Previous Article | Next Article 
J Virol, April 1998, p. 3072-3075, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Detection of Hepatitis G Virus Replication Sites by Using Highly
Strand-Specific Tth-Based Reverse Transcriptase PCR
Tomasz
Laskus,1,*
Marek
Radkowski,1
Lian-Fu
Wang,1
Hugo
Vargas,2 and
Jorge
Rakela1,2
Division of Transplantation Medicine, Thomas
E. Starzl Transplantation Institute, University of
Pittsburgh,1 and
Division of
Gastroenterology and Hepatology, University of Pittsburgh Medical
Center,2 Pittsburgh, Pennsylvania
Received 3 November 1997/Accepted 17 December 1997
 |
ABSTRACT |
The replication sites of the recently discovered hepatitis G virus
(HGV) remain unknown. Using highly strand-specific Tth-based reverse transcriptase PCR, we searched for the presence of viral RNA
negative strand in multiple autopsy tissues from four
patients with AIDS and in peripheral blood mononuclear cells from six
other human immunodeficiency virus-positive patients. Negative-strand HGV RNA was detected in three of four bone marrow samples, in two of
two spleen samples, and in one of four liver tissue samples. However,
the specific cellular site of replication within the positive tissues
was not determined. This study does not support HGV as a primary
hepatotropic virus.
| |
INTRODUCTION |
Recently, two independent groups of
investigators described two isolates of the same novel flavivirus and
named the virus hepatitis G virus (HGV) and hepatitis GB virus C
(10, 13). Since the nomenclature of this new agent has not
yet been decided, for the purpose of this article it will be referred
to as HGV. HGV RNA sequences have been detected by reverse
transcriptase (RT) PCR in 1 to 2% of volunteer blood donors and
at significantly higher rates in persons with repeated parenteral
exposure such as intravenous drug addicts (10, 14)
or patients receiving multiple transfusions (4, 10,
16). Furthermore, HGV infection was found to be common in
subjects with various forms of chronic liver disease, being
particularly prevalent in subjects with chronic hepatitis C (2, 3,
10, 15). However, the association between hepatitis and HGV
infection is unclear since the vast majority of infected
individuals do not show liver injury unless simultaneously infected
with another hepatotropic virus (1, 11, 16). This
raises the possibility that HGV is not a strictly hepatotropic virus but rather one which causes hepatitis only occasionally.
View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Sensitivity and specificity of RT-PCR using the Tth
assay. Synthetic positive and negative strands were generated by in
vitro runoff transcription with T7 RNA polymerase from a vector
(pGEM-3Z) containing the 5' untranslated sequence of HCV and serially
diluted in water. The number of target template copies was calculated
from optical density readings. A positive-sense primer was present
during cDNA synthesis, after which the enzyme was inactivated by
chelation with Mn2+ and then negative-sense primer was
added. Samples were amplified as described in the text. Twenty
microliters (20%) of the reaction mixture was fractionated on agarose,
transferred to a nylon membrane by Southern blotting, and subsequently
hybridized to a 32P-labeled probe. When 1 or 6 µg of
total cellular RNA extracted from normal human liver tissue was added,
the sensitivity of the reactions was lowered by no more than 1 log,
while the specificity of the assay was not affected.
|
|
Although studies on the clinical effects of HGV infection are abundant,
studies addressing the issue of viral replication sites are missing. In
a previous article (7), we reported on the lack of evidence
for HGV replication in the liver in a group of HGV-HCV-coinfected
patients with cirrhosis, which implies that the liver is not the
primary replication site for this virus. However, no other cell
compartments have been studied so far.
The major obstacle to a study of HGV replication sites is the lack of
availability of multiple tissue samples from infected individuals since
such samples can be obtained only during autopsy. We reasoned that such
an investigation could be conducted on postmortem tissues from
intravenous drug addicts who died from AIDS, since HGV infection in
this group is common and viral titers are expected to be elevated,
facilitating positive identification of replication sites.
HGV genome organization was found to be similar to that of hepatitis C
virus (HCV), with a single open reading frame and 5' and 3'
untranslated regions (10, 13). In addition, analysis of the
predicted amino acid sequences indicated the presence of structural and
nonstructural proteins as well as a number of putative proteolytic
cleavage sites in a relative position found in HCV (9).
Taking into account these similarities, it can be assumed that HGV
replicates through negative-strand RNA, the presence of which could be
regarded as direct evidence of viral replication.
However, standard RT-PCR is not strand specific due to false priming of
the incorrect strand or self-priming related to RNA secondary
structures (5). An efficient way of avoiding these mispriming events is by conducting cDNA synthesis at high temperature with the thermostable enzyme Tth (5, 6, 8). In the current study, we employed this technique in the search for negative-strand HGV
RNA in peripheral blood mononuclear cells (PBMCs) and multiple organs
from HGV-positive patients with AIDS. The sensitivity and strand
specificity of our assay were determined on synthetic RNA templates.
| |
MATERIALS AND METHODS |
Biological samples.
PBMCs were collected from six human
immunodeficiency virus type 1 (HIV-1)-positive drug addicts whose sera
were found to be HGV RNA positive. All were HCV positive and hepatitis
B surface antigen negative; none had received any antiviral therapy
prior to the study. PBMCs were isolated by Ficoll-Hypaque (Pharmacia, Uppsala, Sweden) density gradient centrifugation, washed three times
with phosphate-buffered saline (pH 7.4), and stored frozen at 
80°C
until use. RNA was extracted from 5 × 106 to 1 × 107 cells or 100 µl of serum by means of a modified
guanidinium thiocyanate-phenol-chloroform technique using commercially
available kits (Ultraspec 2 and Ultraspec 3; Biotecx Laboratories,
Houston, Tex.) and finally dissolved in 30 µl of water. Ten
microliters of this RNA solution was reverse transcribed as further
described; in the case of serum, the amount of extracted RNA loaded
into the reaction mixture corresponded to 20 µl.
Tissue samples were collected from four HIV-1-infected drug addicts who
died from AIDS-related complications between March and May 1997. All
four patients were anti-HCV positive and hepatitis B surface antigen
negative; their CD4 cell count was below 200 cells/mm3.
Tissue samples were obtained from each patient during routine autopsy
conducted within 48 h of death and stored at 80°C until analysis.
Samples of the following tissues were collected postmortem from each
patient: liver, bone marrow, spleen, mediastinal lymph
node, pancreas,
thyroid, adrenal gland, kidney, lung, skeletal
muscle, skin, and spinal
cord. RNA was extracted after tissue
homogenization as described above.
For each tissue, two different
amounts of extracted RNA (6 and 1 µg,
as determined by spectrophotometry)
were initially used for RT-PCR. If
the sample was positive in
the amount of 1 µg of RNA, the RNA
template was serially 10-fold
diluted for the purpose of titer
determination.
Synthetic HGV RNA.
To generate synthetic positive- and
negative-strand HGV RNA, PCR product encompassing the 5' untranslated
region of the virus was cloned into a plasmid vector and subsequently
transcribed with T7 polymerase as described elsewhere (7).
Strand-specific RT-PCR with Tth.
The Tth-based RT-PCR
detection of the negative-strand HGV RNA was described in detail
previously (7); the final product was analyzed by agarose
gel electrophoresis and Southern hybridization with a
32P-labeled internal oligoprobe. As described in our
previous report (7) and as illustrated in Fig. 1, this assay
was capable of detecting approximately 100 genomic equivalent molecules
(genomic eq) of the correct strand while unspecifically detecting
107 genomic eq of the incorrect strand. When 1 or 6 µg
of total cellular RNA extracted from normal human liver tissue was
added, the sensitivity of the reactions was lowered by no more than 1 log, while the specificity of the assay was not affected.
RT-PCR with MMLV RT.
Moloney murine leukemia virus (MMLV)
RT-based detection of HGV RNA has been described in detail elsewhere
(7). This assay was found to be very sensitive but totally
unspecific. As reported previously (7), the assay was
capable of detecting 10 genomic eq of the correct template but at the
same time also unspecifically detected 101 to
103 genomic eq of the positive strand.
The detection of HCV sequences with MMLV RT and Tth-based RT-PCR was
described previously (
8). The sensitivity and specificity
of
HCV RNA detection were similar to those for the detection of
HGV RNA
(
8).
To increase the specificity and sensitivity of our assays, wax beads
(Ampliwax; Perkin-Elmer) were employed for "hot start"
of all PCRs
after the RT step. All RT-PCR runs included positive
controls
consisting of end-point dilutions of respective RNA strands,
and
negative controls included normal liver tissue and normal
sera.
All titers were determined by analyzing 10-fold serial dilutions of the
RNA template since at this dilution the results were
reliably
reproducible from run to run. The titers were calculated
by assuming
that the end-point dilution contains 10 genomic eq
when tested by the
MMLV RT-based assay and 10
2 genomic eq when tested with the
Tth-based assay.
To prevent contamination, pre-PCR and post-PCR steps were carried out
in separate rooms. To detect carryover contamination,
negative controls
were included in all reaction series: one negative
sample was processed
for every three to four tested specimens,
and nontarget controls were
included in each run. Under these
conditions, none of the negative
samples or controls was positive.
Since we were concerned about the integrity of the RNA in the samples,
which were collected up to 48 h after the patient's
death, all
liver samples were tested for the presence of
2-microglobulin
RNA by RT-PCR using sense primer
5'TTAGCTGTGCTCGCGCTACTCTCTC3'
and antisense primer
5'GTCGGATTGATGAAACCCAGACACA3'. A product
of the expected
size, 144 bp, was amplified from as little as
0.1 ng of total liver RNA
from each of the four patients.
| |
RESULTS AND DISCUSSION |
HGV RNA in PBMCs.
All six patients from whom PBMCs were
collected were positive for the presence of positive-strand HGV RNA in
serum and in PBMCs at titers ranging from 5 × 103 to
5 × 107 genomic eq/ml and 101 to
103 genomic eq/2 × 106 to 3 × 106 cells, respectively (Table
1). However, all serum and PBMC samples were negative for the presence of the negative-strand HGV RNA when
tested with the Tth-based assay in two independent experiments.
View this table:
[in this window]
[in a new window]
|
TABLE 1.
Detection of positive and negative strands of HGV
RNA in serum samples and PBMCs in six HIV-infected patients
|
|
HGV RNA in various organs.
Almost all analyzed tissues, with
the exception of a few spinal cord and muscle tissue samples, were
positive for the presence of HGV RNA when tested with the MMLV RT-based
assay, although the actual titer varied from tissue to tissue, the
highest being in the bone marrow (Table
2).
View this table:
[in this window]
[in a new window]
|
TABLE 2.
Detection of positive (+) and negative () strands of
HGV RNA in serum samples and various tissues from four patients
with AIDS
|
|
By using the Tth-based strand-specific assay, the presence of
negative-strand HGV RNA was documented in some bone marrow,
spleen, and
liver tissue samples at titers which were 1 to 2 logs
lower than the
titers of the positive-strand HGV RNA (Table
2).
In patient 1, negative-strand HGV RNA was found in bone marrow
only; in patient 2, it
was found in bone marrow and spleen; in
patient 3, it was present in
bone marrow, spleen, and liver; while
in the remaining patient, all
studied samples were persistently
negative for negative-strand HGV RNA
(Table
2; Fig.
2). These
results were
confirmed in two independent experiments using two
separate extraction
procedures.
View larger version (30K):
[in this window]
[in a new window]
|
FIG. 2.
Detection of negative-strand HCV RNA in various tissue
samples from patient 2 by the Tth-based strand-specific RT-PCR assay
and by the non-strand-specific MMLV RT-based assay. The amount of RNA
loaded into each reaction mixture was 1 µg; in the case of serum (S),
it corresponded to 20 µl. The examined tissues included liver (Lv),
spleen (Sp), bone marrow (BM), lymph node (LN), pancreas (Pn), thyroid
(Th), adrenal gland (AG), kidney (Kd), lung (Lg), muscle (Ms), Skin
(Sk), and spinal cord (SC). Positive or sensitivity controls (lane P)
consisted of end-point dilutions of the correct synthetic strand (10 genomic eq for MMLV RT assay and 100 genomic eq for the Tth assay), and
negative controls (lane N) consisted of RNA extracted from livers from
uninfected subjects. While the majority of samples were positive by the
MMLV RT-based RT-PCR, only bone marrow and spleen samples were positive
by the strand-specific Tth-based assay.
|
|
In contrast, positive-strand HCV RNA was detected in liver tissue from
all four patients at titers ranging from 10
3 to
10
7 genomic eq of RNA/µg, and negative-strand HCV RNA
strand, as
determined by Tth assay, was present in all liver samples at
titers
that were 1 to 2 logs lower than those of the positive strand.
Titers of positive-strand HCV RNA in serum samples ranged from
5 × 10
3 to 5 × 10
5 genomic eq/ml (Table
3).
View this table:
[in this window]
[in a new window]
|
TABLE 3.
Detection of positive and negative strands of
HCV RNA in serum and liver tissue samples from four patients
with AIDS
|
|
The present study is the first to positively identify HGV replication
sites in humans. By examining autopsy material from
AIDS patients, we
found the presence of viral negative-strand
RNA, a putative viral
replicative form, in bone marrow, spleen,
and liver tissue. Moreover,
negative-strand HGV RNA titers were
1 to 2 logs lower than titers of
the positive strand, which is
the same proportion as that found for
another flavivirus, HCV,
at its respective replication site. However,
negative-strand HGV
RNA detection was not consistent from patient to
patient
in one
case, no negative-strand RNA was found in any of the
organs tested.
Since the tissue samples were collected at the time of
autopsy,
some RNA might have been degraded and low-level replication
could
have been missed. Nevertheless, detection of high titers of
positive-
and negative-strand HCV RNA in all four liver samples
suggests
the presence of relatively well preserved template.
Negative-strand HGV RNA was detected in only one of four studied liver
samples, although the overall HGV titers in liver tissue
were
significantly higher than those of previously studied HIV-negative
patients (
7). In striking contrast, significant titers of
negative-strand
HCV RNA were detected in liver tissue from all four
patients.
These findings support our previous conclusion that HGV is
not
a strictly hepatotropic virus and that even in the presence of
severe HIV-related immunosuppression, its replication in the liver
is
low or absent.
However, we cannot exclude the possibility of a very low level of HGV
replication in the liver in the remaining three subjects.
In cells
supporting HCV replication, negative RNA strands are
generally detected
at a level that is 1 to 2 logs lower than the
levels of positive
strands (
6,
7). Since the same seems
likely to be true for
HGV, it would mean that replication is below
the sensitivity level of
our Tth-based strand-specific assay.
Obviously, the same applies to
other tissues and PBMCs, where
low-level replication or replication
confined to a small subset
of cells would remain undetected.
It is currently unclear which particular cells are infected at the
identified replication sites. Replication in bone marrow
precursor
cells could manifest itself clinically, but so far no
hematological
disturbances have been associated with HGV infection.
Alternate
candidates for supporting bone marrow viral replication
are stromal
endothelial cells, fibroblasts, and macrophages. Interestingly,
macrophages are richly represented at the sites where HGV
replication
was detected and are known to be permissive for a wide
range of
viruses, including some other flaviviruses (
12).
Alternatively,
HGV could infect various cells at different locations.
In summary, by using a strand-specific Tth-based assay on a variety of
autopsy samples from AIDS patients, we identified the
presence of
negative-strand HGV RNA in bone marrow, spleen, and
liver tissue.
However, the cell lineage supporting viral replication
at these sites
remains to be determined.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Transplant Medicine, University of Pittsburgh Medical Center, 301 Lhormer Bldg., 200 Lothrop St., Pittsburgh, PA 15213. Phone: (412)
624-0287. Fax: (412) 647-9672.
| |
REFERENCES |
| 1.
|
Alter, H. J.
1996.
The cloning and clinical implications of HGV and HGBV-C.
N. Engl. J. Med.
334:1536-1537[Free Full Text].
|
| 2.
|
Berenguer, M.,
N. A. Terrault,
M. Piatak,
A. Yun,
J. P. Kim,
J. Y. N. Lau,
J. R. Lake,
J. R. Roberts,
N. Ascher,
L. Ferrell, and T. Wright.
1996.
Hepatitis G virus infection in patients with hepatitis C virus infection undergoing liver transplantation.
Gastroenterology
111:1569-1575[Medline].
|
| 3.
|
Fiordalisi, G.,
I. Zanella,
G. Mantero,
A. Bettinardi,
R. Stellini,
G. Paraninfo,
G. Cadeo, and D. Primi.
1996.
High prevalence of GB virus C infection in a group of Italian patients with hepatitis of unknown etiology.
J. Infect. Dis.
174:181-183[Medline].
|
| 4.
|
Jarvis, L. M.,
F. Davidson,
J. P. Hanley,
P. L. Yap,
C. A. Ludlam, and P. Simmonds.
1996.
Infection with hepatitis G virus among recipients of plasma products.
Lancet
348:1352-1355[Medline].
|
| 5.
|
Lanford, R. E.,
C. Sureau,
J. R. Jacob,
R. White, and T. R. Fuerst.
1994.
Demonstration of in vitro infection of chimpanzee hepatocytes with hepatitis C virus using strand-specific RT/PCR.
Virology
202:606-614[Medline].
|
| 6.
|
Lanford, R. E.,
D. Chavez,
F. V. Chisari, and C. Sureau.
1995.
Lack of detection of negative-strand hepatitis C virus RNA in peripheral blood mononuclear cells and other extrahepatic tissues by the highly strand-specific rTth reverse transcriptase PCR.
J. Virol.
69:8079-8083[Abstract].
|
| 7.
|
Laskus, T.,
M. Radkowski,
L.-F. Wang,
H. Vargas, and J. Rakela.
1997.
Lack of evidence for hepatitis G virus replication in the livers of patients coinfected with hepatitis C and G viruses.
J. Virol.
71:7804-7806[Abstract].
|
| 8.
|
Laskus, T.,
M. Radkowski,
L.-F. Wang,
J. Cianciara,
H. Vargas, and J. Rakela.
1997.
Hepatitis C virus negative strand is not detected in peripheral blood mononuclear cells and viral sequences are identical to those in serum: a case against extrahepatic replications.
J. Gen. Virol.
78:2747-2750[Abstract].
|
| 9.
|
Leary, T. P.,
A. S. Muerhoff,
J. N. Simons,
T. J. Pilot-Matias,
J. C. Erker,
M. L. Chalmers,
G. G. Schlauder,
G. J. Dawson,
S. M. Desai, and I. K. Mushahwar.
1996.
Sequence and genomic organization of GBV-C: a novel member of the Flaviviridae associated with human non-A-E hepatitis.
J. Med. Virol.
48:60-67[Medline].
|
| 10.
|
Linnen, J.,
J. Wages,
Z.-Y. Zhank-Keck,
K. E. Fry,
K. Z. Krawczynski,
H. Alter,
E. Koonin,
M. Gallaher,
M. Alter,
S. Hadziyannis,
P. Karayiannis,
K. Fung,
Y. Nakatsuji,
J. W. K. Shih,
L. Young,
M. Piatak,
C. Hoover,
J. Fernandez,
S. Chen,
J.-C. Zou,
T. Morris,
K. C. Hyams,
S. Ismay,
J. D. Lifson,
G. Hess,
S. K. H. Foung,
H. Thomas,
D. Bradley,
H. Margolis, and J. P. Kim.
1996.
Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent.
Science
271:505-508[Abstract].
|
| 11.
|
Masuko, K.,
T. Mitsui,
K. Iwano,
C. Yamazaki,
K. Okuda,
T. Meguro,
N. Murayama,
T. Inoue,
K. Tsuda,
H. Okamoto,
Y. Miyakawa, and M. Mayumi.
1996.
Infection with hepatitis GB virus C in patients on maintenance hemodialysis.
N. Engl. J. Med.
334:1465-1490.
|
| 12.
|
Mogensen, S. C.
1979.
Role of macrophages in natural resistance to virus infections.
Microbiol. Rev.
43:1-26[Free Full Text].
|
| 13.
|
Simons, J. N.,
T. P. Leary,
G. J. Dawson,
T. J. Pilot-Matias,
A. S. Muerhoff,
G. G. Schlauder,
S. M. Desai, and I. K. Mushahwar.
1995.
Isolation of novel virus-like sequences associated with human hepatitis.
Nat. Med.
1:564-569[Medline].
|
| 14.
|
Stark, K.,
U. Bienzle,
G. Hess,
A. M. Engel,
B. Hagenschied, and V. Schluter.
1996.
Detection of hepatitis G virus genome among injecting drug users, homosexual and bisexual men, and blood donors.
J. Infect. Dis.
174:1320-1323[Medline].
|
| 15.
|
Tanaka, E.,
H. J. Alter,
Y. Nakatsuji,
W.-K. Shih,
J. P. Kim,
A. Matsumoto,
M. Kobayashi, and K. Kiyosawa.
1996.
Effect of hepatitis G virus infection on chronic hepatitis C.
Ann. Intern. Med.
125:772-773[Free Full Text].
|
| 16.
|
Wang, J. T.,
F. C. Tsai,
C.-Z. Lee,
P.-J. Chen,
J. C. Sheu,
T.-H. Wang, and D.-S. Chen.
1996.
A prospective study of transfusion associated GB virus C infection: similar frequency but different clinical presentation compared with hepatitis C virus.
Blood
88:1881-1886[Abstract/Free Full Text].
|
J Virol, April 1998, p. 3072-3075, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Gisder, S., Aumeier, P., Genersch, E.
(2009). Deformed wing virus: replication and viral load in mites (Varroa destructor). J. Gen. Virol.
90: 463-467
[Abstract]
[Full Text]
-
McLinden, J. H., Kaufman, T. M., Xiang, J., Chang, Q., Klinzman, D., Engel, A. M., Hess, G., Schmidt, U., Houghton, M., Stapleton, J. T.
(2006). Characterization of an Immunodominant Antigenic Site on GB Virus C Glycoprotein E2 That Is Involved in Cell Binding. J. Virol.
80: 12131-12140
[Abstract]
[Full Text]
-
Hsu, C.-W., Cheng, J.-C., Yeh, C.-T.
(2006). Quantitative Assessment of Serum NV-F Virus DNA Concentrations in Samples from Patients Coinfected with Hepatitis B or C Virus.. J. Clin. Microbiol.
44: 3130-3133
[Abstract]
[Full Text]
-
Yue, C., Genersch, E.
(2005). RT-PCR analysis of Deformed wing virus in honeybees (Apis mellifera) and mites (Varroa destructor). J. Gen. Virol.
86: 3419-3424
[Abstract]
[Full Text]
-
Radkowski, M., Wilkinson, J., Nowicki, M., Adair, D., Vargas, H., Ingui, C., Rakela, J., Laskus, T.
(2002). Search for Hepatitis C Virus Negative-Strand RNA Sequences and Analysis of Viral Sequences in the Central Nervous System: Evidence of Replication. J. Virol.
76: 600-608
[Abstract]
[Full Text]
-
Xiang, J., Wünschmann, S., Schmidt, W., Shao, J., Stapleton, J. T.
(2000). Full-Length GB Virus C (Hepatitis G Virus) RNA Transcripts Are Infectious in Primary CD4-Positive T Cells. J. Virol.
74: 9125-9133
[Abstract]
[Full Text]
-
Handa, A., Brown, K. E.
(2000). GB virus C/hepatitis G virus replicates in human haematopoietic cells and vascular endothelial cells. J. Gen. Virol.
81: 2461-2469
[Abstract]
[Full Text]
-
Fogeda, M., López-Alcorocho, J. M., Bartolomé, J., Arocena, C., Martín, M. A., Carreño, V.
(2000). Existence of Distinct GB Virus C/Hepatitis G Virus Variants with Different Tropism. J. Virol.
74: 7936-7942
[Abstract]
[Full Text]
-
Radkowski, M., Kubicka, J., Kisiel, E., Cianciara, J., Nowicki, M., Rakela, J., Laskus, T.
(2000). Detection of active hepatitis C virus and hepatitis G virus/GB virus C replication in bone marrow in human subjects. Blood
95: 3986-3989
[Abstract]
[Full Text]
-
Quarleri, J. F., Mathet, V. L., Feld, M., Ferrario, D., della Latta, M. P., Verdun, R., Sánchez, D. O., Oubiña, J. R.
(1999). GB Virus C/Hepatitis G Virus Groups and Subgroups: Classification by a Restriction Fragment Length Polymorphism Method Based on Phylogenetic Analysis of the 5' Untranslated Region. J. Clin. Microbiol.
37: 1340-1347
[Abstract]
[Full Text]
-
Fogeda, M., Navas, S., Martín, J., Casqueiro, M., Rodríguez, E., Arocena, C., Carreño, V.
(1999). In Vitro Infection of Human Peripheral Blood Mononuclear Cells by GB Virus C/Hepatitis G Virus. J. Virol.
73: 4052-4061
[Abstract]
[Full Text]
-
Stapleton, J. T., Klinzman, D., Schmidt, W. N., Pfaller, M. A., Wu, P., LaBrecque, D. R., Han, J.-q., Phillips, M. J. P., Woolson, R., Alden, B.
(1999). Prospective Comparison of Whole-Blood- and Plasma-Based Hepatitis C Virus RNA Detection Systems: Improved Detection Using Whole Blood as the Source of Viral RNA. J. Clin. Microbiol.
37: 484-489
[Abstract]
[Full Text]
Top
Abstract
Introduction
