
S. Nicklen, and A. R. Coulson.
1977.
DNA sequencing with chain-terminating inhibitors.
Proc. Natl. Acad. Sci. USA
74:5463-5467[Abstract/Free Full Text].
|
| 21.
|
Sherr, C. J.,
M. M. Lieber, and G. J. Todaro.
1974.
Mixed splenocyte cultures and graft versus host reactions selectively induce an "S-tropic" murine type C virus.
Cell
1:55-58.
|
| 22.
|
Strandstrom, H.,
P. Veijalainen,
V. Moennig,
G. Hunsmann,
H. Schwarz, and W. Schafer.
1974.
C-type particles produced by a permanent cell line from a leukemic pig. I. Origin and properties of the host cells and some evidence for the occurrence of type-C-like particles.
Virology
57:175-178[Medline].
|
| 23.
|
Teich, N.
1982.
Taxonomy of retroviruses, p. 25-308. In
R. Weiss, N. Teich, H. Varmus, and J. Coffin (ed.), RNA tumor viruses.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 24.
|
Todaro, G. J.,
R. E. Benveniste,
M. M. Lieber, and C. J. Sherr.
1974.
Characterization of a type C virus released from the porcine cell line PK(15).
Virology
58:65-74[Medline].
|
| 25.
|
Tristem, M.,
P. Kabat,
L. Lieberman,
S. Linde,
A. Karpas, and F. Hill.
1996.
Characterization of a novel murine leukemia virus-related subgroup within mammals.
J. Virol.
70:8241-8246[Abstract].
|
| 26.
|
Tumilowicz, J. J.,
C.-L. Hung, and B. Kramarsky.
1979.
Concurrent replication of a papovavirus and a C-type virus in the CCL 33 porcine cell line.
In Vitro
15:922-928[Medline].
|
| 27.
|
Wilson, C. A.,
M. V. Eiden, and J. W. Marsh.
1994.
Quantitative micro p30 and reverse transcriptase assays for Moloney murine leukemia virus.
J. Virol. Methods
48:109-118[Medline].
|
J Virol, April 1998, p. 3082-3087, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Issa, N. C., Wilkinson, R. A., Griesemer, A., Cooper, D. K. C., Yamada, K., Sachs, D. H., Fishman, J. A.
(2008). Absence of Replication of Porcine Endogenous Retrovirus and Porcine Lymphotropic Herpesvirus Type 1 with Prolonged Pig Cell Microchimerism after Pig-to-Baboon Xenotransplantation. J. Virol.
82: 12441-12448
[Abstract]
[Full Text]
-
Argaw, T., Figueroa, M., Salomon, D. R., Wilson, C. A.
(2008). Identification of Residues outside of the Receptor Binding Domain That Influence the Infectivity and Tropism of Porcine Endogenous Retrovirus. J. Virol.
82: 7483-7491
[Abstract]
[Full Text]
-
Shi, M., Wang, X., De Clercq, E., Takao, S., Baba, M.
(2007). Selective Inhibition of Porcine Endogenous Retrovirus Replication in Human Cells by Acyclic Nucleoside Phosphonates. Antimicrob. Agents Chemother.
51: 2600-2604
[Abstract]
[Full Text]
-
Moalic, Y., Blanchard, Y., Felix, H., Jestin, A.
(2006). Porcine Endogenous Retrovirus Integration Sites in the Human Genome: Features in Common with Those of Murine Leukemia Virus. J. Virol.
80: 10980-10988
[Abstract]
[Full Text]
-
Preuss, T., Fischer, N., Boller, K., Tonjes, R. R.
(2006). Isolation and characterization of an infectious replication-competent molecular clone of ecotropic porcine endogenous retrovirus class C.. J. Virol.
80: 10258-10261
[Abstract]
[Full Text]
-
Martina, Y., Marcucci, K. T., Cherqui, S., Szabo, A., Drysdale, T., Srinivisan, U., Wilson, C. A., Patience, C., Salomon, D. R.
(2006). Mice transgenic for a human porcine endogenous retrovirus receptor are susceptible to productive viral infection.. J. Virol.
80: 3135-3146
[Abstract]
[Full Text]
-
Miyagawa, S., Nakatsu, S., Nakagawa, T., Kondo, A., Matsunami, K., Hazama, K., Yamada, J., Tomonaga, K., Miyazawa, T., Shirakura, R.
(2005). Prevention of PERV Infections in Pig to Human Xenotransplantation by the RNA Interference Silences Gene. J Biochem
137: 503-508
[Abstract]
[Full Text]
-
Harrison, I., Takeuchi, Y., Bartosch, B., Stoye, J. P.
(2004). Determinants of High Titer in Recombinant Porcine Endogenous Retroviruses. J. Virol.
78: 13871-13879
[Abstract]
[Full Text]
-
Bartosch, B., Stefanidis, D., Myers, R., Weiss, R., Patience, C., Takeuchi, Y.
(2004). Evidence and Consequence of Porcine Endogenous Retrovirus Recombination. J. Virol.
78: 13880-13890
[Abstract]
[Full Text]
-
Scobie, L., Taylor, S., Logan, N. A., Meikle, S., Onions, D., Patience, C., Quinn, G.
(2004). Characterization of germline porcine endogenous retroviruses from Large White pig. J. Gen. Virol.
85: 2421-2428
[Abstract]
[Full Text]
-
Quinn, G., Wood, J. C., Ryan, D. J. J., Suling, K. M., Moran, K. M., Kolber-Simonds, D. L., Greenstein, J. L., Schuurman, H.-J., Hawley, R. J., Patience, C.
(2004). Porcine Endogenous Retrovirus Transmission Characteristics of Galactose {alpha}1-3 Galactose-Deficient Pig Cells. J. Virol.
78: 5805-5811
[Abstract]
[Full Text]
-
Magre, S., Takeuchi, Y., Langford, G., Richards, A., Patience, C., Weiss, R.
(2004). Reduced Sensitivity to Human Serum Inactivation of Enveloped Viruses Produced by Pig Cells Transgenic for Human CD55 or Deficient for the Galactosyl-{alpha}(1-3) Galactosyl Epitope. J. Virol.
78: 5812-5819
[Abstract]
[Full Text]
-
Jalan, R, Sen, S, Williams, R
(2004). PROSPECTS FOR EXTRACORPOREAL LIVER SUPPORT. Gut
53: 890-898
[Full Text]
-
Wood, J. C., Quinn, G., Suling, K. M., Oldmixon, B. A., Van Tine, B. A., Cina, R., Arn, S., Huang, C. A., Scobie, L., Onions, D. E., Sachs, D. H., Schuurman, H.-J., Fishman, J. A., Patience, C.
(2004). Identification of Exogenous Forms of Human-Tropic Porcine Endogenous Retrovirus in Miniature Swine. J. Virol.
78: 2494-2501
[Abstract]
[Full Text]
-
Argaw, T., Colon-Moran, W., Wilson, C. A.
(2004). Limited infection without evidence of replication by porcine endogenous retrovirus in guinea pigs. J. Gen. Virol.
85: 15-19
[Abstract]
[Full Text]
-
Quinn, G., Wood, J., Suling, K., Arn, S., Sachs, D. H., Schuurman, H.-J., Patience, C.
(2004). Genotyping of Porcine Endogenous Retroviruses from a Family of Miniature Swine. J. Virol.
78: 314-319
[Abstract]
[Full Text]
-
Tonjes, R. R., Niebert, M.
(2003). Relative Age of Proviral Porcine Endogenous Retrovirus Sequences in Sus scrofa Based on the Molecular Clock Hypothesis. J. Virol.
77: 12363-12368
[Abstract]
[Full Text]
-
Leyh, R. G., Wilhelmi, M., Walles, T., Kallenbach, K., Rebe, P., Oberbeck, A., Herden, T., Haverich, A., Mertsching, H.
(2003). Acellularized porcine heart valve scaffolds for heart valve tissue engineering and the risk of cross-species transmission of porcine endogenous retrovirus. J. Thorac. Cardiovasc. Surg.
126: 1000-1004
[Abstract]
[Full Text]
-
Walles, T., Lichtenberg, A., Puschmann, C., Leyh, R., Wilhelmi, M., Kallenbach, K., Haverich, A., Mertsching, H.
(2003). In vivo model for cross-species porcine endogenous retrovirus transmission using tissue engineered pulmonary arteries. Eur. J. Cardiothorac. Surg.
24: 358-363
[Abstract]
[Full Text]
-
Ericsson, T. A., Takeuchi, Y., Templin, C., Quinn, G., Farhadian, S. F., Wood, J. C., Oldmixon, B. A., Suling, K. M., Ishii, J. K., Kitagawa, Y., Miyazawa, T., Salomon, D. R., Weiss, R. A., Patience, C.
(2003). Identification of receptors for pig endogenous retrovirus. Proc. Natl. Acad. Sci. USA
100: 6759-6764
[Abstract]
[Full Text]
-
Wilson, C. A., Laeeq, S., Ritzhaupt, A., Colon-Moran, W., Yoshimura, F. K.
(2002). Sequence Analysis of Porcine Endogenous Retrovirus Long Terminal Repeats and Identification of Transcriptional Regulatory Regions. J. Virol.
77: 142-149
[Abstract]
[Full Text]
-
Scheef, G., Fischer, N., Flory, E., Schmitt, I., Tonjes, R. R.
(2002). Transcriptional Regulation of Porcine Endogenous Retroviruses Released from Porcine and Infected Human Cells by Heterotrimeric Protein Complex NF-Y and Impact of Immunosuppressive Drugs. J. Virol.
76: 12553-12563
[Abstract]
[Full Text]
-
Ritzhaupt, A., van der Laan, L. J. W., Salomon, D. R., Wilson, C. A.
(2002). Porcine Endogenous Retrovirus Infects but Does Not Replicate in Nonhuman Primate Primary Cells and Cell Lines. J. Virol.
76: 11312-11320
[Abstract]
[Full Text]
-
Bartosch, B., Weiss, R. A., Takeuchi, Y.
(2002). PCR-based cloning and immunocytological titration of infectious porcine endogenous retrovirus subgroup A and B. J. Gen. Virol.
83: 2231-2240
[Abstract]
[Full Text]
-
Blusch, J. H., Seelmeir, S., von der Helm, K.
(2002). Molecular and Enzymatic Characterization of the Porcine Endogenous Retrovirus Protease. J. Virol.
76: 7913-7917
[Abstract]
[Full Text]
-
Lee, J.-H., Webb, G. C., Allen, R. D. M., Moran, C.
(2002). Characterizing and Mapping Porcine Endogenous Retroviruses in Westran Pigs. J. Virol.
76: 5548-5556
[Abstract]
[Full Text]
-
Niebert, M., Rogel-Gaillard, C., Chardon, P., Tonjes, R. R.
(2002). Characterization of Chromosomally Assigned Replication-Competent Gamma Porcine Endogenous Retroviruses Derived from a Large White Pig and Expression in Human Cells. J. Virol.
76: 2714-2720
[Abstract]
[Full Text]
-
Oldmixon, B. A., Wood, J. C., Ericsson, T. A., Wilson, C. A., White-Scharf, M. E., Andersson, G., Greenstein, J. L., Schuurman, H.-J., Patience, C.
(2002). Porcine Endogenous Retrovirus Transmission Characteristics of an Inbred Herd of Miniature Swine. J. Virol.
76: 3045-3048
[Abstract]
[Full Text]
-
Takefman, D. M., Spear, G. T., Saifuddin, M., Wilson, C. A.
(2002). Human CD59 Incorporation into Porcine Endogenous Retrovirus Particles: Implications for the Use of Transgenic Pigs for Xenotransplantation. J. Virol.
76: 1999-2002
[Abstract]
[Full Text]
-
Herring, C., Quinn, G., Bower, R., Parsons, N., Logan, N. A., Brawley, A., Elsome, K., Whittam, A., Fernandez-Suarez, X. M., Cunningham, D., Onions, D., Langford, G., Scobie, L.
(2001). Mapping Full-Length Porcine Endogenous Retroviruses in a Large White Pig. J. Virol.
75: 12252-12265
[Abstract]
[Full Text]
-
Seo, S. H., Goloubeva, O., Webby, R., Webster, R. G.
(2001). Characterization of a Porcine Lung Epithelial Cell Line Suitable for Influenza Virus Studies. J. Virol.
75: 9517-9525
[Abstract]
[Full Text]
-
Scheef, G., Fischer, N., Krach, U., Tonjes, R. R.
(2001). The Number of a U3 Repeat Box Acting as an Enhancer in Long Terminal Repeats of Polytropic Replication-Competent Porcine Endogenous Retroviruses Dynamically Fluctuates during Serial Virus Passages in Human Cells. J. Virol.
75: 6933-6940
[Abstract]
[Full Text]
-
Krach, U., Fischer, N., Czauderna, F., Tönjes, R. R.
(2001). Comparison of Replication-Competent Molecular Clones of Porcine Endogenous Retrovirus Class A and Class B Derived from Pig and Human Cells. J. Virol.
75: 5465-5472
[Abstract]
[Full Text]
-
Takefman, D. M., Wong, S., Maudru, T., Peden, K., Wilson, C. A.
(2001). Detection and Characterization of Porcine Endogenous Retrovirus in Porcine Plasma and Porcine Factor VIII. J. Virol.
75: 4551-4557
[Abstract]
[Full Text]
-
Chapman, L. E., Bloom, E. T.
(2001). Clinical Xenotransplantation. JAMA
285: 2304-2306
[Full Text]
-
Specke, V., Tacke, S. J., Boller, K., Schwendemann, J., Denner, J.
(2001). Porcine endogenous retroviruses: in vitro host range and attempts to establish small animal models. J. Gen. Virol.
82: 837-844
[Abstract]
[Full Text]
-
Moza, A. K., Mertsching, H., Herden, T., Bader, A., Haverich, A.
(2001). Heart valves from pigs and the porcine endogenous retrovirus: Experimental and clinical data to assess the probability of porcine endogenous retrovirus infection in human subjects. J. Thorac. Cardiovasc. Surg.
121: 697-701
[Abstract]
[Full Text]
-
Ericsson, T., Oldmixon, B., Blomberg, J., Rosa, M., Patience, C., Andersson, G.
(2001). Identification of Novel Porcine Endogenous Betaretrovirus Sequences in Miniature Swine. J. Virol.
75: 2765-2770
[Abstract]
[Full Text]
-
Patience, C., Switzer, W. M., Takeuchi, Y., Griffiths, D. J., Goward, M. E., Heneine, W., Stoye, J. P., Weiss, R. A.
(2001). Multiple Groups of Novel Retroviral Genomes in Pigs and Related Species. J. Virol.
75: 2771-2775
[Abstract]
[Full Text]
-
Fryer, J. F. L., Griffiths, P. D., Fishman, J. A., Emery, V. C., Clark, D. A.
(2001). Quantitation of Porcine Cytomegalovirus in Pig Tissues by PCR. J. Clin. Microbiol.
39: 1155-1156
[Abstract]
[Full Text]
-
Dejardin, L. M., Arnoczky, S. P., Ewers, B. J., Haut, R. C., Clarke, R. B.
(2001). Tissue-Engineered Rotator Cuff Tendon Using Porcine Small Intestine Submucosa: Histologic and Mechanical Evaluation in Dogs. Am J Sports Med
29: 175-184
[Abstract]
[Full Text]
-
Qari, S. H., Magre, S., García-Lerma, J. G., Hussain, A. I., Takeuchi, Y., Patience, C., Weiss, R. A., Heneine, W.
(2001). Susceptibility of the Porcine Endogenous Retrovirus to Reverse Transcriptase and Protease Inhibitors. J. Virol.
75: 1048-1053
[Abstract]
[Full Text]
-
Serup, P., Madsen, O. D, Mandrup-Poulsen, T.
(2001). Science, medicine, and the future: Islet and stem cell transplantation for treating diabetes. BMJ
322: 29-32
[Full Text]
-
Boneva, R. S., Folks, T. M., Chapman, L. E.
(2001). Infectious Disease Issues in Xenotransplantation. Clin. Microbiol. Rev.
14: 1-14
[Abstract]
[Full Text]
-
SAMSTEIN, B., PLATT, J. L.
(2001). Physiologic and Immunologic Hurdles to Xenotransplantation. J. Am. Soc. Nephrol.
12: 182-193
[Abstract]
[Full Text]
-
Powell, S. K., Gates, M. E., Langford, G., Gu, M.-L., Lockey, C., Long, Z., Otto, E.
(2000). Antiretroviral Agents Inhibit Infection of Human Cells by Porcine Endogenous Retroviruses. Antimicrob. Agents Chemother.
44: 3432-3433
[Abstract]
[Full Text]
-
Bösch, S., Arnauld, C., Jestin, A.
(2000). Study of Full-Length Porcine Endogenous Retrovirus Genomes with Envelope Gene Polymorphism in a Specific-Pathogen-Free Large White Swine Herd. J. Virol.
74: 8575-8581
[Abstract]
[Full Text]
-
Blusch, J. H., Patience, C., Takeuchi, Y., Templin, C., Roos, C., Von Der Helm, K., Steinhoff, G., Martin, U.
(2000). Infection of Nonhuman Primate Cells by Pig Endogenous Retrovirus. J. Virol.
74: 7687-7690
[Abstract]
[Full Text]
-
Czauderna, F., Fischer, N., Boller, K., Kurth, R., Tönjes, R. R.
(2000). Establishment and Characterization of Molecular Clones of Porcine Endogenous Retroviruses Replicating on Human Cells. J. Virol.
74: 4028-4038
[Abstract]
[Full Text]
-
Wilson, C. A., Wong, S., VanBrocklin, M., Federspiel, M. J.
(2000). Extended Analysis of the In Vitro Tropism of Porcine Endogenous Retrovirus. J. Virol.
74: 49-56
[Abstract]
[Full Text]
-
Sommerfelt, M. A.
(1999). Retrovirus receptors. J. Gen. Virol.
80: 3049-3064
[Full Text]
-
Vanderpool, H. Y
(1999). Xenotransplantation: progress and promise. BMJ
319: 1311-1311
[Full Text]
-
Takeuchi, Y., Patience, C., Magre, S., Weiss, R. A., Banerjee, P. T., Le Tissier, P., Stoye, J. P.
(1998). Host Range and Interference Studies of Three Classes of Pig Endogenous Retrovirus. J. Virol.
72: 9986-9991
[Abstract]
[Full Text]
-
Weiss, R. A
(1998). Science, medicine, and the future: Xenotransplantation. BMJ
317: 931-934
[Full Text]