Previous Article | Next Article 
J Virol, April 1998, p. 2890-2895, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Impact of Multidideoxynucleoside Resistance-Conferring
Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase
on Polymerase Fidelity and Error Specificity
Lisa F.
Rezende,1
Kenneth
Curr,1
Takamasa
Ueno,2
Hiroaki
Mitsuya,2 and
Vinayaka
R.
Prasad1,*
Department of Microbiology and Immunology,
Albert Einstein College of Medicine, Bronx, New York
10461,1 and
Experimental Retrovirology
Section, National Cancer Institute, National Institutes of Health,
Bethesda, Maryland 208922
Received 3 October 1997/Accepted 19 December 1997
 |
ABSTRACT |
Variants of human immunodeficiency virus type 1 (HIV-1) that are
highly resistant to a number of nucleoside analog drugs have been
shown to develop in some patients receiving
2',3'-dideoxy-3'-azidothymidine therapy in combination with
2',3'-dideoxycytidine or 2',3'-dideoxyinosine. The appearance, in the
reverse transcriptase (RT), of the Q151M mutation in such variants
precedes the sequential appearance of three or four additional
mutations, resulting in a highly resistant virus. Three of the affected
residues are proposed to lie in the vicinity of the template-primer in
the three-dimensional structure of the HIV-1 RT-double-stranded DNA
complex. The amino acid residue Q151 is thought to be very near the
templating base. The nucleoside analog resistance mutations in the
9-
10 (M184V) and the
5a (E89G) strands of HIV-1 RT were
previously shown to increase the fidelity of deoxynucleoside
triphosphate insertion. Therefore, we have examined wild-type
HIV-1BH10 RT and two nucleoside analog-resistant variants,
the Q151M and A62V/V75I/F77L/F116Y/Q151M (VILYM) RTs, for their overall
forward mutation rates in an M13 gapped-duplex assay that utilizes
lacZ
as a reporter. The overall error rates for the
wild-type, the Q151M, and the VILYM RTs were 4.5 × 10
5, 4.0 × 10
5, and 2.3 × 10
5 per nucleotide, respectively. Although the mutant RTs
displayed minimal decreases in the overall error rates compared to
wild-type RT, the error specificities of both mutant RTs were altered.
The Q151M RT mutant generated new hot spots, which were not observed for wild-type HIV-1 RT previously. The VILYM RT showed a marked reduction in error rate at two of the predominant mutational hot spots
that have been observed for wild-type HIV-1 RT.
 |
INTRODUCTION |
Human immunodeficiency virus type 1 (HIV-1) infections are characterized by a high degree of genetic
variation, which inevitably leads to facile generation of
drug-resistant variants during treatment (16, 26). To date,
five nucleoside analogs which target reverse transcriptase (RT) have
been approved for treating infected individuals. Since monotherapies
with each drug culminate in the emergence of resistant mutants,
combinations of two or more drugs are preferred (8, 15,
22). One such combination is 2',3'-dideoxy-3'-azidothymidine (AZT) with either 2',3'-dideoxycytidine (ddC) or
2',3'-dideoxyinosine (ddI) in simultaneous or
sequential therapy (29, 30). However, the emergence of
variant viruses that are resistant to one of the drugs in the regimen,
as well as those that are resistant to multiple nucleoside analogs
(29, 30), has been reported. Chronological studies of
viral variants over an extended period (up to 48 months) revealed
the appearance of a series of five mutations (13, 30). Of
these, the Q151M mutation appears first and alone is sufficient to
confer multidrug resistance to HIV-1, exhibiting a 10-fold increase in
resistance to AZT, a 20-fold increase in resistance to ddC, and a
5-fold increase in resistance to ddI in cell culture virus replication
assays (30). Subsequently, mutations appearing at four other
sites (A62V, V75I, F77L, and F116Y) further increase the level of drug
resistance. Viruses containing all five mutations exhibit up to a
320-fold increase in resistance to AZT, up to a 45-fold increase in
resistance to ddC, and up to a 40-fold increase in resistance to ddI in
cell culture (31). When recombinant purified RTs containing
the Q151M alteration alone or the complete set of five mutations were
studied via biochemical assays, they exhibited high-level resistance to ddATP, ddCTP, ddGTP, ddTTP, and AZT triphosphate (33, 34).
Mutations in RT that result in nucleoside analog resistance are thought
to do so by decreasing the ability to bind and utilize a nucleoside
analog while retaining the ability to utilize deoxynucleoside triphosphate (dNTP) substrates in the polymerization reaction (19,
33, 34). If these mutations affect the geometry of the
dNTP-binding pocket to preferentially utilize the normal dNTP substrate, it is conceivable that the mutations may also impart an
ability to favor the insertion of correctly base-paired dNTPs over
incorrectly base-paired dNTPs. Indeed, it has recently been shown that
the 2',3'-dideoxy-3'-thiacytidine-resistant M184V RT mutant
(11, 21, 35) and the multidrug-resistant E89G
HIV-1 RT mutant (9, 27a) exhibit a significant
increase in nucleotide insertion fidelity over that of the wild-type
enzyme. Mutagenesis and biochemical studies have implicated residue
Q151 of HIV-1 RT in dNTP-binding function (28). Furthermore,
the Q151 residue lies within the LPQG motif that is conserved in RTs
(23). The three-dimensional structure of HIV-1 RT complexed
with double-stranded DNA reveals that the Q151 residue is in a position
to interact with the first nucleotide of the single-stranded
template (30). Additionally, the high-resolution X-ray
structure of a fragment of the Moloney murine leukemia virus RT reveals
that the residue Q190, which is analogous to Q151 of HIV-1 RT,
interacts with the templating base and the incoming dNTP
(12), suggesting that it may determine the fidelity of DNA
synthesis. Three of the remaining four mutations that occur in AZT-ddI
or AZT-ddC combination therapy also map to the DNA-protein interface,
including residue 116, which may be involved in dNTP binding
(30). Therefore, we have examined the effect of the Q151M
mutation alone as well as in combination with the remaining four
mutations (VILYM [see below]) on the overall fidelity of DNA
synthesis by HIV-1 RT by using an M13-based forward mutation assay
previously described by Kunkel and coworkers (3, 27). Our
results show that the mutations cause a small change in the overall
mutation frequency, but important differences in mutational
specificities were evident when the three enzymes were compared.
(The data in this paper are from a thesis to be submitted by L. F. Rezende in partial fulfillment of the requirements for a Ph.D. in the
Sue Golding Graduate Division of Medical Sciences, Albert Einstein
College of Medicine, Yeshiva University.)
 |
MATERIALS AND METHODS |
Phage DNA and bacterial strains.
The gapped-duplex DNA
substrate was derived from the bacteriophage M13mp2. The M13 phage was
grown in Escherichia coli NR9099 [
(pro-lac)
thi ara recA56/F' (proAB
lacIqZ
M15)] for the preparation of both
single-stranded and replicative-form DNAs. E. coli MC1061 [hsdR hsdM+ araD
(ara leu)
(lacIPOZY) galU galK strA] was used for
electroporation of the products of the fill-in reaction to produce
phage. E. coli CSH50 [
(pro-lac) thi ara
strA/F' (proAB lacIqZ
M15
traD36)] was the
-complementation strain used to
score for the mutant phage.
Enzymes.
Bacterial expression and purification of homodimers
of wild-type HIV-1BH10 RT, the Q151M mutant RT, and the
VILYM (containing the five mutations A62V, V75I, F77L, F116Y, and
Q151M) mutant RT have been described by Ueno et al. (34).
The specific activities of these RTs were found to be 500 U/mg for the
wild-type enzyme, 833 U/mg for the Q151M RT, and 625 U/mg for the VILYM
RT. One unit is defined as the amount of enzyme required to incorporate 1 nmol of dTMP into DNA on a poly(rA) · oligo(dT)
template-primer at 37°C in 10 min.
Determination of forward mutation frequency.
The M13mp2
duplex DNA containing a single-stranded gap of 361 nucleotides
(including the lacZ upstream regulatory sequences and the
first 107 nucleotides of the open reading frame) was prepared as
previously described (6) and used as a template-primer to perform the DNA synthesis reactions in vitro with purified wild-type and mutant RTs. DNA synthesis reactions were performed in a total volume of 25 µl containing 75 mM Tris-Cl (pH 8.0), 80 mM KCl, 6 mM
MgCl2, 10 mM dithiothreitol, 500 µM (each) dATP, dCTP,
dGTP, and dTTP (Boehringer Mannheim, Indianapolis, Ind.), 59 ng of
gapped-duplex DNA, and 0.7 to 1.3 U of purified RT for 1 h
at 37°C. Complete synthesis of the gapped region was confirmed by gel
electrophoresis. Two independent fill-in reactions were performed with
each enzyme.
Products of the fill-in reaction were electroporated (in two to five
batches per fill-in reaction) into E. coli MC1061. After electroporation, the cells were allowed to recover for 10 min and then
mixed with a log-phase culture of E. coli CSH50, and the
mixed cells were overlaid, in top agar, on M9 plates containing 0.2 mM
IPTG (isopropyl-
-D-thiogalactopyranoside) (Sigma) and 0.195 mM X-Gal
(5-bromo-4-chloro-3-indolyl-
-D-galactopyranoside) (Labscientific, Inc). The plates were incubated at 37°C for
approximately 15 h before scoring for mutant plaques that did not
display the bright blue color of the wild-type M13mp2. These included
both clear plaques and plaques with three grades of reduced color
intensity (6). Mutant plaques were picked from the plates
and stored in 1 ml of 0.9% saline at 4°C. Mutational frequencies
were determined by dividing the number of confirmed mutant plaques by
the total number of plaques screened. The background mutation frequency was determined by electroporating unfilled gapped-duplex DNA and scoring for mutants as described above. All mutants identified in the
initial screen were confirmed by picking, resuspending, and replating
with an equivalent amount of wild-type phage as described above.
Sequencing of phage DNA.
Single-stranded DNA was prepared
from mutant plaques as described by Bebenek and Kunkel (6).
Briefly, 50 µl of plaque supernatant and 200 µl of an overnight
culture of E. coli CSH50 were added to 1.8 ml of 2xYT broth
and incubated at 37°C for approximately 15 h. Culture
supernatants were collected, and the phage were precipitated with
one-fourth the volume of 15% polyethylene glycol-2.5 M NaCl for 6 min
at 4°C. Phage were decoated by incubation with 50 µg of proteinase
K for 30 min, and single-stranded DNA was precipitated by treatment
with 1/10 volume of 5% hexadecyl trimethylammonium bromide in 0.5 mM
NaCl for 10 min followed by centrifugation at 12,000 × g.
The DNA pellets were resuspended in 1.2 M NaCl, and finally the
single-stranded phage DNA was precipitated with ethanol.
The phage DNA was sequenced by using a Sequenase 2.0 DNA sequencing kit
(Amersham Life Sciences, Arlington Heights, Ill.)
with a primer that
allowed the determination of the nucleotide
sequence of the entire gap
region (5'GCGCAGCTGTTGGGAAGGGCG3').
Sequenced templates were
resolved on 6% sequencing gels with a
GENOMYX DNA sequencer.
Calculation of error rates.
Error rates were calculated as
described by Bebenek and Kunkel (6). Since two fill-in
reactions were performed for each enzyme and the mixtures were
separately electroporated, we calculated the mutation frequencies
separately and derived the mean values and standard errors. The mean
mutational frequency was corrected by subtracting the background
mutational frequency. The corrected mean mutational frequency is
multiplied by the percentage of all mutations represented by the
particular class of mutations (e.g., base substitutions). This number
was divided by 0.6 (the likelihood of expression of the newly
synthesized strand in E. coli) and then divided by the total
number of sites where this class of mutations can be detected within
our 361-base target (6).
Statistical analysis.
Differences between mutation
frequencies were calculated by using the unpaired t test.
Differences in the proportions of errors at specific sites were
calculated by using the two-tailed Fisher's exact test.
 |
RESULTS |
Mutational frequencies of wild-type and multidrug-resistant
RTs.
We used the M13-based forward assay to assess the
overall fidelity of the wild-type, Q151M, and VILYM
(A62V/V75I/F77L/Q151M/F116Y) RTs. This assay allows the measurement of
both the overall fidelity and the rates of specific mutations by each
mutant RT. The M13 gapped-duplex substrate contained a single-stranded
gap over the regulatory sequences and some of the coding region of the
lacZ
gene. All three enzymes were capable of synthesizing
DNA, resulting in gap closure as determined by agarose gel
electrophoresis (Fig. 1).

View larger version (35K):
[in this window]
[in a new window]
|
FIG. 1.
Ethidium bromide-stained agarose gel showing synthesis
of DNA across the gapped-duplex DNA substrate with recombinant,
purified HIV-1 RT. Complete synthesis of DNA across the gapped-duplex
DNA substrate was confirmed on a 0.8% agarose gel run at 25 V for
20 h. The synthesis is indicated by the gel mobility shift
observed between the initial gapped-duplex DNA (no RT) and the products
obtained after filling in by wild-type, Q151M, and the VILYM RTs. ds,
double stranded.
|
|
After screening of approximately 19,000 to 24,000 plaques per enzyme,
generated from gap fill-in reactions by the wild-type,
Q151M, and
VILYM RTs, the background-adjusted overall mutation
frequencies were determined to be 64 × 10
4 ± 9 × 10
4, 55 × 10
4 ± 9 × 10
4, and 31 × 10
4 ± 4 × 10
4, respectively (Table
1). These mutation frequencies
corresponded
to overall error rates of 4.5 × 10
5,
4.0 × 10
5, and 2.3 × 10
5 per
nucleotide, respectively. Statistical analysis revealed that
the
mutation frequencies of the two variant RTs were not substantially
altered from that of wild-type RT (
P > 0.05 for both
comparisons
by the unpaired
t test;
P = 0.6 for wild-type RT compared to Q151M
RT, and
P = 0.075 for wild-type RT compared to VILYM RT).
Spectra of mutations by wild-type and multidrug-resistant HIV-1
RTs.
In order to determine the specificity of mutations generated
during the gap fill-in DNA synthesis reaction, M13 templates from 117 plaques representing the mutations induced by the wild-type enzyme, 103 plaques representing the errors by the Q151M RT, and 101 plaques
representing those by the VILYM RT were randomly selected from each
independent electroporation for sequence determination. A comparison of
the mutational spectra of the wild-type and Q151M RTs is shown in the
top panel of Fig. 2, while that for
wild-type and VILYM RTs is shown in the bottom panel of Fig. 2. It is
readily apparent from these mutational spectra that there are
differences in the error specificities of the wild-type and the mutant
RTs. An examination of the mutation spectrum generated by the wild-type RT reveals four prominent mutational hot spots (consisting of at least
six errors at a given site), each occurring at runs of nucleotides. Of
these, three are substitution hot spots located at the run of Ts at
positions
36 to
34, the run of Gs at positions 88 to 90, and the
first of two Ts at positions 112 to 113. The fourth is a frameshift hot
spot located in the run of Ts at positions 137 to 139. Three milder hot
spots (consisting of three errors at a given site) are also observed
for wild-type HIV-1 RT: one at the first of two Gs at position 29, a
second at the first T of the pair at position 121, and a third at the
last G in the stretch of sequence shown (Fig. 2).

View larger version (78K):
[in this window]
[in a new window]
|
FIG. 2.
Spectra of mutations generated by wild-type and
nucleoside analog-resistant HIV-1 RTs. The wild-type lacZ
sequence is represented, with the corresponding nucleotide positions
indicated below the sequence. Mutations created by the wild-type HIV-1
RT are shown above the lacZ sequence, and those generated
by one of the mutant RTs are shown below the sequence. Base
substitutions are noted directly above or below the lacZ
sequence and represent the nucleotide in the mutated template.
Frameshift mutations are indicated with an upright triangle for
single-base deletions and with an inverted triangle for single-base
insertions. Since it cannot be determined exactly which base in a run
of nucleotides has been deleted or inserted, the frameshift events are
indicated in the middle of the run. (Top) Comparison of the spectra of
mutations generated by the wild-type and Q151M variant HIV-1 RTs.
(Bottom) Comparison of wild-type and VILYM RTs. In addition to the
mutations shown here, two templates generated by the VILYM RT contained
large deletions (see text).
|
|
The mutational spectrum generated by the Q151M RT retains both the hot
spot at the run of Ts at positions

36 to

34 and that
at the run of
Gs at positions 88 to 90 (Fig.
2, top; Table
2).
However, the frameshift hot spot
observed at positions 137 to
139 with the wild-type HIV-1 RT is
significantly reduced (10-fold;
P < 0.05 by the
two-tailed Fisher's exact test). Three new prominent
hot spots were
created by the Q151M RT: an A-to-G mutation at
nucleotide 42 (
P < 0.0005 by the two-tailed Fisher's exact test),
a
frameshift hot spot at the run of Cs located at positions 132
to 136 (
P < 0.06 by the two-tailed Fisher's exact test), and
an
A-to-T base substitution hot spot at position 144 (
P < 0.01 by
the two-tailed Fisher's exact test). A milder T-to-G hot
spot
also appears at position 40 (
P < 0.03 by the
two-tailed Fisher's
exact test). All but one (the frameshift hot spot
at positions
132 to 136;
P < 0.06 by the two-tailed
Fisher's exact test) of
the new hot spots detected with the Q151M RT
were previously not
observed with the wild-type HIV-1 RT at these new
positions (
3,
4,
10,
17,
18).
The mutational spectrum generated by the VILYM RT also shows variation
from that of the wild-type RT (Fig.
2, bottom). The
two major base
substitution hot spots at positions

36 and 89
show marked reductions
in mutations, i.e., 5.5-fold (
P < 0.03
by the
two-tailed Fisher's exact test) and 25-fold (
P < 0.002
by the two-tailed Fisher's exact test), respectively (Table
2).
The strongest mutational hot spot (12 mutations) for base substitutions
by VILYM RT is position 112, which was also a hot spot (6 mutations)
in
the spectrum generated by the wild-type RT.
Some of the templates sequenced showed multiple mutations, ranging from
two to six per template. Approximately 6% of the sequenced
templates
generated by the wild-type and the VILYM RTs contained
mutations at
multiple sites. However, only 1% of templates generated
by the Q151M
RT contained multiple mutations. While this rate
of multiple mutations
may be higher than one would expect considering
the mutational
frequency, many of the second mutations would have
been silent if found
alone and thus not counted in the mutation
frequency.
In addition to templates containing mutations involving only a few (one
to three) nucleotides per site, the VILYM RT generated
two mutants with
large deletions of 86 and 91 bp. One of these
deletions began at
nucleotide 145, which should be the first nucleotide
synthesized in our
gap-filling DNA synthesis reactions, and ended
at nucleotide 59. The
other began six nucleotides upstream of
the priming site and ended at
position 60.
The distributions of mutations generated by the RTs in this study
varied slightly. Unlike in a previous study (
3), which
revealed an approximately 1:1 ratio of frameshifts to base
substitutions
for HIV-1 RT, in the present study wild-type RT and its
Q151M
and VILYM variants generated approximately four, seven, and three
times more substitutions than frameshifts, respectively (frameshift
mutations constituting 22, 16, and 30%, respectively, of total
mutations). We believe that this discrepancy can be attributed
to the
different molecular clones from which the RTs used in the
two studies
were derived. The wild-type and mutant RTs studied
here differed not
only in the amounts of frameshift errors made
but also in the types of
frameshift errors made. While all enzymes
showed a preference for
1-base deletions over 1-base insertions,
the wild-type enzyme created
the fewest insertions (0.8%), the
Q151M RT generated slightly more
insertions (1.9%), and the VILYM
RT generated the most insertions
(6.6%).
The rate of formation of base substitution errors paralleled the
pattern seen in the overall error rate; i.e., it was lower
in the
nucleoside analog-resistant RTs than in the wild-type RT
(Table
3). Base substitutions can be generated
by either the
direct misinsertion of a nucleotide or by properly
base-paired
insertion during transient misalignment of a template or
primer
(
4). Misalignment-generated base substitutions
generally occur
at the end of a run of nucleotides (
4,
7).
We have classified
the base substitutions in our spectrum as
those that most likely
arise by misalignment (mutations at the ends of
runs of nucleotides)
and those that most likely arise by direct
misinsertion (mutations
not in or adjacent to runs of nucleotides).
Base substitutions
in the middle of runs, which form 0.8% of the
detectable mutations,
or at the end of a 2-nucleotide run, which form
5.1% of the detectable
mutations, are put into both categories, since
the mechanism of
their generation cannot be accurately assessed. We
calculated
the rate of generation of base substitution by each
mechanism.
Using this method of analysis, we found that the proportion
of
misalignment-mediated errors made by the VILYM RT was significantly
less than that for the wild-type RT (
P = 0.04 by the
two-tailed
Fisher's exact test) (Table
3).
 |
DISCUSSION |
Fidelity studies of HIV-1 RT, using either gel-based primer
extension assays or the gap-filling assay with the lacZ
gene, have shown that this polymerase has a high error rate (24,
27). More recent studies on the nucleoside analog-resistant RTs,
such as those with M184V or E89G alterations, have shown an increase of
fidelity (9, 11, 21, 27a, 35). However, those studies employed a gel-based primer extension assay, which allows one to
specifically measure the efficiency of misinsertion and does not allow
detection of changes in the efficiency of mispair extension or the
generation of frameshift mutations. Furthermore, the assay allows for
the measurement of misinsertion fidelity under conditions where the
enzyme does not have the option to make the correct insertion. In this
study, we have used the M13-based forward mutation assay to assess the
overall fidelities and mutational specificities of mutant RTs which are
parts of variant viruses seen in a subset of patients receiving
long-term combination therapy with AZT and ddI or with AZT and ddC. We
were able to show that while no significant difference in overall
fidelity was observed, important differences in the mutational
specificity were seen when wild-type and mutant enzymes were compared.
By using the M13-based gap-filling in vitro mutation assay, the
mutation frequency of HIV-1NY5 RT has been estimated to be 400 × 10
4 nucleotides (27). In this
study, however, the wild-type HIV-1BH10 RT had a mutation
frequency of 64 × 10
4. Thus, the wild-type RT used
here displays an approximately 6.5-fold-lower mutation frequency in
vitro than that reported for RT derived from HIV-1NY5
(27). A second difference between the previous in vitro
study and this study is the proportion of frameshift mutations. The
ratios of substitutions to frameshifts observed here were 4.5:1,
6.25:1, and 3.3:1 for wild-type, Q151M, and VILYM RTs, respectively.
These ratios contrast with a 1:1 ratio observed previously by Bebenek
et al. (3). These differences cannot be explained merely by
the fact that the strains of HIV used in these two studies are
different. In recent studies, the HIV-1NY5 RT has also been
shown to display decreased affinity for template (compared with
HxB2-derived RT), as revealed by a 279-fold decrease in the
Km for the template-primer (2) and a
greater-than-200-fold increase in the Koff on
poly(rA) · oligo(dT) template-primers (14). Poor
affinity of RT for the template-primer is thought to promote poorer
processivity (1), which in turn can decrease the fidelity of
the polymerase (32). Subsequent studies by Bebenek et al.
using HIV-1HxB2 RT showed lower mutation frequencies
(200 × 10
4 to 210 × 10
4)
(5). We have also performed the forward assay with
HIV-1HxB2 RT and have found a mutation frequency of 97 × 10
4, similar to that we have found for RT from
HIV-1BH10 reported here (24a). When comparing
the wild-type and nucleoside analog-resistant RTs from this study, the
increases in fidelity are found to be small (1.1-fold for the single
mutant and 2.0-fold for the quintuple mutant) and do not reach the
difference seen between RTs of different strains, making the difference
seem negligible. The fidelities of Moloney murine leukemia virus RT and
avian myeloblastosis virus RT have been studied previously by using
this assay (27), and the mutation frequencies were found to
be 22 × 10
4 and 42 × 10
4,
respectively, which are similar to the mutation frequencies determined
for HIV-1 RT in this study.
Interestingly, differences between the mutational specificities of the
wild-type and mutant enzymes were revealed by our studies. It is well
documented that the context of a nucleotide site affects the mutation
frequency (20, 25). Our data suggest that the overall
structure of the enzyme template-primer-binding pocket may also affect
which portions of the template are susceptible to mutation. The Q151M
RT showed the generation of new hot spots neither previously reported
for HIV-1 RT (3, 10, 17, 18) nor observed in our laboratory
(24a). Three of these sites (positions 40, 42, and 144)
showed statistically significant increases in proportions of mutations
(P < 0.05 by the two-tailed Fisher's exact test),
with one site (position 42) showing an increase at a more rigorous
degree of significance (P < 0.002 by the two-tailed Fisher's exact test) that is necessary to avoid false positives due to
type I error. The Q151 residue in HIV-1 RT maps to the loop between the
E and
8 region of the RT, near the single-stranded DNA of the
template base (30), and is proposed to make contact with the
deoxyribose backbone of the templated base (28). The amino
acid change from a glutamine to a methionine reduces the size of the
side chain. This may add flexibility to the template base, changing the
context specificity in which mutations are made. The Q151 residue has
been shown to be involved in dNTP binding (28), which may
also allow for changes in the nucleotide base pairing allowed by the
enzyme. The most striking change in the multiply mutated nucleoside
analog-resistant RT is the decrease in misalignment-mediated
substitutions and the decrease in mutations at two common mutation
sites,
36 and 89. The presence of multiple mutations in this RT,
however, precludes any speculations on mechanistic explanations for
this phenotype.
We and others (9, 11, 21, 27a, 35) have previously reported
coexistence of nucleoside analog resistance with an increase in dNTP
insertion fidelity. In this study, however, we find only modest
increases in fidelity with another class of nucleoside analog-resistant
mutants. The in vivo effects of the alteration of mutational
specificity by these RT mutations in vitro need to be assessed. It is
conceivable that dramatic changes in the mutational specificity of RT
could alter the course of evolution of the HIV-1 quasispecies in
infected individuals. It is, however, unclear whether the small changes
in error specificity observed here will have a major impact on viral
variation. This remains to be assessed via a single-cycle infection
assay.
 |
ACKNOWLEDGMENTS |
This work was supported by Public Health Service grants AI-30861
and AI40375 (to V.R.P.). L.F.R. acknowledges support from institutional
NIGMS predoctoral training grant T32-GM07491.
We thank T. A. Kunkel (National Institute for Environmental Health
Sciences) for providing the reagents for the M13 forward mutation
assay, B. D. Preston (University of Utah) for M13mp2 DNA, W. C. Drosopoulos for several helpful discussions, Deborah Stemp and Clark
Choi for their relentless enthusiasm while preparing hundreds of
templates for sequencing, Gloria Ho (Albert Einstein College of
Medicine) for assistance with the statistical analysis, and the
Oligonucleotide Synthesis Facility of the Albert Einstein College of
Medicine's Cancer Center for DNA oligonucleotides.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Department of
Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461. Phone: (718) 430-2517. Fax: (718)
430-8976. E-mail: prasad{at}aecom.yu.edu.
 |
REFERENCES |
| 1.
|
Abbotts, J.,
K. Bebenek,
T. A. Kunkel, and S. H. Wilson.
1993.
Mechanism of HIV-1 reverse transcriptase.
J. Biol. Chem.
268:10312-10323[Abstract/Free Full Text].
|
| 2.
|
Beard, W. A., and S. H. Wilson.
1993.
Kinetic analysis of template-primer interactions with recombinant forms of HIV-1 reverse transcriptase.
Biochemistry
32:9745-9753[Medline].
|
| 3.
|
Bebenek, K.,
J. Abbotts,
J. D. Roberts,
S. H. Wilson, and T. A. Kunkel.
1989.
Specificity and mechanism of error-prone replication by human immunodeficiency virus-1 reverse transcriptase.
J. Biol. Chem.
264:16948-16956[Abstract/Free Full Text].
|
| 4.
|
Bebenek, K.,
J. Abbotts,
S. H. Wilson, and T. A. Kunkel.
1993.
Error-prone polymerization by HIV-1 reverse transcriptase.
J. Biol. Chem.
268:10324-10334[Abstract/Free Full Text].
|
| 5.
|
Bebenek, K.,
W. A. Beard,
J. R. Casas-Finet,
H. R. Kim,
T. A. Darden,
S. H. Wilson, and T. A. Kunkel.
1995.
Reduced frameshift fidelity and processivity of HIV-1 reverse transcriptase mutants containing alanine substitutions in helix H of the thumb subdomain.
J. Biol. Chem.
270:19516-19523[Abstract/Free Full Text].
|
| 6.
|
Bebenek, K., and T. A. Kunkel.
1995.
Analyzing fidelity of DNA polymerases.
Methods Enzymol.
262:217-232[Medline].
|
| 7.
|
Bebenek, K., and T. A. Kunkel.
1993.
The fidelity of retroviral reverse transcriptase, p. 85-102. In
A. M. Skalka, and S. P. Goff (ed.), Reverse transcriptase.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 8.
|
Collier, A. C.,
R. W. Coombs,
D. A. Schoenfeld,
R. Bassett,
A. Baruch, and L. Corey.
1996.
Combination therapy with zidovudine, didanosine and saquinavir.
Antiviral Res.
29:99[Medline].
|
| 9.
|
Drosopoulos, W. C., and V. R. Prasad.
1996.
Increased polymerase fidelity of E89G, a nucleoside analog-resistant variant of human immunodeficiency virus type 1 reverse transcriptase.
J. Virol.
70:4834-4838[Abstract].
|
| 10.
|
Eckert, K. A., and T. A. Kunkel.
1993.
Fidelity of DNA synthesis catalyzed by human DNA polymerase and HIV-1 reverse transcriptase: effect of reaction pH.
Nucleic Acids Res.
21:5212-5220[Abstract/Free Full Text].
|
| 11.
|
Essink, B. B. O.,
N. K. T. Back, and B. Berkhout.
1997.
Increased polymerase fidelity of the 3TC-resistant variants of HIV-1 reverse transcriptase.
Nucleic Acids Res.
25:3212-3217[Abstract/Free Full Text].
|
| 12.
|
Georgiadis, M. M.,
S. M. Jessen,
C. M. Ogata,
A. Telesnitsky,
S. P. Goff, and W. A. Hendrickson.
1995.
Mechanistic implications from the structure of a catalytic fragment of Moloney murine leukemia virus reverse transcriptase.
Structure
3:879-892.
|
| 13.
|
Iversen, A. K. N.,
R. W. Shafer,
K. Wehrly,
M. A. Winters,
J. I. Mullins,
B. Chesebro, and T. C. Merigan.
1996.
Multidrug-resistant human immunodeficiency virus type 1 strains resulting from combination antiretroviral therapy.
J. Virol.
70:1086-1090[Abstract].
|
| 14.
|
Jaju, M.,
W. A. Beard, and S. H. Wilson.
1995.
Human immunodeficiency virus type 1 reverse transcriptase.
J. Biol. Chem.
270:9740-9747[Abstract/Free Full Text].
|
| 15.
|
Johnson, V. A.
1996.
Combination therapy for HIV-1 infection-overview: preclinical and clinical analysis of antiretroviral combinations.
Antiviral Res.
29:35-39[Medline].
|
| 16.
|
Larder, B. A.
1993.
Inhibitors of HIV reverse transcriptase as antiviral agents and drug resistance, p. 205-222. In
A. M. Skalka, and S. P. Goff (ed.), Reverse transcriptase.
Cold Spring Harbor Laboratory Press, Plainview, N.Y.
|
| 17.
|
Mansky, L. M.
1996.
The mutation rate of human immunodeficiency virus type 1 is influenced by the vpr gene.
Virology
222:391-400[Medline].
|
| 18.
|
Mansky, L. M., and M. Temin.
1995.
Lower in vivo mutation rate of human immunodeficiency virus type 1 than that predicted from the fidelity of purified reverse transcriptase.
J. Virol.
69:5087-5094[Abstract].
|
| 19.
|
Martin, J. L.,
J. E. Wilson,
R. B. Haynes, and P. A. Furman.
1993.
Mechanism of resistance of human immunodeficiency virus type 1 to 2',3'-dideoxyinosine.
Proc. Natl. Acad. Sci. USA
90:6135-6139[Abstract/Free Full Text].
|
| 20.
|
Mendelman, L. V.,
M. S. Boosalis,
J. Petruska, and M. F. Goodman.
1989.
Nearest neighbor influences on DNA polymerase insertion fidelity.
J. Biol. Chem.
264:14415-14423[Abstract/Free Full Text].
|
| 21.
|
Pandey, V. N.,
N. Kaushik,
N. Rege,
S. G. Sarafianos,
P. N. S. Yadav, and M. J. Modak.
1996.
Role of methionine 184 in human immunodeficiency virus type 1 reverse transcriptase in the polymerase function and fidelity of DNA synthesis.
Biochemistry
35:2168-2179[Medline].
|
| 22.
|
Perrin, L., and B. Hirschel.
1996.
Combination therapy in primary HIV infection.
Antiviral Res.
29:87-89[Medline].
|
| 23.
|
Poch, O.,
I. Sauvaget,
M. Delarue, and N. Tordo.
1989.
Identification of four conserved motifs among the RNA-dependent encoding elements.
EMBO J.
8:3867-3874[Medline].
|
| 24.
|
Preston, B. D.,
B. J. Poiesz, and L. A. Loeb.
1988.
Fidelity of HIV-1 reverse transcriptase.
Science
242:1168-1171[Abstract/Free Full Text].
|
| 24a.
| Rezende, L. F., et al. Unpublished
observations.
|
| 25.
|
Ricchetti, M., and H. Buc.
1990.
Reverse transcriptases and genomic variability: the accuracy of DNA replication is enzyme specific and sequence dependent.
EMBO J.
9:1583-1593[Medline].
|
| 26.
|
Richman, D. D.
1992.
HIV drug resistance.
AIDS Res. Hum. Retroviruses
8:1065-1071[Medline].
|
| 27.
|
Roberts, J. D.,
K. Bebenek, and T. A. Kunkel.
1988.
The accuracy of reverse transcriptase from HIV-1.
Science
242:1171-1173[Abstract/Free Full Text].
|
| 27a.
|
Rubinek, T.,
M. Bakhanashvili, and A. Hizi.
1997.
The fidelity of 3' misinsertion and mispair extension during DNA synthesis exhibited by two drug-resistant mutants of the reverse transcriptase of human immunodeficiency virus type 1 with Leu74Val and Glu89Gly.
Eur. J. Biochem.
247:238-247[Medline].
|
| 28.
|
Sarafianos, S. G.,
V. N. Pandey,
N. Kaushik, and M. J. Modak.
1995.
Glutamine 151 participates in the substrate dNTP binding function of HIV-1 reverse transcriptase.
Biochemistry
34:7207-7216[Medline].
|
| 29.
|
Shafer, R. W.,
M. J. Kozal,
M. A. Winters,
A. K. N. Iversen,
D. A. Katzenstein,
M. V. Ragnei,
W. A. Meyer III,
P. Gupta,
S. Rasheed,
R. Coombs,
M. Katzman,
S. Fiscus, and T. C. Merrigan.
1994.
Combination therapy with zidovudine and didanosine selects for drug-resistant human immunodeficiency virus type 1 strains with unique patterns of pol gene mutations.
J. Infect. Dis.
169:722-729[Medline].
|
| 30.
|
Shirasaka, T.,
M. F. Kavlick,
T. Ueno,
W. Gao,
E. Kojima,
M. L. Alcaide,
S. Chokekijchai,
B. M. Roy,
E. Arnold,
R. Yarchoan, and H. Mitsuya.
1995.
Emergence of human immunodeficiency virus type 1 variants with resistance to multiple dideoxynucleosides in patients receiving therapy with dideoxynucleosides.
Proc. Natl. Acad. Sci. USA
92:2398-2402[Abstract/Free Full Text].
|
| 31.
|
Shirasaka, T.,
R. Yarchoan,
M. C. O'Brien,
R. N. Husson,
B. D. Anderson,
E. Kojima,
T. Shimada,
S. Border, and H. Mitsuya.
1993.
Changes in drug sensitivity of human immunodeficiency virus type 1 during therapy with azidothymidine, dideoxycytidine, and dideoxyinosine: an in vitro comparative study.
Proc. Natl. Acad. Sci. USA
90:562-566[Abstract/Free Full Text].
|
| 32.
|
Temin, H. M.
1993.
Retrovirus variation and reverse transcription: abnormal transfers result in retrovirus genetic variation.
Proc. Natl. Acad. Sci. USA
90:6900-6903[Abstract/Free Full Text].
|
| 33.
|
Ueno, T., and H. Mitsuya.
1997.
Comparative enzymatic study of HIV-1 reverse transcriptase resistant to 2',3'-dideoxynucleotide analogs using the single-nucleotide incorporation assay.
Biochemistry
36:1092-1099[Medline].
|
| 34.
|
Ueno, T.,
T. Shirasaka, and H. Mitsuya.
1995.
Enzymatic characterization of human immunodeficiency virus reverse transcriptase resistant to multiple 2',3'-dideoxynucleoside 5'-triphosphates.
J. Biol. Chem.
270:23605-23611[Abstract/Free Full Text].
|
| 35.
|
Wainberg, M. A.,
W. C. Drosopoulos,
H. Salomon,
M. Hsu,
G. Borkow,
M. A. Parniak,
Z. Gu,
Q. Song,
J. Manne,
S. Islam,
G. Castriota, and V. R. Prasad.
1996.
Enhanced fidelity of 3TC-selected mutant HIV-1 reverse transcriptase.
Science
271:1282-1285[Abstract].
|
J Virol, April 1998, p. 2890-2895, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Derache, A., Maiga, A.-I., Traore, O., Akonde, A., Cisse, M., Jarrousse, B., Koita, V., Diarra, B., Carcelain, G., Barin, F., Pizzocolo, C., Pizarro, L., Katlama, C., Calvez, V., Marcelin, A.-G.
(2008). Evolution of genetic diversity and drug resistance mutations in HIV-1 among untreated patients from Mali between 2005 and 2006. J Antimicrob Chemother
62: 456-463
[Abstract]
[Full Text]
-
Smith, R. A., Anderson, D. J., Preston, B. D.
(2006). Hypersusceptibility to Substrate Analogs Conferred by Mutations in Human Immunodeficiency Virus Type 1 Reverse Transcriptase. J. Virol.
80: 7169-7178
[Abstract]
[Full Text]
-
Curr, K., Tripathi, S., Lennerstrand, J., Larder, B. A., Prasad, V. R.
(2006). Influence of naturally occurring insertions in the fingers subdomain of human immunodeficiency virus type 1 reverse transcriptase on polymerase fidelity and mutation frequencies in vitro. J. Gen. Virol.
87: 419-428
[Abstract]
[Full Text]
-
Skasko, M., Weiss, K. K., Reynolds, H. M., Jamburuthugoda, V., Lee, K., Kim, B.
(2005). Mechanistic Differences in RNA-dependent DNA Polymerization and Fidelity between Murine Leukemia Virus and HIV-1 Reverse Transcriptases. J. Biol. Chem.
280: 12190-12200
[Abstract]
[Full Text]
-
Sharma, B., Kaushik, N., Upadhyay, A., Tripathi, S., Singh, K., Pandey, V. N.
(2003). A positively charged side chain at position 154 on the {beta}8-{alpha}E loop of HIV-1 RT is required for stable ternary complex formation. Nucleic Acids Res
31: 5167-5174
[Abstract]
[Full Text]
-
Fisher, T. S., Prasad, V. R.
(2002). Substitutions of Phe61 Located in the Vicinity of Template 5'-Overhang Influence Polymerase Fidelity and Nucleoside Analog Sensitivity of HIV-1 Reverse Transcriptase. J. Biol. Chem.
277: 22345-22352
[Abstract]
[Full Text]
-
Gutierrez-Rivas, M., Menendez-Arias, L.
(2001). A mutation in the primer grip region of HIV-1 reverse transcriptase that confers reduced fidelity of DNA synthesis. Nucleic Acids Res
29: 4963-4972
[Abstract]
[Full Text]
-
Archer, R. H., Dykes, C., Gerondelis, P., Lloyd, A., Fay, P., Reichman, R. C., Bambara, R. A., Demeter, L. M.
(2000). Mutants of Human Immunodeficiency Virus Type 1 (HIV-1) Reverse Transcriptase Resistant to Nonnucleoside Reverse Transcriptase Inhibitors Demonstrate Altered Rates of RNase H Cleavage That Correlate with HIV-1 Replication Fitness in Cell Culture. J. Virol.
74: 8390-8401
[Abstract]
[Full Text]
-
Singh, K., Kaushik, N., Jin, J., Madhusudanan, M., Modak, M. J.
(2000). Role of Q190 of MuLV RT in ddNTP resistance and fidelity of DNA synthesis: a molecular model of interactions with substrates. Protein Eng Des Sel
13: 635-643
[Abstract]
[Full Text]
-
Boyer, P. L., Hughes, S. H.
(2000). Effects of Amino Acid Substitutions at Position 115 on the Fidelity of Human Immunodeficiency Virus Type 1 Reverse Transcriptase. J. Virol.
74: 6494-6500
[Abstract]
[Full Text]
-
Boyer, P. L., Sarafianos, S. G., Arnold, E., Hughes, S. H.
(2000). Analysis of mutations at positions 115 and 116 in the dNTP binding site of HIV-1 reverse transcriptase. Proc. Natl. Acad. Sci. USA
97: 3056-3061
[Abstract]
[Full Text]
-
Halvas, E. K., Svarovskaia, E. S., Pathak, V. K.
(2000). Development of an In Vivo Assay To Identify Structural Determinants in Murine Leukemia Virus Reverse Transcriptase Important for Fidelity. J. Virol.
74: 312-319
[Abstract]
[Full Text]
-
Yahi, N., Tamalet, C., Tourrès, C., Tivoli, N., Ariasi, F., Volot, F., Gastaut, J.-A., Gallais, H., Moreau, J., Fantini, J.
(1999). Mutation Patterns of the Reverse Transcriptase and Protease Genes in Human Immunodeficiency Virus Type 1-Infected Patients Undergoing Combination Therapy: Survey of 787 Sequences. J. Clin. Microbiol.
37: 4099-4106
[Abstract]
[Full Text]
-
Harris, D., Kaushik, N., Pandey, P. K., Yadav, P. N. S., Pandey, V. N.
(1998). Functional Analysis of Amino Acid Residues Constituting the dNTP Binding Pocket of HIV-1 Reverse Transcriptase. J. Biol. Chem.
273: 33624-33634
[Abstract]
[Full Text]
-
Diamond, T. L., Kimata, J., Kim, B.
(2001). Identification of a Simian Immunodeficiency Virus Reverse Transcriptase Variant with Enhanced Replicational Fidelity in the Late Stage of Viral Infection. J. Biol. Chem.
276: 23624-23631
[Abstract]
[Full Text]