Previous Article | Next Article 
J Virol, April 1998, p. 2991-2998, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
In Vitro Transcription of pe38/Polyhedrin Hybrid
Promoters Reveals Sequences Essential for Recognition by the
Baculovirus-Induced RNA Polymerase and for the Strength of Very Late
Viral Promoters
Ruud M. W.
Mans and
Dagmar
Knebel-Mörsdorf*
Institute of Genetics, University of Cologne,
D-50931 Cologne, Germany
Received 25 August 1997/Accepted 23 December 1997
 |
ABSTRACT |
In vitro transcription was used to analyze the promoter specificity
of the
-amanitin-resistant RNA polymerase that is induced late
during infection of Autographa californica multicapsid
nuclear polyhedrosis virus. By modifying the preparation of crude
nuclear extracts, we have established an assay that permits
differentiation between weak late and strong very late viral promoters.
The virus-induced RNA polymerase initiates at a TAAG sequence motif in
both late and very late promoters. Based on the sensitivity of our in
vitro transcription system, we have investigated the sequences
responsible for a functional TAAG motif and their putative role with
respect to the strength of very late promoters. By constructing hybrid promoters between the early pe38 and the very late polyhedrin promoters, we demonstrated that the replacement of 7 nucleotides upstream of the nonfunctional TAAG sequences in the pe38 promoter with
the corresponding sequences of the polyhedrin promoter was sufficient
for recognition by the virus-induced RNA polymerase. The strength of
the very late polyhedrin promoter was established after replacing the
5' untranslated sequences of the pe38 promoter by those of the
polyhedrin promoter in addition to the 7 nucleotides upstream of the
TAAG motif.
 |
INTRODUCTION |
The infection cycle of
Autographa californica multicapsid nuclear polyhedrosis
virus (AcMNPV) includes a complex temporally regulated gene
expression cascade and results in the production of two different
infectious forms. Although replication of this DNA virus takes place in
the nucleus, AcMNPV infection induces a novel RNA polymerase
activity that is resistant to
-amanitin (7, 12). It is
not known whether the virus-induced RNA polymerase is virus encoded,
comprising subunits that are divergent from known RNA polymerases, or
is a host complex modified by virus-encoded subunits. The targets of
the virus-induced RNA polymerase are late and very late viral
promoters, while host RNA polymerase II recognizes early promoters (for
reviews, see references 5 and
31). Late and very late promoters differ not only in
the temporal appearance of their activity but also in promoter
strength. The promoters of the very late genes polyhedrin and p10 are
much stronger than those of late genes, resulting in abundant protein expression. How the virus-induced RNA polymerase contributes to the
hyperexpression of the p10 and polyhedrin genes is still under investigation.
Transcriptional initiation at late and very late promoters occurs
within a conserved TAAG sequence motif (35). Mutagenesis studies of the polyhedrin and p10 promoters demonstrate that upstream sequences have only a minor effect on activity whereas any mutations in
the TAAG sequence abolish transcriptional initiation (26, 30, 32,
34, 43, 44). In addition, mutations in the adenine- and
thymine-rich sequences downstream of the TAAG motif result in dramatic
reduction of transcription. In contrast to strong very late promoter
activity, weak late expression can be sufficiently directed by a TAAG
sequence motif (13, 28).
The differential regulation of late and very late promoters has been
analyzed in vivo and in vitro. Transient-expression studies indicate
that 18 genes of AcMNPV are able to transactivate the late
promoters vp39 and p6.9 (39, 40). An additional factor, vlf-1 (27), enhances activation only of the very late
promoters p10 and polyhedrin, without affecting the activity of late
promoters (40). It is not known how this factor contributes
to the high transcriptional efficiency or whether additional factors
are directly involved in the regulation of late and very late
promoters.
As an alternative, in vitro transcription systems were established to
identify the factors involved in baculovirus early- and late-gene
expression. These in vitro systems are based on crude nuclear extracts
(10, 45) or fractionated nuclear extracts (3)
from infected Spodoptera frugiperda cells, which support the
transcription of early, late, and very late genes. To accelerate the
analysis of late and very late in vitro-transcribed RNAs, cytidine-free
cassettes were introduced (45), although the high transcriptional efficiency of very late promoters observed in vivo
could not be mimicked in vitro.
We have introduced a modification in the extract preparation that leads
to crude nuclear protein extracts capable of faithful in vitro
transcription of baculovirus very late genes, which allows the
distinction between late and very late promoters based on promoter
strength. Our assay was a prerequisite for determining the promoter
specificity of the virus-induced RNA polymerase in more detail.
Transcriptional initiation at TAAG sequences implies the recognition of
a rather short consensus site by the virus-induced RNA polymerase,
which in turn leads to the question of how AcMNPV accomplishes the recognition of functional versus nonfunctional TAAG
motifs on its genome of 133,894 bp (1). One mechanism is
selection against TAAG sequences; instead of 1,410 statistically expected motifs, only 397 are present (1). Indeed,
additional mechanisms might account for the initiation at distinct TAAG
motifs. The analysis of late-promoter selection in the
AcMNPV gp64 gene suggests that the immediate context, rather
than the position relative to active TAAG sequence motifs, determines
whether the TAAG sequence serves as transcriptional initiation site
(9). To analyze the role of the immediate context of TAAG
sequences in transcriptional initiation, we have constructed hybrid
promoters between the early pe38 (21) and the very late
polyhedrin promoters. Close to the early transcriptional start, the
pe38 promoter contains a TAAG motif that is not recognized by the
virus-induced RNA polymerase. By replacing the pe38 flanking sequences
of the TAAG element with those of the polyhedrin promoter, we
demonstrated the conversion of a nonfunctional into a functional TAAG
element. These observations led us to investigate which additional
sequences specify a very late promoter.
 |
MATERIALS AND METHODS |
Cells and viruses.
S. frugiperda IPLB21
(41) cells were grown at 27°C in TC100 medium
(8) supplemented with 10% fetal calf serum. For protein extract preparation, S. frugiperda cells were grown in
suspension culture. Infection with AcMNPV plaque isolate E
(38) was performed in monolayer culture at a multiplicity of
infection of 10 PFU per cell. Time zero was defined as the time when
the inoculum was added to the cells.
Plasmid constructions and oligonucleotides.
Plasmids
pME53-CAT202 (19), pPE38-CAT82 (20), pHE65-CAT474
(2), and pAcp10-CAT (17) were described
previously. The pPE38-CAT57 plasmid was generated by insertion of the
oligonucleotide comprising 57 bp of the pe38 promoter into the
SalI-XhoI sites of pBLCAT3 (23). This
promoter construct contains 18 bp upstream and 39 bp downstream of the
transcriptional start site. Plasmid pph-CAT101 was constructed by
inserting the polyhedrin promoter into the
PstI-BglII sites of pBLCAT3. The promoter
fragment was generated by PCR amplification with plasmid pAc-EcoH
(22) as the template and the following primers carrying
BglII and PstI sites, respectively:
5'TTTTCTGCAGGTTGCTGATATC3' and
5'GGGGAGATCTCCGGCATATTTATAG3'. The resulting fragment
contains 101 nucleotides upstream of the polyhedrin initiation codon,
which is in frame with the chloramphenicol acetyltransferase (CAT)
gene.
Plasmids containing pe38/polyhedrin hybrid promoters (see Fig. 4) were
all constructed by inserting various oligonucleotides into the
XbaI-XhoI sites of pBLCAT3. Oligonucleotides were
synthesized on an Applied Biosystems 381 A DNA synthesizer. After
oligonucleotides were heated at 95°C for 3 min, complementary pairs
were annealed for 25 min each at 60 and 37°C and then inserted into
the vector. The resulting plasmids, pPE38muTAAG/FR, pPE38muTAAG/R,
and pPE38muTAAG/F, carry promoter fragments that are identical in their
5' and 3' sequences and correspond to those of plasmid
pPE38-CAT82 (see Fig. 4). The promoter fragments in plasmids
pPE38muTAAG/F-ph, pPE38muTAAG/FR-ph, pPE38muTAAG/R-ph,
pPE38muTAAG/F-ph/IRM, and pPE38muTAAG/F-ph/IRC have the same 5'
sequences as the pe38 promoter in plasmid pPE38-CAT82 and the same 3'
sequences as the polyhedrin promoter in pph-CAT101 (see Fig. 4). The
hybrid promoter constructs were named as follows: constructs are based
on the pe38 promoter with mutations in the TAAG box of 18 bp
(PE38muTAAG); 7 bp in front (F) and 5 bp in the rear (R) of the TAAG
motif are replaced by those of the polyhedrin promoter; in addition to
F and R mutations, the 5' untranslated sequences of the pe38 promoter
have been replaced by those of the polyhedrin promoter (ph); the
inverted repeat in the 5' untranslated region (UTR) of the polyhedrin
promoter has been mutated (IRM) or the mutated inverted repeat has been restored by complementing mutations (IRC).
The sequence of each promoter construct was verified by sequence
analysis with an Applied Biosystems 373A DNA sequencer.
Preparation of nuclear extracts.
Crude nuclear extracts from
uninfected S. frugiperda cells were prepared as described
previously (20). To prepare nuclear extracts of infected
S. frugiperda cells, nuclei were purified more extensively
before their lysis, as described initially by Gorski et al.
(11) for tissue-specific transcription from the mouse
albumin promoter. We have adapted the method for nuclei of infected
S. frugiperda cells as follows: 8 × 108
cells grown in spinner cultures were harvested at various times after
infection and resuspended in a hypotonic buffer (10 mM HEPES [pH
8.3], 25 mM KCl, 0.15 mM spermine, 0.5 mM spermidine, 1 mM EDTA, 2 M
sucrose, 10% glycerol) in a twofold volume of the packed cells. The
cells were broken by homogenization in a glass Dounce homogenizer
(L-pestle). The homogenate was layered over a 0.5-ml cushion of the
same buffer and centrifuged at 25,000 rpm for 30 min at 4°C in a
Beckman SW60 rotor (11). The nuclei, which accumulated on
top of the cushion, were resuspended in 1 ml of the hypotonic buffer,
again in the Dounce homogenizer. This homogenate was centrifuged under
the same conditions as described above. The nuclear fraction was
resuspended in 4 volumes of nuclear extraction buffer [15 mM HEPES (pH
8.3), 105 mM KCl, 4.4 mM MgCl2, 0.01 mM EDTA, 0.01 mM
dithioerythreitol, 1 mM phenylmethylsulfonyl fluoride, 2.9 KIU of
aprotinin per ml, 340 mM
(NH4)2SO4]. The nuclei were lysed by stirring for 30 min at 4°C, and the lysate was centrifuged at
40,000 rpm in a Beckman TLS-55 rotor for 60 min at 4°C. The supernatant was dialyzed against 40 mM KCl-10 mM Tris HCl (pH 8)-0.1
mM EDTA-1 mM dithiothreitol-10% glycerol for 4 h. The protein yield was usually 2.5 µg/µl. The aliquots were frozen in liquid N2 and stored at
70°C.
In vitro transcription assay.
The conditions for in vitro
reactions, including pH, temperature, and salt requirements, were as
described previously (10). However, preincubation was not
performed for early, or late, or very late promoters, since it did not
influence the efficiency of transcription under our conditions. The
optimal DNA template concentration was 4 nM. The optimal protein
concentration was determined for each extract made, ranging between 0.6 and 1.2 µg/µl.
Transcriptional analysis.
The 5' ends of the in
vitro-transcribed RNAs were mapped by primer extension analyses as
previously described (2) with the CAT-specific primer
5'GCCATTGGGATATATCAACGGTGGTATATCC3'. The extended products
were analyzed on 8% polyacrylamide-7 M urea gels, and were quantified
by a bioimaging analyzer system (FUJIX BAS 1000, version 3.0).
 |
RESULTS |
Experimental design.
We have addressed the question of how the
virus-induced RNA polymerase distinguishes functional from
nonfunctional TAAG motifs and subsequently differentiates between late
and very late promoters by constructing hybrid promoters whose activity
was tested in vitro. Although recent studies demonstrated that late and
very late promoters can be transcribed in vitro by crude nuclear
extracts (10, 45), the transcriptional activity
detected did not reflect the strength of the very late promoters
observed in vivo. Therefore, we have initially optimized the in vitro
transcription system to differentiate between late and very late
promoters.
In vitro transcription assay for late and very late promoters.
To optimize the in vitro assay for late transcription, we chose an
early/late promoter unit such as the me53 promoter as the template for
early and late transcription and the p10 promoter as the template for
very late transcription. Previous experiments demonstrated both early
and late me53 transcriptional start sites after infection of S. frugiperda and TN-368 cells (18), suggesting that the
me53 promoter serves as a target for both host- and virus-induced RNA
polymerases. In vitro transcription was performed with crude nuclear
extracts of S. frugiperda cells and plasmids pME53-CAT202 and pAcp10-CAT containing the me53 and p10 promoters, respectively; this step was followed by primer extension analysis. The extended products of 143 and 183 nucleotides (nt) represent early and late me53
transcription, respectively (Fig. 1), and
the 357-nt products reflect p10 very late transcription (Fig.
2).

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 1.
In vitro transcription of the early/late me53 promoter.
(a) Nuclear extracts of uninfected (lanes u) or
AcMNPV-infected S. frugiperda cells prepared at
3, 9, 15, and 24 h p.i. (lanes 3, 9, 15, and 24) by the method of
Krappa et al. (20) were used for in vitro transcription.
Plasmid pME53-CAT202 was used as the template (lanes +). As negative
control, the DNA template was omitted (lanes ). Transcripts were
analyzed by primer extension with a 31-mer CAT-specific primer. The
extended products of 143 and 183 nt represent the early and late me53
transcriptional start sites, respectively. (b) In vitro transcription
was performed in extracts of uninfected cells (lanes u), in extracts
prepared from cells at 15 h p.i. by the method of Krappa et al.
(20) [lanes 15 (P)], or in extracts prepared from cells at
18 h p.i. by the method of Gorski et al. (11) [lanes
18(G)]. The absence ( ) or presence (+) of 2.5 µg of -amanitin
( -ama) per ml is indicated below the autoradiogram. Positions of DNA
size markers (lanes M) are shown on the right. ORF, open reading frame.
The localization of the extended products and the corresponding start
sites are shown below.
|
|

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 2.
In vitro transcription of the very late p10 promoter.
Plasmid pAcp10-CAT was used as template for in vitro transcription in
nuclear extracts of the vertebrate cell lines HeLa and BHK and of
uninfected (lanes u) or AcMNPV-infected S. frugiperda cells prepared at 20 h p.i. (lanes 20) and 40 h p.i. (lanes 40). Nuclear extracts of uninfected and
AcMNPV-infected cells were prepared by the method of Gorski
et al. (11). In vitro transcription with extracts of
uninfected cells was performed in the presence of 6 mM Mg2+
and with extracts of infected cells in the presence of either 6 mM
Mg2+ or 2.5 mM Mn2+; -amanitin (2.5 µg/ml)
was added to each reaction mixture. The extended products of 357 nt
represent the very late p10 transcriptional start. Positions of DNA
size markers (lane M) are shown on the right. ORF, open reading frame.
The localization of the extended product and the corresponding start
site are shown below.
|
|
Early me53 transcription was very efficiently supported by nuclear
extracts of uninfected cells and by nuclear extracts prepared
from
cells at 3 h postinfection (p.i.) (Fig.
1a), as described
by
Krappa et al. (
20). A decrease in transcription was observed
in extracts prepared from cells at 9, 15, and 24 h p.i. (Fig.
1a),
which corresponds to the decrease of early me53 transcription
during
the course of infection (
18). However, late me53
transcription
was not detectable in nuclear extracts prepared at 15 and
24 h
p.i. (Fig.
1a). Since changing a variety of reaction
conditions
did not improve late transcription, we changed the procedure
used
to prepare the nuclear extracts. After addition of a step to
purify
the nuclei, crude nuclear extracts prepared at 18 h p.i.
recognized
the late me53 start site and still supported early
transcription
(Fig.
1b). Addition of

-amanitin abolished the
accumulation of
the early transcript but did not inhibit late
transcription (Fig.
1b), which indicated that the late promoter is
recognized by the
virus-induced RNA polymerase in the optimized crude
nuclear extracts.
To test whether the strong increase in transcription of very late
promoters can also be supported by the optimized nuclear
extracts, the
p10 and polyhedrin promoters were transcribed in
vitro. The
transcriptional activity of the p10 gene increases
dramatically in vivo
from 24 to 48 h p.i. (
30,
37). We have
analyzed the
increase in transcriptional efficiency in vitro by
comparing nuclear
extracts prepared from cells at 20 and 40 h
p.i. As expected, p10
transcription was not supported by extracts
from uninfected insect
(
S. frugiperda) and mammalian (HeLa and
BHK) cell lines
(Fig.
2). Weak p10 transcription was observed
in extracts prepared from
cells at 20 h p.i., while extracts isolated
at 40 h p.i. gave
rise to very high p10 transcriptional activity,
showing a more than
50-fold stimulation (Fig.
2). Similar results
were obtained for the
polyhedrin promoter (Fig.
3). As a
control,
late me53 transcription was tested in extracts prepared from
cells
at 20 and 40 h p.i., demonstrating no increase of
transcriptional
activity in extracts isolated at 40 h p.i. (data
not shown). Therefore,
our in vitro system reflects the transcriptional
burst of the
p10 and polyhedrin promoters which is observed in vivo
during
the very late phase of infection. We also investigated the
requirement
of the virus-induced RNA polymerase for divalent cations,
since
differences from the requirements of the host polymerase have
been observed in vivo (
7) and in vitro (
10). Our
results
confirmed the preference of the virus-induced RNA polymerase
for
low concentrations of Mg
2+ or Mn
2+ in vitro
(Fig.
2), indicating that the nature of the divalent
cations does not
seem to be particularly important (data not shown).

View larger version (52K):
[in this window]
[in a new window]
|
FIG. 3.
In vitro transcription of the very late polyhedrin
promoter in comparison to early pe38 and he65 transcription. Plasmids
pph-CAT101, pPE38-CAT82, and pHE65-CAT474 were used as templates for in
vitro transcription in nuclear extracts of uninfected S. frugiperda cells (lanes u) or AcMNPV-infected S. frugiperda cells prepared at 20 h p.i. (lanes 20) and 44 h p.i. (lanes 44) by the method of Gorski et al. (11). In
vitro transcription reactions were performed in the presence (lanes +)
or absence (lanes ) of -amanitin ( -ama) (2.5 µg/ml). The
extended products of 160 nt represent the very late polyhedrin
transcriptional start site, and 132 nt and 145/142 nt represent the
early pe38 and he65 start sites, respectively. Positions of DNA size
markers (lane M) are shown on the right. ORF, open reading frame. The
localization of the extended product and the corresponding start site
are shown below.
|
|
Functional and nonfunctional TAAG sequence motifs in
transcriptional initiation by the virus-induced RNA polymerase.
In
late and very late promoters, TAAG sequence motifs from the core of
transcriptional start sites recognized by the virus-induced RNA
polymerase. In addition to early transcriptional start sites, some
promoters such as the me53 (19) and p35 (29)
promoters carry TAAG sequences which can be recognized by the
virus-induced RNA polymerase while others such as the ie2
(6), pe38 (21), and he65 (2) promoters
include TAAG sequences that are nonfunctional during the late phase of
infection (Table 1). To analyze whether these TAAG sequences indeed do not serve as recognition sites of the
virus-induced RNA polymerase, we performed in vitro transcription assays with our optimized nuclear extracts and with plasmids
pPE38-CAT82 and pHE65-CAT474 as templates, followed by primer extension
analysis. The extended products of 132 and 142 nt represent the early
pe38 and he65 transcripts, respectively, which were abundant when
extracts were prepared from uninfected cells and weakly present in
extracts prepared from cells at 20 or 44 h p.i. (Fig. 3). In the
presence of
-amanitin, the extended products disappeared (Fig. 3),
confirming that the pe38 and he65 promoters were not recognized by the
virus-induced RNA polymerase. As a control, strong transcription of the
polyhedrin promoter in extracts prepared from cells at 44 h p.i.
is shown in the presence of
-amanitin (Fig. 3).
These observations prompt the question of how the virus-induced RNA
polymerase differentiates between functional and nonfunctional
TAAG
sequence motifs. Previous results demonstrate that a synthetic
promoter
of 18 bp containing the TAAG sequence motif is sufficient
to direct
late transcription (
28). Since these results suggest
that
only the adjacent flanking sequences of the TAAG motif are
essential
for recognition by the virus-induced RNA polymerase,
we compared
sequences flanking functional and nonfunctional TAAG
sequences. The
remarkable difference in AT richness led us to
calculate the helix
stability of the flanking 8 and 6 nt (
36),
which revealed a
correlation between this thermodynamic parameter
and the recognition by
the virus-induced RNA polymerase. The helix
stability was lowest for
the flanking sequences of the TAAG motif
in very late promoters whereas
the corresponding sequences of
nonfunctional TAAG motifs were
characterized by a higher helix
stability (Table
1). These findings
support the view that recognition
by the virus-induced RNA polymerase
depends on a region that facilitates
strand separation. The presence of
such a region is described
for all RNA polymerases (
15,
16,
24,
25), except for RNA
polymerase II, which uses the high energy

-

bond of ATP to open
the initiation site (
42).
Conversion of the early pe38 promoter into a late promoter.
To
confirm that sequences adjacent to the TAAG motif determine whether
TAAG sequences are recognized by the virus-induced RNA polymerase, we
replaced the flanking sequences of the nonfunctional TAAG motif in the
pe38 promoter construct pPE38-CAT82 by those of the functional motif in
the polyhedrin promoter. We chose pPE38-CAT82 as the shortest pe38
promoter construct for the mutation studies, since deletion of the TATA
sequences in plasmid pPE38-CAT57 abolished promoter activity (see Fig.
5). The promoter construct pPE38muTAAG/FR (Fig.
4) was tested by in vitro transcription
and analyzed by primer extension. In extracts prepared from cells at
19 h p.i., the hybrid pe38 promoter was recognized by the
virus-induced RNA polymerase (Fig. 5),
indicating that the sequence replacement converted the nonfunctional
TAAG motif into a functional TAAG motif. Transcriptional initiation
occurred accurately at the 5' end of the TAAG sequence motif (Fig. 5).
Although the sequence replacement affected the early transcriptional
start site in the pe38 promoter (Fig. 4), construct pPE38muTAAG/FR
still served as a target for the host RNA polymerase II in nuclear
extracts of uninfected cells and in nuclear extracts prepared from
cells at 19 h p.i. (Fig. 4 and 5). In contrast to the wild-type
initiation site in construct pPE38-CAT82 (Fig. 4), transcriptional
initiation at the mutated early start site in pPE38muTAAG/FR was
dispersed and 5- to 10-fold less efficient (Fig. 4 and 5). The addition of
-amanitin to nuclear extracts prepared from cells at 19 h p.i. abolished recognition by the host RNA polymerase II and
illustrates that the hybrid pe38 promoter was recognized by the
virus-induced RNA polymerase (Fig. 5). Recognition of the hybrid
promoter by both the host and the virus-induced RNA polymerases might
be the result of either simultaneous recognition or competition for the same template.

View larger version (40K):
[in this window]
[in a new window]
|
FIG. 4.
Schematic representation of the pe38/polyhedrin hybrid
promoter constructs used for in vitro transcription. The putative TATA
motifs and the sequences of the early and late transcriptional start
sites are boxed. The hybrid promoters are followed by the translational
initiation codon of the CAT gene (ATGCAT) or polyhedrin
gene (ATGph). (a) Arrows indicate early (E) and late/very
late (L) transcriptional start sites, and the thickness of the arrows
is proportional to the efficiency of initiation. (b) Arrows represent
the inverted repeats; broken lines indicate the mutated sequences.
|
|

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 5.
In vitro transcription of the hybrid promoter
pPE38muTAAG/FR in comparison to pe38 transcription. Plasmids
pPE38-CAT57 and pPE38-CAT82, containing wild-type pe38 promoter
sequences, and plasmid pPE38muTAAG/FR, containing a pe38/polyhedrin
promoter (Fig. 4), were used as templates for in vitro transcription in
nuclear extracts of uninfected (lanes u) or AcMNPV-infected
S. frugiperda cells prepared at 19 h p.i. (lanes 19) by
the method of Gorski et al. (11). In vitro transcription
reactions were performed in the presence (lanes +) or absence (lanes
) of -amanitin ( -ama) (2.5 µg/ml). The extended products were
analyzed on a 6% polyacrylamide sequencing gel, and the results of the
precise transcriptional mapping are depicted in Fig. 4. The sequencing
ladder of the bottom strand of the pe38 promoter is shown on the
left.
|
|
The importance of the upstream and downstream flanking sequences of the
TAAG motif was further investigated by independently
replacing each of
the flanking sequences in the pe38 promoter
by those of the polyhedrin
promoter. The resulting plasmid pPE38muTAAG/F
contains a 7-bp
polyhedrin sequence upstream of the TAAG motif,
whereas construct
pPE38muTAAG/R contains a 5-bp polyhedrin sequence
downstream of the
TAAG motif (Fig.
4). Both constructs were transcribed
in vitro by
nuclear extracts of uninfected cells (Fig.
6). In
extracts prepared from cells at
20 h p.i., only plasmid pPE38muTAAG/F
was transcribed in the
presence of

-amanitin, indicating that
the flanking sequences
upstream of the TAAG motif are responsible
for the activity of the
virus-induced RNA polymerase (Fig.
6).

View larger version (81K):
[in this window]
[in a new window]
|
FIG. 6.
In vitro transcription of pe38/polyhedrin hybrid
promoters. In vitro transcription of the hybrid promoters
pPE38muTAAG/FR, pPE38muTAAG/F, pPE38muTAAG/R, pPE38muTAAG/F-ph, and
pPE38muTAAG/R-ph was compared to transcription of the wild-type pe38
(pPE38-CAT82) and polyhedrin (pph-CAT101) promoters in extracts of
uninfected cells (u) in the absence of -amanitin ( -ama) or in
extracts of AcMNPV-infected cells prepared at 20 and 40 h p.i. by the method of Gorski et al. (11), in the presence
of -amanitin (+ -ama). The extended products are indicated by
arrowheads and detailed in Fig. 4.
|
|
The accuracy of early transcriptional initiation was retained in
plasmid pPE38muTAAG/F, which contains the authentic early
transcriptional start site. Accordingly, initiation was dispersed
in the constructs pPE38muTAAG/R and pPE38-muTAAG/FR (Fig.
4).
Conversion of the early pe38 promoter into a very late
promoter.
The transcriptional activity of the constructs
pPE38muTAAG/FR and pPE38muTAAG/F was tested in extracts prepared
from cells at 40 h p.i. to analyze whether the flanking sequences
of the TAAG motif have any influence on the transcriptional burst
observed for very late promoters. As shown in Fig. 6, no increase in
transcription was observed when the activity in nuclear extracts
prepared at 20 and 40 h p.i. was compared. These results confirm
previous mutagenesis studies which suggest that additional promoter
elements such as the 5' UTR are needed along with the TAAG sequence
motif for very late expression (34, 35, 37). Hence, we have
replaced the 5' UTR of the pe38 promoter in constructs
pPE38muTAAG/FR and pPE38muTAAG/R by the corresponding sequences of
the polyhedrin promoter, generating plasmids pPE38muTAAG/FR-ph and
pPE38muTAAG/R-ph (Fig. 4). Both constructs differ only in 7 bp upstream
of the TAAG motif. In plasmid pPE38muTAAG/FR-ph, this 7 bp originates from the polyhedrin promoter, and in construct
pPE38muTAAG/R-ph, it originates from the pe38 promoter.
Therefore, the hybrid promoter in pPE38muTAAG/FR-ph consists of a
functional TAAG motif and that in pPE38muTAAG/R-ph consists of a
nonfunctional TAAG motif.
In extracts of uninfected cells or extracts prepared from cells at
20 h p.i., construct pPE38muTAAG/FR-ph was weakly transcribed
in
vitro (Fig.
6). A dramatic increase in transcription was observed
in
nuclear extracts prepared at 40 h p.i. indicating that the
hybrid
promoter in construct pPE38muTAAG/FR-ph functions as a
very late
promoter which can still be recognized rather weakly
by the host RNA
polymerase II. The lack of the polyhedrin sequences
upstream of the
TAAG motif in construct pPE38muTAAG/R-ph abolished
the characteristics
of a very late promoter. The observation that
this construct still
served as a target of the virus-induced RNA
polymerase indicates that a
nonfunctional TAAG motif can be recognized
by the virus-induced RNA
polymerase if the 5' UTR of a very late
promoter is present (Fig.
6).
To support very late transcription,
both the upstream sequences of a
functional TAAG motif and the
5' UTR are essential.
Since we observed that the upstream sequences of a functional TAAG
motif were sufficient for recognition by the virus-induced
RNA
polymerase, we investigated whether mutation of the 5 bp downstream
of
the TAAG motif also had no influence on the transcriptional
burst. To
answer this question, we constructed a hybrid promoter
which was
identical to the one in plasmid pPE38muTAAG/FR-ph except
for the 5 bp
downstream of the TAAG motif, which was replaced
by the sequence from
the pe38 promoter. Accordingly, the resulting
plasmid,
pPE38muTAAG/F-ph, carries a mutation of 5 bp in the 5'
UTR of the
polyhedrin promoter (Fig.
4). In vitro transcription
assays revealed
that the activity of plasmid pPE38muTAAG/F-ph
was comparable to that of
pPE38muTAAG/FR-ph, which indicates that
the 5 bp downstream of the
TAAG motif is not essential for the
transcriptional burst (Fig.
6). The
recognition by the host RNA
polymerase II was less efficient for
plasmid pPE38muTAAG/FR-ph
than for pPE38muTAAG/F-ph, which
carries the authentic early start
site of the pe38 promoter (Fig.
4 and
5).
In comparison to the transcriptional activity of the wild-type
polyhedrin promoter, both hybrid promoter constructs pPE38muTAAG/F-ph
and pPE38muTAAG/FR-ph showed a three- to fivefold decrease in
transcription (Fig.
6 and
7), which might
be due to the absence
of upstream polyhedrin sequences that slightly
enhance the activity
of the promoter (
30,
34).

View larger version (50K):
[in this window]
[in a new window]
|
FIG. 7.
In vitro transcription of pe38/polyhedrin hybrid
promoters in comparison to constructs with mutations in the polyhedrin
5' UTR. Plasmids pPE38-muTAAG/F-ph/IRM and pPE38muTAAG/F-ph/IRC with
mutations in the polyhedrin 5' UTR, the parental construct
pPE38muTAAG/F-ph, pPE38muTAAG/FR-ph, and pph-CAT101 (Fig. 4) were used
as templates for in vitro transcription in nuclear extracts of
AcMNPV-infected cells prepared at 44 h p.i. by the
method of Gorski et al. (11), in the presence of
-amanitin (+ -ama). The extended products are indicated on the
left and detailed in Fig. 4. Positions of DNA size markers (lane M) are
shown on the right.
|
|
Role of mutations in the 5' UTR of the polyhedrin promoter in very
late transcription.
Previous mutagenesis studies of the p10
(43) and polyhedrin (30) promoters suggest that
integrity of the 5' UTR is essential for very late expression. Hence,
we have not progressively mutated the 5' UTR but instead have
investigated whether 5' UTRs of known very late promoters have common
sequence elements or motifs which might play a role in the
transcriptional burst. A previous comparison of polyhedrin promoters
among several baculoviruses showed limited sequence homology and a
structural frame that was reminiscent of RNA polymerase III promoters
(46). Our updated sequence comparison revealed a perfect or
imperfect inverted repeat in the 5' UTR of all known polyhedrin
promoters, which is localized downstream of the TAAG sequence motif
(Fig. 8). The spacing sequence of the inverted repeats is highly conserved, with the general consensus motif
WTYRT always located 12 bp downstream of the TAAG motif (Fig. 8). To
investigate the significance of the inverted repeat for the
transcriptional burst, plasmids pPE38muTAAG/F-ph/IRM and pPE38muTAAG/F-ph/IRC were generated. Both constructs are based on
pPE38muTAAG/F-ph; one contains six mutations that abolish half of the
inverted repeat (pPE38muTAAG/F-ph/IRM), and in the second, the inverted
repeat is restored by complementary mutations
(pPE38muTAAG/F-ph/IRC) (Fig. 4).

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 8.
Alignment of baculovirus polyhedrin sequences. Sequences
downstream of the TAAG motif in the polyhedrin were compared among
baculoviruses. The conserved inverted repeat in the polyhedrin 5' UTR
of AcMNPV (46) (Ac), Bombyx mori NPV
(46) (Bm), Anticarsia gemmatalis MNPV
(46) (Ag), Antheraea pernyi MNPV (M57666) (Ap),
Choristoneura fumiferana NPV (Cf) (33),
Orgyia pseudotsugata MNPV (46) (Opm),
Hyphantria cunea NPV (D14573) (Hc), Mamestra
brassicae MNPV (46) (Mb), Panolis
flammea MNPV (46) (Pf), Spodoptera
exigua MNPV (46) (Se), Spodoptera
frugiperda MNPV (46) (Sf), Buzura
suppressaria SNPV (14) (Bs), Orgyia
pseudotsugata SNPV (Ops), Lymantria dispar
MNPV (46) (Ld), and Spodoptera
littoralis NPV (D01017) (Sl) is indicated by arrows.
|
|
In extracts prepared from cells at 44 h p.i.,
pPE38muTAAG/F-ph/IRM was as strongly transcribed in vitro as
were the constructs
without mutations in the 5' UTR whereas the
transcriptional activity
of pPE38muTAAG/F-ph/IRC was severely reduced
(Fig.
7). These results
indicate that the mutation of the inverted
repeat comprising 12
bp immediately downstream of the TAAG sequences
(Fig.
4) does
not influence transcription in vitro. Only after mutation
of the
second half of the inverted repeat is the transcriptional burst
lost, demonstrating that an inverted repeat per se is not responsible
for the strong transcriptional activity of very late promoters.
 |
DISCUSSION |
In beginning to understand the mechanism of promoter recognition
by the virus-induced RNA polymerase, we have determined promoter elements that are sufficient for transcriptional initiation.
Transcription in vitro is advantageous for these studies because it
allows the definition of the minimal sequences that are necessary to
form the transcriptional complex leading to accurate initiation
independently of sequences that influence proper mRNA polyadenylation,
stability, and transport. By replacing sequences of the pe38 promoter
by those of the very late polyhedrin promoter in a stepwise manner, we
have converted the early pe38 promoter, which serves only as a target
for the host RNA polymerase II, into a target promoter of the
virus-induced RNA polymerase. The replacement of 7 nt upstream of the
nonfunctional TAAG sequence motif in the pe38 promoter by those of the
polyhedrin promoter was sufficient for recognition by the virus-induced
RNA polymerase. These results support our assumption that thermodynamic
stability rather than sequence specificity of nucleotides located
upstream of the TAAG motif might be the deciding factor for its
functionality. Reduced helix stability was found to correlate with
functional TAAG motifs (Table 1), indicating that easier strand
separation might be essential for transcriptional initiation by the
virus-induced RNA polymerase. In addition, a nonfunctional TAAG motif
could be compensated for if the polyhedrin 5' UTR was present. The
finding that recognition by the virus-induced RNA polymerase was
dependent either on 7 bp upstream of the TAAG sequences or on the
presence of the 5' UTR of a very late promoter might explain previous
observations which led to the prediction of an initiator element of
different lengths (30, 34, 35). Based on mutagenesis studies
of the very late p10 and polyhedrin promoters, an initiator of 12 bp (5'AATAAGTATTTT3') (35) and 8 bp
(5'TAAGTATT3') was postulated (30,
34). Furthermore, the use of linker-scanning mutations of the
late vp39 promoter led to the conclusion that an 18-bp promoter,
including 8 bp upstream and 6 bp downstream of the TAAG motif, is
sufficient for late expression (28). Taken together with the
absence of conserved nucleotides upstream of the TAAG in known very
late promoters (Fig. 8), our results derived from the analysis of
hybrid promoters in vitro suggest that recognition is due simply to a
TAAG motif in a sequence background of low helix stability. This rather
simple mode of recognition implies that the virus-induced RNA
polymerase needs less stringent promoter conditions than known nuclear
RNA polymerases.
Transcriptional regulation that leads to hyperexpression of baculovirus
very late genes is still an enigma. Previous studies of the polyhedrin
promoter suggest that the transcriptional burst depends on the entire
5' UTR of 50 bp (30). Here, we have demonstrated that
deletion of 12 bp immediately downstream of the TAAG motif did not
interfere with transcription in vitro. To further dissect the 5' UTR
into functional domains, we searched for common sequence elements among
known baculovirus very late genes and identified an inverted repeat of
different lengths whose spacing sequences are always at the same
position (Fig. 8). Although the sequences of the inverted repeats
showed no significant homology, an inverted repeat per se is not
involved in the regulation of the polyhedrin promoter. The replacement
of the inverted repeat by the complementary sequence resulted in loss
of the transcriptional burst, which was retained if only the first half
of the inverted repeat was mutated. Based on the sensitivity of our
improved in vitro transcription assay, we have provided first evidence
that strong very late transcription is the result of cooperative action
between a functional TAAG motif and only part of the polyhedrin 5' UTR.
 |
ACKNOWLEDGMENTS |
We thank Christiane Zock for providing protein extracts of
BHK21 and HeLa cells and Andrew Barker for critical reading of the
manuscript.
This research was supported by the EC Biotechnology program BIOTECH
(BIO2-CT930457).
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Institut
für Genetik, Universität zu Köln, Weyertal 121, 50931 Cologne, Germany. Phone: 49-221-4703528. Fax: 49-221-4705163. E-mail: d.moersdorf{at}uni-koeln.de.
 |
REFERENCES |
| 1.
|
Ayres, M. D.,
S. C. Howard,
J. Kuzio,
M. Lopez-Ferber, and R. D. Possee.
1994.
The complete DNA sequence of the Autographa californica nuclear polyhedrosis virus.
Virology
202:586-605[Medline].
|
| 2.
|
Becker, D., and D. Knebel-Mörsdorf.
1993.
Sequence and temporal appearance of the early transcribed baculovirus gene HE65.
J. Virol.
67:5867-5872[Abstract/Free Full Text].
|
| 3.
|
Beniya, H.,
C. J. Funk,
G. F. Rohrmann, and R. F. Weaver.
1996.
Purification of a virus-induced RNA polymerase from the Autographa californica nuclear polyhedrosis virus-infected Spodoptera frugiperda cells that accurately initiates late and very late transcription in vitro.
Virology
216:12-19[Medline].
|
| 4.
|
Blissard, G. W.,
P. H. Kogan,
R. Wei, and G. F. Rohrmann.
1992.
A synthetic early promoter from a baculovirus: roles of the TATA box and conserved start site CAGT sequence in basal levels of transcription.
Virology
190:783-793[Medline].
|
| 5.
|
Blissard, G. W., and G. F. Rohrmann.
1990.
Baculovirus diversity and molecular biology.
Annu. Rev. Entomol.
35:127-155[Medline].
|
| 6.
|
Carson, D. D.,
M. D. Summers, and L. A. Guarino.
1991.
Molecular analysis of a baculovirus regulatory gene.
Virology
182:279-286[Medline].
|
| 7.
|
Fuchs, L. Y.,
M. S. Woods, and R. F. Weaver.
1983.
Viral transcription during Autographa californica nuclear polyhedrosis virus infection: a novel RNA polymerase induced in infected Spodoptera frugiperda cells.
J. Virol.
48:641-646[Abstract/Free Full Text].
|
| 8.
|
Gardiner, G. R., and H. Stockdale.
1975.
Two tissue culture media for production of lepidopteran cells and nuclear polyhedrosis viruses.
J. Invertebr. Pathol.
25:363-370.
|
| 9.
|
Garrity, D. B.,
M.-J. Chang, and G. W. Blissard.
1997.
Late promoter selection in the baculovirus gp64 envelope fusion protein gene.
Virology
231:167-181[Medline].
|
| 10.
|
Glocker, B.,
R. R. Hoopes, and G. F. Rohrmann.
1993.
In vitro transcription from baculovirus late gene promoter: accurate mRNA initiation by nuclear extracts prepared from infected Spodoptera frugiperda cells.
J. Virol.
67:3771-3776[Abstract/Free Full Text].
|
| 11.
|
Gorski, K.,
M. Carneiro, and U. Schibler.
1986.
Tissue-specific in vitro transcription from the mouse albumin promoter.
Cell
47:767-776[Medline].
|
| 12.
|
Grula, M. A.,
P. L. Buller, and R. F. Weaver.
1981.
-Amanitin-resistant viral RNA synthesis in nuclei isolated from nuclear polyhedrosis virus-infected Heliothis zea larvae and Spodoptera frugiperda cells.
J. Virol.
38:916-921[Abstract/Free Full Text].
|
| 13.
|
Guarino, L. A., and M. Smith.
1992.
Regulation of delayed-early gene transcription by dual TATA boxes.
J. Virol.
66:3733-3739[Abstract/Free Full Text].
|
| 14.
|
Hu, Z. H.,
M. F. Liu,
F. Jin,
Z. X. Wang,
X. Y. Liu,
M. J. Li,
B. F. Liang, and T. E. Xie.
1993.
Nucleotide sequence of the Buzura suppressaria single nucleocapsid nuclear polyhedrosis virus polyhedrin gene.
J. Gen. Virol.
74:1617-1620[Abstract/Free Full Text].
|
| 15.
|
Jaehning, J. A.
1993.
Mitochondrial transcription: is a pattern emerging?
Mol. Microbiol.
8:1-4[Medline].
|
| 16.
|
Kassavetis, G. A.,
J. A. Blanco,
T. E. Johnson, and E. P. Geiduschek.
1992.
Formation of open and elongating transcription complexes by RNA polymerase III.
J. Mol. Biol.
226:47-58[Medline].
|
| 17.
|
Knebel, D.,
H. Lübbert, and W. Doerfler.
1985.
The promoter of the late p10 gene in the insect nuclear polyhedrosis virus Autographa californica: activation by viral gene products and sensitivity to DNA methylation.
EMBO J.
4:1301-1306[Medline].
|
| 18.
|
Knebel-Mörsdorf, D.,
J. T. M. Flipsen,
R. Roncarati,
F. Jahnel,
A. W. F. Kleefsman, and J. M. Vlak.
1996.
Baculovirus infection of Spodoptera exigua larvae: lacZ expression driven by promoters of early genes pe38 and me53 in larval tissue.
J. Gen. Virol.
77:815-824[Abstract/Free Full Text].
|
| 19.
|
Knebel-Mörsdorf, D.,
A. Kremer, and F. Jahnel.
1993.
Baculovirus gene ME53, which contains a putative zinc finger motif, is one of the major early-transcribed genes.
J. Virol.
67:753-758[Abstract/Free Full Text].
|
| 20.
|
Krappa, R.,
A. Behn-Krappa,
F. Jahnel,
W. Doerfler, and D. Knebel-Mörsdorf.
1992.
Differential factor binding at the promoter of early baculovirus gene PE38 during viral infection: GATA motif is recognized by an insect protein.
J. Virol.
66:3494-3503[Abstract/Free Full Text].
|
| 21.
|
Krappa, R., and D. Knebel-Mörsdorf.
1991.
Identification of the very early transcribed baculovirus gene PE-38.
J. Virol.
65:805-812[Abstract/Free Full Text].
|
| 22.
|
Lübbert, H.,
I. Kruczek,
S. Tjia, and W. Doerfler.
1981.
The cloned EcoRI fragments of Autographa californica nuclear polyhedrosis virus.
Gene
16:343-345[Medline].
|
| 23.
|
Luckow, B., and G. Schütz.
1987.
CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements.
Nucleic Acids Res.
15:5490[Free Full Text].
|
| 24.
|
Margalit, H.,
B. A. Shapiro,
R. Nussinov,
J. Owens, and R. L. Jernigan.
1988.
Helix stability in prokaryotic promoter regions.
Biochemistry
27:5179-5188[Medline].
|
| 25.
|
Marilley, M., and P. Pasero.
1996.
Common DNA structural features exhibited by eukaryotic ribosomal gene promoters.
Nucleic Acids Res.
24:2204-2211[Abstract/Free Full Text].
|
| 26.
|
Matsuura, Y.,
R. D. Possee,
H. A. Overton, and D. H. L. Bishop.
1987.
Baculovirus expression vectors: the requirements for high level expression of proteins, including glycoproteins.
J. Gen. Virol.
68:1233-1250[Abstract/Free Full Text].
|
| 27.
|
McLachlin, J. L., and L. K. Miller.
1994.
Identification and characterization of vlf-1, a baculovirus gene involved in very late gene expression.
J. Virol.
68:7746-7756[Abstract/Free Full Text].
|
| 28.
|
Morris, T. D., and L. K. Miller.
1994.
Mutational analysis of a baculovirus major late promoter.
Gene
140:147-153[Medline].
|
| 29.
|
Nissen, M. S., and P. D. Friesen.
1989.
Molecular analysis of the transcriptional regulatory region of an early baculovirus gene.
J. Virol.
63:493-503[Abstract/Free Full Text].
|
| 30.
|
Ooi, B. G.,
C. Rankin, and L. K. Miller.
1989.
Downstream sequences augment transcription from the essential initiation site of a baculovirus polyhedrin gene.
J. Mol. Biol.
210:721-736[Medline].
|
| 31.
|
O'Reilly, D. R.,
L. K. Miller, and V. A. Luckow.
1994.
.
Baculovirus expression vectors a laboratory manual. W. H.
Freeman & Co., New York, N.Y.
|
| 32.
|
Possee, R. D., and S. C. Howard.
1987.
Analysis of the polyhedrin gene promoter of the Autographa californica nuclear polyhedrosis virus.
Nucleic Acids Res.
15:10233-10248[Abstract/Free Full Text].
|
| 33.
|
Qui, W.,
J. J. Liu, and E. B. Carstens.
1996.
Studies of Choristoneura fumiferana nuclear polyhedrosis virus gene expression in insect cells.
Virology
217:564-572[Medline].
|
| 34.
|
Rankin, C.,
B. G. Ooi, and L. K. Miller.
1988.
Eight base pairs encompassing the transcriptional start point are the major determinant for baculovirus polyhedrin gene expression.
Gene
70:39-49[Medline].
|
| 35.
|
Rohrmann, G. F.
1986.
Polyhedrin structure.
J. Gen. Virol.
67:1499-1513[Abstract/Free Full Text].
|
| 36.
|
SantaLucia, J.,
H. T. Allawi, and P. A. Seneviratne.
1996.
Improved nearest neighbour parameters for predicting DNA duplex stability.
Biochemistry
35:3555-3562[Medline].
|
| 37.
|
Smith, G. E.,
J. M. Vlak, and M. D. Summers.
1983.
Physical analysis of Autographa californica nuclear polyhedrosis virus transcripts for polyhedrin and 10,000-molecular-weight protein.
J. Virol.
45:215-225[Abstract/Free Full Text].
|
| 38.
|
Tjia, S. T.,
E. B. Carstens, and W. Doerfler.
1979.
Infection of Spodoptera frugiperda cells with Autographa californica nuclear polyhedrosis virus.
Virology
180:492-508.
|
| 39.
|
Todd, J. W.,
A. L. Passarelli, and L. K. Miller.
1995.
Eighteen baculovirus genes, including lef-11, p35, 39K, and p47, support late-gene expression.
J. Virol.
69:968-974[Abstract].
|
| 40.
|
Todd, J. W.,
A. L. Passarelli,
A. Lu, and L. K. Miller.
1996.
Factors regulating baculovirus late and very late gene expression in transient-expression assays.
J. Virol.
70:2307-2317[Abstract].
|
| 41.
|
Vaughn, J. L.,
R. H. Goodwin,
G. J. Tompkins, and P. McCawley.
1977.
The establishment of two cell lines from the insect Spodoptera frugiperda.
In Vitro (Rockville)
13:213-217[Medline].
|
| 42.
|
Wang, W.,
M. Carey, and J. D. Gralla.
1992.
Polymerase II promoter activation: closed complex formation and ATP-driven start site opening.
Science
255:450-453[Abstract/Free Full Text].
|
| 43.
|
Weyer, U., and R. D. Possee.
1988.
Functional analysis of the p10 gene 5' leader sequence of the Autographa californica nuclear polyhedrosis virus.
Nucleic Acids Res.
16:3635-3653[Abstract/Free Full Text].
|
| 44.
|
Weyer, U., and R. D. Possee.
1989.
Analysis of the promoter of the Autographa californica nuclear polyhedrosis virus p10 gene.
J. Gen. Virol.
70:203-208[Abstract/Free Full Text].
|
| 45.
|
Xu, B.,
S. Yoo, and L. A. Guarino.
1995.
Differential transcription of baculovirus late and very late promoters: fractionation of nuclear extracts by phosphocellulose chromatography.
J. Virol.
69:2912-2917[Abstract].
|
| 46.
|
Zanotto, P. M.,
M. J. A. Sampaio,
D. W. Johnson,
T. L. Rocha, and J. E. Maruniak.
1992.
The Anticarsia gemmatalis nuclear polyhedrosis virus polyhedrin gene region: sequence analysis, gene product and structural comparisons.
J. Gen. Virol.
73:1049-1056[Abstract/Free Full Text].
|
J Virol, April 1998, p. 2991-2998, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Jiang, S. S., Chang, I-S., Huang, L.-W., Chen, P.-C., Wen, C.-C., Liu, S.-C., Chien, L.-C., Lin, C.-Y., Hsiung, C. A., Juang, J.-L.
(2006). Temporal Transcription Program of Recombinant Autographa californica Multiple Nucleopolyhedrosis Virus.. J. Virol.
80: 8989-8999
[Abstract]
[Full Text]
-
Duffy, S. P., Young, A. M., Morin, B., Lucarotti, C. J., Koop, B. F., Levin, D. B.
(2006). Sequence Analysis and Organization of the Neodiprion abietis Nucleopolyhedrovirus Genome. J. Virol.
80: 6952-6963
[Abstract]
[Full Text]
-
Fujita, R., Matsuyama, T., Yamagishi, J., Sahara, K., Asano, S., Bando, H.
(2006). Expression of Autographa californica Multiple Nucleopolyhedrovirus Genes in Mammalian Cells and Upregulation of the Host {beta}-Actin Gene. J. Virol.
80: 2390-2395
[Abstract]
[Full Text]
-
Mistretta, T.-A., Guarino, L. A.
(2005). Transcriptional Activity of Baculovirus Very Late Factor 1. J. Virol.
79: 1958-1960
[Abstract]
[Full Text]
-
Titterington, J. S., Nun, T. K., Passarelli, A. L.
(2003). Functional dissection of the baculovirus late expression factor-8 gene: sequence requirements for late gene promoter activation. J. Gen. Virol.
84: 1817-1826
[Abstract]
[Full Text]
-
Quadt, I., Mainz, D., Mans, R., Kremer, A., Knebel-Morsdorf, D.
(2002). Baculovirus Infection Raises the Level of TATA-Binding Protein That Colocalizes with Viral DNA Replication Sites. J. Virol.
76: 11123-11127
[Abstract]
[Full Text]
-
Prikhod'ko, E. A., Miller, L. K.
(1999). The Baculovirus PE38 Protein Augments Apoptosis Induced by Transactivator IE1. J. Virol.
73: 6691-6699
[Abstract]
[Full Text]
-
Yang, S., Miller, L. K.
(1999). Activation of Baculovirus Very Late Promoters by Interaction with Very Late Factor 1. J. Virol.
73: 3404-3409
[Abstract]
[Full Text]
-
Guarino, L. A., Jin, J., Dong, W.
(1998). Guanylyltransferase Activity of the LEF-4 Subunit of Baculovirus RNA Polymerase. J. Virol.
72: 10003-10010
[Abstract]
[Full Text]
-
Jin, J., Dong, W., Guarino, L. A.
(1998). The LEF-4 Subunit of Baculovirus RNA Polymerase Has RNA 5'-Triphosphatase and ATPase Activities. J. Virol.
72: 10011-10019
[Abstract]
[Full Text]
-
Guarino, L. A., Xu, B., Jin, J., Dong, W.
(1998). A Virus-Encoded RNA Polymerase Purified from Baculovirus-Infected Cells. J. Virol.
72: 7985-7991
[Abstract]
[Full Text]