Previous Article | Next Article ![]()
J Virol, April 1998, p. 2999-3004, Vol. 72, No. 4
Departamento de Bioquímica y
Biología Molecular, Instituto Universitario de
Biotecnología de Asturias, Universidad de Oviedo, 33006 Oviedo,
Spain
Received 18 June 1997/Accepted 6 January 1998
The rabbit hemorrhagic disease virus (RHDV) (isolate AST/89)
RNA-dependent RNA-polymerase (3Dpol) coding region was
expressed in Escherichia coli by using a glutathione S-transferase-based vector, which allowed milligram
purification of a homogeneous enzyme with an expected molecular mass of
about 58 kDa. The recombinant polypeptide exhibited rifampin- and
actinomycin D-resistant, poly(A)-dependent poly(U) polymerase. The
enzyme also showed RNA polymerase activity in in vitro reactions with synthetic RHDV subgenomic RNA in the presence or absence of an oligo(U) primer. Template-size products were synthesized in the oligo(U)-primed reactions, whereas in the absence of added primer, RNA
products up to twice the length of the template were made. The
double-length RNA products were double stranded and hybridized to both
positive- and negative-sense probes.
Rabbit hemorrhagic disease
virus (RHDV), a member of the Caliciviridae family (3,
16, 17), consists of a single plus-stranded RNA genome of
about 7.4 kb (12) that has a virus-encoded protein, VPg
(24), attached covalently to its 5' end (13) and
is polyadenylated at the 3' end. Viral particles also encapsidate an
abundant VPg-linked polyadenylated subgenomic RNA of about 2.2 kb
(13), which is coterminal with the 3' end of the viral
genome. The data obtained from the in vitro translation (24)
and Escherichia coli expression studies (11)
revealed that the viral RNA is translated into a polyprotein that is
subsequently cleaved to give rise to mature structural and
nonstructural proteins.
Progress on the replication of caliciviruses has been negligible
(2) compared with the advances made with the picornaviruses. Because of the lack of a cell culture system for most caliciviruses, such as RHDV, recombinant DNA technology will be important for the
production and characterization of viral proteins. Although functional
studies have not yet been performed for most of the RHDV nonstructural
proteins, the extensive sequence similarities between the RNA-dependent
RNA polymerase 3D of picornavirus and the recently described RHDV
polyprotein cleavage product p58 (24) indicate that this
polypeptide might have a similar role in genome replication. This
putative mature RNA-dependent RNA polymerase of RHDV
(3Dpol) is generated by cleavage at specific
glutamicacid-threonine and glutamic acid-glycine bonds by a viral
trypsin-like cysteine proteinase (1, 25).
The expression of enzymatically active 3Dpol from
poliovirus (14, 19, 20) and encephalomyocarditis (EMC) virus
(22) in E. coli has been reported, and the
recombinant enzyme was found to have properties similar to those of the
polymerase obtained from virus-infected cells (15). Attempts
to isolate the RNA polymerase of RHDV from infected rabbit livers for
in vitro studies were unsuccessful. This suggested the alternative
approach to produce the mature RHDV 3Dpol in E. coli, using an expression system known to allow the rapid purification of similar recombinant polypeptides under nondenaturing conditions.
Construction of plasmid pGEX-3D.
The 3Dpol
coding region was cloned as a BamHI cassette by PCR
amplification of plasmid pRC30 (11). This was done by
using oligonucleotide primers 3D5'
(5'ggatccatgacatcaaacttcttctgcg3') and 3CD3'
(5'ggatcctcactccataacattcacaaactc3'), which also added a BamHI restriction enzyme
recognition sequence (underlined residues) at both ends of the
amplified region. The resulting fragment was ligated to the pGEM-T
vector (Promega). After digestion of the recombinant plasmid with
the restriction enzyme BamHI, the 1.5-kb fragment
containing the 3Dpol gene was purified and inserted into
BamHI-digested, alkaline phosphatase-treated
expression vector pGEX-2T (Pharmacia) to generate the recombinant
plasmid pGEX-3D (Fig. 1). Cells of
E. coli XL1-Blue were subsequently transformed with
this vector.
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Expression of Enzymatically Active Rabbit Hemorrhagic Disease
Virus RNA-Dependent RNA Polymerase in Escherichia
coli
![]()
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
![]()
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

View larger version (10K):
[in a new window]
FIG. 1.
Schematic representation of expression plasmid pGEX-3D.
The expanded region indicates the junction between GST and
3Dpol coding regions and deduced amino acid sequence. The
thrombin cleavage site and the authentic 3Dpol amino
terminus are also indicated.
Expression and purification of RHDV 3Dpol.
Overnight cultures of E. coli transformed with pGEX-3D
were diluted 1:250 in 500 ml of fresh 2× Luria-Bertani medium
containing ampicillin (50 µg ml
1). The cultures were
incubated at 37°C to an optical density at 600 nm of 0.5, and
isopropyl-1-thio-
-D-galactopyranoside (IPTG) was added
up to 200 µM. After 2 h of growth at 37°C, the cells were
harvested by centrifugation and the pellet was suspended in 30 ml of 50 mM Tris-HCl (pH 8.0)-150 mM NaCl-0.25 mM EDTA (buffer 1). After a
30-min incubation with lysozyme, the suspension was sonicated by using
five 30-s bursts. The supernatant, recovered after centrifugation at
15,000 rpm for 15 min in a Kontron A8.24 rotor, was loaded onto a 5 ml
glutathione-Sepharose 4B column (Pharmacia) equilibrated in buffer 1. The eluate was retained and reapplied to the column. Following the
absorption step, the column was washed five times with 5 ml of buffer
1. After the final wash, the gel slurry was suspended in 400 µl of
buffer 1 containing 480 ng of thrombin (Pharmacia) and incubated at
room temperature for 3 h. The purified RHDV 3Dpol was
recovered by collecting the column eluate. The purified RHDV 3Dpol preparation was stored at
20°C after addition of
5% glycerol and 10 mM MgCl2.
Preparation of oligo(U).
Oligo(U) was prepared by alkali
hydrolysis of poly(U) as described by Plotch et al. (19).
The size of the resulting oligo(U) was determined by end-labeling with
[
-32P]ATP (ICN) and electrophoresis on a 6%
polyacrylamide gel.
Preparation of synthetic RHDV subgenomic RNA. The viral subgenomic RNA was made by in vitro transcription of plasmid pRNA2.2T7R (Fig. 2). Transcription vector pRNA2.2T7R consisted of pEMBL 18 in which a modified T7 RNA polymerase promoter followed by nucleotide (nt) residues 5296 to 7437 of RHDV (isolate AST/89) cDNA, a poly(A) tail of 18 residues, hepatitis delta virus (HDV) antigenome ribozyme (18), and T7 RNA polymerase terminator sequences were cloned (Fig. 2). In vitro transcription of XhoI-digested pRNA2.2T7R with T7 RNA polymerase yielded a 2.2-kb RNA transcript with a nucleotide sequence identical to the authentic subgenomic mRNA of RHDV but lacking the VPg attached to its 5' terminus and having a shorter poly(A) tail of only 18 residues. A 3' truncated synthetic subgenomic RNA, lacking 312 nt residues and the poly(A) tail, was also made by runoff transcription of vector pRNA2.2T7R digested with HindIII (Fig. 2).
|
Gel electrophoresis and protein concentration. RNA was analyzed on 1.2% formaldehyde-agarose gels (21). Sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis was performed as described elsewhere (9). The protein concentration was determined by the Bio-Rad protein assay.
Enzymatic assays.
The poly(A)-dependent oligo(U)-primed
poly(U) polymerase assay was performed as described by Sankar and
Porter (22). Briefly, the reaction was carried out at 30°C
for 60 min in 50-µl samples containing appropriate concentrations of
purified 3Dpol, 50 mM HEPES (pH 8.0), 10 µM UTP, 4 mM
dithiothreitol, 3 mM magnesium acetate, 6 µM zinc chloride, 20 µg
of rifampin ml
1, 3 nmol of oligo(U) nt
1, 7 nmol of poly(A) nt
1, and 2.5 µmol of
[
-32P]UTP (Amersham) (400 Ci/mmol). The in
vitro-synthesized product was precipitated with 10% trichloroacetic
acid after addition of 100 µg of carrier tRNA in 0.2 M sodium
pyrophosphate, collected onto 0.45-µm-pore-size Whatman GF/C filters,
and vacuum dried. The radioactivity on the filters was measured by
using a scintillation counter.
-32P]UTP, and 14 to 28 nM synthetic RHDV
subgenomic RNA. After incubation at 30°C for 60 min, the
reaction mixture was phenol-chloroform extracted and then ethanol
precipitated in the presence of 0.3 M sodium acetate (pH 6.0) and
20 µg of carrier tRNA. The sediments were dissolved in
electrophoresis sample buffer, loaded onto 1.2% formaldehyde-agarose
gels, and electrophoresed at 60 to 70 V. The gels were then dried, and
the in vitro 32P-labeled RNA was detected by
autoradiography.
RNase treatment.
The products synthesized by
3Dpol were treated with 14 µg of RNase A
ml
1 in 0.5 M or 15 mM NaCl for 15 min at room temperature
(8) and analyzed by electrophoresis on 1.2%
formaldehyde-agarose gels as described above.
Northern blot hybridization.
Template synthetic RHDV
subgenomic RNA and the products synthesized from it by
3Dpol in an enzymatic assay similar to that described above
but without [
-32P]UTP were analyzed in parallel tracks
of denaturing agarose gels and transferred onto nylon membranes. After
blotting, hybridization was done at 42°C for 24 h in the
presence of formamide and 32P-labeled RNA transcripts made
in vitro with T7 or T3 RNA polymerases to obtain the positive and
negative probes, respectively. The recombinant transcription vector
contained cDNA sequences representing nt residues 5436 to 7043 from
RHDV, cloned into the EcoRI site of pBluescript
SK+ (Stratagene). After hybridization the filters were
washed at 55°C for 1 h with two changes of 0.1× SSC (150 mM
NaCl, 15 mM sodium citrate)-0.1% SDS and autoradiographed.
| |
RESULTS |
|---|
|
|
|---|
Cloning and enzyme purification. To obtain large quantities of 3Dpol, we used the expression vector pGEX-2T, designed for inducible expression of foreign polypeptides in E. coli as fusion proteins with GST. The protein chimera was purified from bacterial lysates by affinity chromatography using the Bulk GST Purification Module (Pharmacia), and the 3Dpol was then released from GST by proteolysis of the fusion protein as described in Materials and Methods.
After induction with IPTG, a major protein band of about 84 kDa was observed in the extracts corresponding to the cells transformed with the recombinant vector pGEX-3D (Fig. 3, lane 2). The molecular mass of this polypeptide was in the range of that expected for the fusion protein GST-3Dpol. The 84-kDa polypeptide was retained on a glutathione-Sepharose column (Fig. 3, lane 3), supporting further the conclusion that this band was indeed the fusion protein. The 3Dpol moiety was released from the carrier protein by in situ proteolysis of the fusion protein adsorbed onto the glutathione-Sepharose column. The released 3Dpol was washed off the gel slurry, showing the expected molecular mass of 58 kDa (Fig. 3, lane 4). The recombinant polypeptide was almost identical in amino acid sequence to the authentic RHDV 3Dpol, except that it contained three extra amino acid residues (Gly-Ser-Met) at the N terminus.
|
Poly(U) polymerase activity of recombinant RHDV
3Dpol.
As a first step towards establishing an
assay system for the RHDV 3Dpol, we used the
poly(A)-dependent oligo(U)-primed poly(U) polymerase assay, as
described by Sankar and Porter (22). Polymerase activity was
quantified as the rate of incorporation of [
-32P]UTP
into acid-precipitable material in response to a poly(A) template and
an oligo(U) primer. Low concentrations of the purified recombinant
3Dpol exhibited significant poly(U) polymerase activity
that was resistant to rifampin at 20 µg ml
1 (Table
1), an antibiotic which is known to block
the reinitiation of RNA chains by the E. coli
DNA-dependent RNA polymerase holoenzyme. The poly(U) polymerase
activity exhibited by 3Dpol was next characterized with
respect to template and primer requirements for activity. The results
obtained showed that it was completely dependent on the presence of
both oligo(U) and poly(A) in the reaction mixture: omission of either
one resulted in an almost complete loss of activity (Table 1). The
presence of 8 µg of actinomycin D ml
1 did not inhibit
the poly(U) polymerase activity (Table 1).
|
|
RNA-dependent RNA polymerase activity of recombinant RHDV 3Dpol. To determine whether the recombinant enzyme exhibited any RNA polymerase activity, a synthetic RHDV subgenomic RNA, made by in vitro transcription of XhoI-digested plasmid pRNA2.2T7R (see Materials and Methods), was incubated with the purified enzyme in the presence of all four ribonucleoside triphosphates. The RHDV RNA transcribed in vitro differed somewhat from authentic subgenomic RNA in that it lacked VPg at its 5' end and its 3' end had a shorter poly(A) tail of only 18 residues.
The size and quantity of the labeled RNA products synthesized in the absence or presence of increasing amounts of oligo(U) were analyzed by formaldehyde-agarose gel electrophoresis. The major reaction product synthesized in the absence of oligo(U) was an RNA of twice the length (4.4 kb) of the template (Fig. 5, lane 1), indicating that in the presence of an RNA template the enzyme did not have an absolute requirement for oligo(U), in contrast with the results obtained in the poly(U) polymerase assay (Table 1). When increasing amounts of oligo(U) were added to the above reaction mixture, increasing amounts of a template-size product (2.2 kb) were observed together with an equivalent decrease in the 4.4-kb product concentration (Fig. 5, lanes 2 to 6). These data indicate that the replication of RHDV RNA could also be dependent on a preformed primer, as shown for other RNA polymerases (22).
|
|
1) in the presence of 0.5 M NaCl but was degraded when
the salt concentration was lowered to 0.015 M (Fig.
7). These data supported the hypothesis
that most of the 4.4-kb RNA product is double stranded (8)
as the result of the self-complementarity of the newly synthesized
product and the plus-stranded template, both strands being covalently
linked at one end. To investigate further this hypothesis, we have
determined the polarity of the 4.4-kb transcript in a Northern blot
assay. The results showed that the double-length RNA transcript was
recognized by both positive (Fig. 8A,
lane 2) and negative (Fig. 8B, lane 2) probes. The template-size RNA recognized by the negative probe in the reaction mixture (Fig. 8B, lane
2) corresponded to an excess of template RNA, and negative polarity
products of template length were not detected in the absence of the
oligo(U) primer (Fig. 8A, lane 2). These data suggested that under
these experimental conditions, the RHDV 3Dpol synthesized
double-size transcripts in an oligo(U)-independent reaction which
consisted of a newly made minus-strand RNA covalently linked to the
plus-strand RNA template.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
RNA-dependent RNA polymerases are unique to viruses, and there are no known homologs in animal cells; therefore, this class of enzyme is an interesting target for antiviral chemotherapy. On the other hand, from an evolutionary point of view RNA-dependent RNA polymerases were probably among the first enzymes, and it would be interesting to see how their structure and function have evolved.
Studies on the replication of caliciviruses have lagged behind the advances made with picornaviruses, despite the fact that some of them can be propagated readily in tissue culture cells (2). In the case of RHDV, the lack of a cell system to propagate this pathogen impeded studies of this type and made recombinant DNA technology an essential approach for the characterization of viral functions.
The extensive sequence similarities between the RNA-dependent RNA 3Dpol of picornavirus and the recently described RHDV polyprotein cleavage product p58 (24) suggested that this polypeptide might have a similar role in RHDV genome replication. However, a direct demonstration of polymerase activity associated with this polypeptide has not been made.
The purpose of this work was to develop a system for heterologous expression of the RHDV p58 coding region for functional studies. Using a GST-based vector, we have achieved high-level expression of the fusion protein and purified the recombinant polypeptide to near homogeneity after thrombin cleavage of the fusion protein. The recombinant p58 was designed to be identical in sequence to the RHDV native enzyme; nevertheless, it contained three extra amino acid residues (Gly-Ser-Met) at the N terminus as a consequence of the expression strategy used. The fact that 3Dpol activity was present in a recombinant polypeptide, not generated as the result of cleavage of a polyprotein, suggested that the enzyme did not need to be generated from a precursor to fold into an active conformation. Furthermore, a prokaryotic system was also able to produce a functional enzyme, indicating that eukaryotic posttranslational modifications were not essential for 3Dpol activity. These data agreed with similar results reported for poliovirus and EMC virus replicases (19, 22).
Considering that RHDV minus-strand synthesis might involve poly(U) synthesis as a first step, we assayed the recombinant enzyme for poly(A)-dependent poly(U) polymerase activity. As expected, the recombinant 3Dpol showed a poly(U) polymerase activity, which was dependent on both oligo(U) and poly(A) and which was not inhibited by rifampin or by actinomycin D. The requirements for primer and template ruled out the possibility that the observed activity was due to a terminal transferase-like reaction. These results agreed with those found for other RNA-dependent RNA polymerases of members of the picornavirus superfamily of positive-sense single-stranded RNA viruses: poliovirus (4, 19), EMC virus (22), and potyvirus (7). Furthermore, we have also found that at high concentrations, the oligo(U) primer saturated the enzyme.
In order to investigate the ability of purified recombinant 3Dpol to transcribe RHDV RNA in an in vitro system, we produced a synthetic RNA template from a DNA plasmid which directed the transcription of RHDV subgenomic RNA. This plasmid contained a full-length cDNA of RHDV subgenomic message, inserted between a promoter site for bacteriophage T7 RNA polymerase and a cDNA copy of the self-cleaving HDV antigenome ribozyme (18). On addition of T7 RNA polymerase such plasmid made RNA transcripts which, after autolytic cleavage, yielded a 2.2-kb RNA transcript with a nucleotide sequence identical to that of the authentic subgenomic mRNA of RHDV, lacking the VPg attached to its 5' terminus and having a shorter poly(A) tail of only 18 residues. It should be stated at this point that this RNA is coterminal to the 3' end of the RHDV genome and its 5' untranslated region is very similar to the one found in the virus genome. Considering these structural features, this synthetic RNA template would also mimic a viral genome of reduced size, and the results obtained with this template might be predictably similar to the ones obtained with the authentic genomic RNA. This system has the additional advantages of avoiding experimental animal infections to purify RHDV virions and producing good yields of a highly purified and homogeneous RNA template.
In the presence of the full-length synthetic RHDV subgenomic RNA, the recombinant 3Dpol synthesized template-size products from an oligo(U) primer. Nevertheless, the enzyme produced RNA molecules up to twice the size of the template, in the absence of oligo(U). Several authors have reported the synthesis of double-length product RNA by poliovirus RNA-dependent RNA polymerase in host factor-dependent reactions (5, 26) and in the absence of primer or eukaryotic host factors (19). The omission of ATP, CTP, or GTP from the reaction mixture completely abolished polymerase activity (data not shown). This result was consistent with the activity of a template-dependent RNA polymerase activity and not with a terminal transferase-like reaction. The enzyme activity was also dependent on the addition of Mg2+ and was inhibited by EDTA (data not shown), as described for poliovirus 3Dpol (14) and EMC virus 3Dpol (22).
The observation that the product RNA, in the absence of oligo(U), was twice the size of the template RNA suggested that a covalent linkage existed between the product RNA and the template. The products made in the absence of oligo(U) might derive from internal hairpins, as described in the poliovirus literature, or by priming at the extreme 3' end of the template, resulting in a self-complementary double-stranded product. Although no sequence analysis was performed to test priming at the 3' terminus of the template, this can be deduced from the results obtained in the presence of oligo(U) with both types of template RNA (Fig. 5). It can be seen that most of the 4.4-kb product formed from the 2.2-kb template RNA (Fig. 5, lane 1) is replaced by template-length product (Fig. 5, lanes 2 to 6) in the presence of increasing amounts of oligo(U). That this effect of oligo(U) is sequence specific and occurred at the 3' end can be deduced from the lack of competitive effect of increasing oligo(U) concentrations on the 3' truncated template (Fig. 5, lanes 8 to 11). Moreover, priming from more internal hairpins should yield products ranging from template length to twice the template length. If a significant amount of these products were formed, then additional bands of intermediate size should be observed.
The results obtained after treatment of the 4.4-kb product with RNase A showed that this RNA was in fact double stranded. Moreover, the Northern blot experiments indicated that this RNA was made of a positive (template sense) strand and a negative strand covalently linked.
The mechanism involved in the generation of these dimer-length products is not known, nor is it known whether such template-primed products represent intermediates of the normal replication reaction or whether they are aberrant products of the in vitro reaction or the recombinant enzyme used.
In poliovirus, nucleolytic activation of poliovirus RNA templates appeared to be responsible for the host factor-mediated synthesis observed. Other authors (6) showed that a host factor preparation that contained a low-level nuclease (and possibly a 3' phosphatase) was sufficient to activate RNA templates for transcription by 3Dpol to generate dimer-length products. Since the reaction mixture used in this work did not contain added host factors, a putative nuclease activity could also be related to the recombinant 3Dpol.
An alternative explanation for the synthesis of double-length products is that the 3Dpol may stabilize a small hairpin structure at the 3' end of the template RNA or hold the 3' end of a second molecule of RNA in position so that it can function as a primer. In this model, it is assumed that the primer nucleotide is held by the recombinant enzyme itself and not by conventional base pairing. This model would also explain why the largest product RNA was twice the size of the template RNA and contained a snapback sequence.
We have also found that recombinant RHDV 3Dpol can also act on nonviral RNA templates, such as the luciferase mRNA, yielding double-length RNA products in the absence of an oligo(U) primer as described for poliovirus replicase (23).
If RHDV RNA synthesized in vivo by the polymerase is covalently linked to the template RNA or to another RNA that was used as a primer, then a mechanism must exist for specifically processing the linkage between the product RNA and the priming RNA. Tobin et al. (23) showed that the VPg linkage reaction in poliovirus was very specific for template-linked minus-strand RNA synthesized by the polymerase and host factor on poliovirion RNA. In their current model the VPg attaches covalently to poliovirus RNA by a transesterification reaction. The nucleophilic attack by VPg appears to take place at the terminal hairpin promoting a breakage of a phosphodiester bond in the RNA and a formation of a new phosphodiester bond between VPg and the product RNA. A similar replication intermediate formed on nonviral polyadenylated RNA was not active in the VPg linkage reaction. It has been suggested that the VPg linkage reaction would serve two functions: the separation of the covalently linked template and product RNAs and the linkage of VPg to minus-strand RNA. A similar role could also be true for RHDV VPg.
Additional work is required to further characterize the structure of the template-linked products synthesized in vitro and the mechanism by which the double-length RNA is made. It must also be determined whether covalently linked products are synthesized on negative-strand RNA templates. This should help us to understand the molecular mechanism involved in the replication of RHDV RNA and the function of the viral and cellular proteins required for this process.
The availability of purified RHDV RNA polymerase will also allow us to map the functional domains of this unique enzyme and determine its relatedness to the DNA-dependent RNA polymerases and reverse transcriptases. Because the GST expression system has allowed the purification of milligram quantities of RHDV 3Dpol, efforts to crystallize this enzyme and solve its structure can also be attempted.
| |
ACKNOWLEDGMENTS |
|---|
We thank L. A. Ball from the Department of Microbiology, University of Alabama (Birmingham), for providing a plasmid containing the HDV antigenome ribozyme sequence.
This work was supported by grants BIO96-1172-CO2-O2 and PB96-0552-CO2-O1. A.L.V. and R.C. are recipients of fellowships from Fundación Ramón Areces and FICYT, respectively.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Departamento de Bioquímica y Biología Molecular, Instituto Universitario de Biotecnología de Asturias, Universidad de Oviedo, 33006 Oviedo, Spain. Phone: 34-8-5103563. Fax: 34-8-5103157. E-mail: parra{at}biosun.quimica.uniovi.es.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Boniotti, B.,
C. Wirblich,
M. Sibilia,
G. Meyers,
H. J. Thiel, and C. Rossi.
1994.
Identification and characterization of a 3C-like protease from rabbit hemorrhagic disease virus, a calicivirus.
J. Virol.
68:6487-6495 |
| 2. | Clarke, I. N., and P. R. Lambden. 1997. The molecular biology of caliciviruses. J. Gen. Virol. 78:291-301[Medline]. |
| 3. | Cubbit, D., D. W. Bradley, M. J. Carter, S. Chiba, M. K. Estes, L. J. Saif, F. L. Schaffer, A. W. Smith, M. J. Studdert, and H. J. Thiel. 1995. Family Caliciviridae. Arch. Virol. 10(Suppl.):359-363. |
| 4. |
Flanegan, J. B., and D. Baltimore.
1977.
Poliovirus-specific primer-dependent RNA polymerase able to copy poly(A).
Proc. Natl. Acad. Sci. USA
74:3677-3680 |
| 5. |
Hey, T. D.,
O. C. Richards, and E. Ehrenfeld.
1986.
Synthesis of plus- and minus-strand RNA from poliovirion RNA template in vitro.
J. Virol.
58:790-796 |
| 6. |
Hey, T. D.,
O. C. Richards, and E. Ehrenfeld.
1987.
Host factor-induced template modification during synthesis of poliovirus RNA in vitro.
J. Virol.
61:802-811 |
| 7. | Hong, H., and A. G. Hunt. 1996. RNA polymerase activity catalyzed by a potyvirus-encoded RNA-dependent RNA polymerase. Virology 226:146-151[Medline]. |
| 8. | Hull, R. 1985. Purification, biophysical and biochemical characterization of viruses with especial reference to plant viruses, p. 1-24. In B. W. J. Mahy (ed.), Virology, a practical approach. IRL Press, Oxford, United Kingdom. |
| 9. | Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (London) 227:680-685[Medline]. |
| 10. |
Lubinski, J. M.,
L. J. Ransone, and A. Dasgupta.
1987.
Primer-dependent synthesis of covalently linked dimeric RNA molecules by poliovirus replicase.
J. Virol.
61:2997-3003 |
| 11. | Martín Alonso, J. M., R. Casais, J. A. Boga, and F. Parra. 1996. Processing of rabbit hemorrhagic disease virus polyprotein. J. Virol. 70:1261-1265[Abstract]. |
| 12. | Meyers, G., C. Wirblich, and H. J. Thiel. 1991. Rabbit hemorrhagic disease virus: molecular cloning and nucleotide sequencing of a calicivirus genome. Virology 184:664-676[Medline]. |
| 13. | Meyers, G., C. Wirblich, and H. J. Thiel. 1991. Genomic and subgenomic RNAs of rabbit hemorrhagic disease virus are both protein linked and packaged into particles. Virology 184:677-686[Medline]. |
| 14. |
Morrow, C. D.,
B. Warren, and M. R. Lentz.
1987.
Expression of enzymatically active poliovirus RNA-dependent RNA polymerase in Escherichia coli.
Proc. Natl. Acad. Sci. USA
84:6050-6054 |
| 15. |
Neufeld, K. L.,
O. C. Richards, and E. Ehrenfeld.
1991.
Purification, characterization, and comparison of poliovirus RNA polymerase from native and recombinant sources.
J. Biol. Chem.
266:24212-24219 |
| 16. |
Ohlinger, V. F.,
B. Haas,
G. Meyers,
F. Weiland, and H. J. Thiel.
1990.
Identification and characterization of the virus causing rabbit hemorrhagic disease.
J. Virol.
64:3331-3336 |
| 17. |
Parra, F., and M. Prieto.
1990.
Purification and characterization of a calicivirus as the causative agent of a lethal hemorrhagic disease in rabbits.
J. Virol.
64:4013-4015 |
| 18. | Perrotta, A. T., and M. D. Been. 1991. A pseudoknot-like structure required for efficient self-cleavage of hepatitis delta virus RNA. Nature (London) 350:434-436[Medline]. |
| 19. |
Plotch, S. J.,
O. Palant, and Y. Gluzman.
1989.
Purification and properties of poliovirus RNA polymerase expressed in Escherichia coli.
J. Virol.
63:216-225 |
| 20. | Rothstein, M. A., O. C. Richards, C. Amin, and E. Ehrenfeld. 1988. Enzymatic activity of poliovirus RNA polymerase synthesized in Escherichia coli from viral cDNA. Virology 164:301-308[Medline]. |
| 21. | Sambrook, J., E. F. Firtsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. |
| 22. |
Sankar, S., and A. G. Porter.
1991.
Expression, purification, and properties of recombinant encephalomyocarditis virus RNA-dependent RNA polymerase.
J. Virol.
65:2993-3000 |
| 23. | Tobin, G. J., D. C. Young, and J. B. Flanegan. 1989. Self-catalyzed linkage of poliovirus terminal protein VPg to poliovirus RNA. Cell 59:511-519[Medline]. |
| 24. | Wirblich, C., H.-J. Thiel, and G. Meyers. 1996. Genetic map of the calicivirus rabbit hemorrhagic disease virus as deduced from in vitro translation studies. J. Virol. 70:7974-7983[Abstract]. |
| 25. | Wirblich, C., M. Sibilia, B. Boniotti, C. Rossi, H. J. Thiel, and G. Meyers. 1995. 3C-like protease of rabbit hemorrhagic disease virus: identification of cleavage sites in the ORF1 polyprotein and analysis of cleavage specificity. J. Virol. 69:7159-7168[Abstract]. |
| 26. |
Young, D. C.,
D. M. Tuschall, and J. B. Flanegan.
1985.
Poliovirus RNA-dependent RNA polymerase and host cell protein synthesize product RNA twice the size of poliovirion RNA in vitro.
J. Virol.
54:256-264 |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»