Previous Article | Next Article 
J Virol, April 1998, p. 2795-2805, Vol. 72, No. 4
Department of Bacteriology and
Virology1 and
Department of Hepatology
and Gastroenterology,
Received 5 November 1997/Accepted 5 January 1998
A 40-amino-acid sequence located in the nonstructural 5A (NS5A)
protein of hepatitis C virus genotype 1b (HCV-1b) was recently suggested to be the interferon sensitivity-determining region (ISDR),
because HCV-1b strains with an ISDR amino acid sequence identical to
that of the prototype strain HCV-J were found to be resistant to alpha
interferon (IFN- Hepatitis C virus (HCV) is a small
enveloped RNA virus which causes chronic liver disease, including
chronic active hepatitis in up to 80% of infected individuals, as well
as cirrhosis and hepatocellular carcinoma (1). The estimated
mean prevalence of infection in industrialized countries is 1 to 2%.
Many patients have been infected through blood transfusions or
intravenous drug use, but the cause of infection remains unknown in
about 20% of cases (63). No antiviral drugs targeting
specific HCV proteins have been developed, although in vitro models are
now available to screen such drugs (28, 35, 54). The only
approved drug is alpha interferon (IFN- In a recent meta-analysis of controlled trials of the effect of IFN- The independent predictive influence of virological parameters on
sustained HCV clearance in patients receiving IFN- HCV, like other RNA viruses (5, 6, 10-12, 14, 29, 59, 71,
74), exists within its hosts as pools of genetically distinct but
closely related variants referred to as quasispecies (44).
This probably confers a significant survival advantage, since the
simultaneous presence of multiple variant genomes and the high rate at
which new variants are generated allow rapid selection of mutants
better suited to new environmental conditions (44). The
genetic heterogeneity of the HCV quasispecies population results from a
high RNA-dependent RNA polymerase error rate (with misincorporation
frequencies averaging about 10 The quasispecies distribution of HCV genomes in infected individuals
implies that direct sequencing of any genomic region gives
access only to dominant or consensus viral sequences. Thus, direct
sequencing is not suited to addressing the issue of IFN- Patients and samples.
We studied 45 consecutive patients who
had chronic hepatitis C related to HCV-1b infection and who were
eligible for IFN-
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Interferon Resistance of Hepatitis C Virus Genotype 1b:
Relationship to Nonstructural 5A Gene Quasispecies Mutations
ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
) whereas strains with amino acid substitutions were
found to be sensitive (N. Enomoto, I. Sakuma, Y. Asahina, M. Kurosaki,
T. Murakami, C. Yamamoto, N. Izumi, F. Marumo, and C. Sato,
J. Clin. Invest. 96:224-230, 1995; N. Enomoto, I. Sakuma, Y. Asahina, M. Kurosaki, T. Murakami, C. Yamamoto, Y. Ogura, N. Izumi, F. Marumo, and C. Sato, N. Engl. J. Med. 334:77-81,
1996). We used single-strand conformation polymorphism (SSCP)
analysis, combined with cloning and sequencing strategies, to
characterize NS5A quasispecies in HCV-1b-infected patients and
determine the relationships between pre- and posttreatment NS5A quasispecies mutations and the IFN- sensitivity of HCV-1b. The
serine residues involved in phosphorylation of NS5A protein were highly
conserved both in the various patients and in quasispecies in a given
patient, suggesting that phosphorylation is important in NS5A protein
function. A hot spot for amino acid substitutions was found at
positions 2217 to 2218; it could be the result of either strong
selection pressure or tolerance to these amino acid replacements. The
proportion of synonymous mutations was significantly higher
than the proportion of nonsynonymous mutations, suggesting that genetic
variability in the region studied was the result of high mutation rates
and viral replication kinetics rather than of positive selection.
Sustained HCV RNA clearance was associated with low viral load and low
nucleotide sequence entropy, suggesting (i) that the replication
kinetics when treatment is started plays a critical role in HCV-1b
sensitivity to IFN- and (ii) that HCV-1b resistance to IFN- could
be conferred by numerous and/or related mutations that could be patient
specific and located at different positions throughout the viral genome
and could allow escape variants to be selected by IFN--stimulated
immune responses. No NS5A sequence appeared to be intrinsically
resistant or sensitive to IFN-, but the HCV-J sequence was
significantly more frequent in nonresponder quasispecies than in
sustained virological responder quasispecies, suggesting that the
balance between NS5A quasispecies sequences in infected patients could
have a subtle regulatory influence on HCV replication.
INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
), whose antiviral effect
results from both direct nonspecific inhibition of viral replication
and modulation of the immune response to viral epitopes (2, 51,
70).
in chronic hepatitis C (60), the rate of sustained biochemical responses (defined as sustained normalization of serum alanine aminotransferase [ALT] activity after treatment withdrawal) to a standard regimen of IFN- (3 MU subcutaneously 3 times a week
for 6 months) was 22%. Recent data suggest that about 80% of patients
with a sustained biochemical response achieve a sustained virological
response, defined as sustained HCV RNA clearance (4). Several independent predictors of a sustained virological response to
IFN have been identified in multivariate analyses. They include age,
the presence of cirrhosis on liver biopsy, the titer of anti-HCV core
immunoglobulin M, and virological parameters such as viral load, the
HCV genotype, and the genetic heterogeneity of hypervariable region 1 (HVR1) of the HCV genome (9, 22, 43, 46, 49, 53, 58, 66).
therapy raises
the question whether intrinsic characteristics of HCV strains confer
sensitivity or resistance to IFN-. Recently, Enomoto et al.
(15, 16) analyzed the NS5A gene of HCV genotype 1b
(HCV-1b) strains by direct sequencing. They found a 40-amino-acid
stretch in the NS5A protein that they designated the interferon
sensitivity-determining region (ISDR), because HCV-1b strains with an
amino acid sequence identical to that of the prototype HCV-1b strain
HCV-J, isolated in 1990 in Japan by Kato et al. (33), were
resistant to IFN- while strains with amino acid substitutions were
sensitive to IFN- (15). The authors therefore suggested
that sequence analysis of the ISDR before therapy might be used to
predict the response to IFN- (15, 16). Using a similar
approach based on direct sequencing of the NS5A gene, several authors
confirmed the results of Enomoto et al. (3, 40, 47, 48)
while others found frequent amino acid substitutions in the NS5A gene
of nonresponders to IFN- and concluded that the response was not
related to the number of amino acid substitutions in the putative ISDR
(26, 34, 67, 76).
4 to 105 per
base site) and the apparent absence of any error correction or
proofreading mechanism (6). Most mutant viral particles cannot replicate, but the remainder can transmit the new genetic information to their progeny. The "fittest" infectious particles are selected on the basis of their replication capacities and especially by the selective pressure exerted by their interactions with
host cell proteins and the immune response, which targets regions
encoding both cytotoxic and neutralizing epitopes (12, 13, 17, 37,
38, 72, 73).
sensitivity- and resistance-associated sequences within any coding region of the HCV genome, including the NS5A region. In this
study, we used single-strand conformation polymorphism (SSCP) analysis, combined with cloning and sequencing strategies, to characterize NS5A quasispecies and their nucleotide and amino acid sequences in
HCV-1b-infected patients who responded or failed to respond to IFN-
therapy. Using these techniques, we determined the relationships between pre- and posttreatment NS5A quasispecies mutations and HCV-1b
sensitivity to IFN- therapy. Hypotheses on the mechanisms underlying
HCV-1b resistance to IFN- are given.
MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
therapy. The genetic heterogeneity of the NS5A
gene was studied before treatment in all 45 patients by means of
reverse transcriptase-PCR-SSCP. SSCP analysis was initially developed
to detect sequence differences in single-stranded DNA by nondenaturing
polyacrylamide gel electrophoresis (52, 65). In this
technique, the target sequences are amplified by PCR. The products are
denatured by heating in the presence of formamide to obtain
single-stranded DNA and are analyzed by nondenaturing polyacrylamide
gel electrophoresis. The mobility of the separated strands depends on
their sequence-specific three-dimensional conformation. Therefore,
heterogeneous mixtures of mutant genomes, such as viral quasispecies,
can be separated into different bands by PCR-SSCP analysis (52,
65).
2a
(Roferon-A; Roche Laboratories, Basel, Switzerland) subcutaneously 3 times a week for at least 3 months. At month 3 of therapy, patients with elevated ALT levels were considered nonresponders while patients with normal ALT activity received a further 3 months of treatment with
the same dose (i.e., until month 6). The ALT activity in serum was used
as a biochemical index of the response to IFN-. A sustained
biochemical response was defined as normal ALT activity at month 12, i.e., 6 months after treatment withdrawal. All patients with a
sustained biochemical response at month 12 underwent HCV RNA
determination by highly sensitive nested PCR. Patients who were PCR
negative at this time were defined as sustained virological responders.
withdrawal (sustained HCV clearance) and eight nonresponders
randomly selected from the initial 45 patients, all of whom had
elevated ALT levels and detectable HCV viremia at treatment withdrawal
and 6 months later. For the epidemiological, histological, and
virological features of these 13 patients, see Table 1.
|
HCV RNA quantification. HCV RNA was quantified before therapy by means of a commercial noncompetitive PCR-based assay (Amplicor HCV Monitor; Roche Molecular Systems, Branchburg, N.J.) as specified by the manufacturer (55). The results were expressed in log10 genome copies per milliliter.
5' untranslated region PCR.
A sustained virological response
was defined by a negative 5' untranslated region PCR in patients with
normal ALT activity 6 months after IFN- withdrawal. A previously
described nested reverse transcriptase PCR technique was used
(56).
NS5A PCR. RNA was first extracted from 50 µl of serum with RNAzol (RNA-B; Bioprobe Systems, Montreuil-sous-Bois, France) and chloroform. After alignment of European HCV genotype 1b sequences, conserved primers were designed (34) to amplify a 185-bp fragment containing, downstream, the portion of the so-called ISDR in which mutations had been reported in responders (15, 16) and, upstream, three serine residues at amino acid positions 2197, 2201, and 2204, which were recently reported to be mandatory for hyperphosphorylation of the NS5A gene product (68). RNA was reverse transcribed at 42°C for 90 min with 100 pmol of random hexamers in the presence of 8 U of avian myeloblastosis virus reverse transcriptase (Promega, Madison, Wis.). Seminested PCR was performed. The first round used 5 pmol of upstream primer HCPr 378 (5'GTGCTCACTTCCATGCTCACCG; nucleotides 6837 to 6858 in the HCV-J sequence) and downstream primer HCPr 382 (5'GTTTCCGCCCATCTCCTGCCGC3'; nucleotides 7028 to 7049) (34). The second round used upstream primer HCPr 379 (5'CCCACATTACAGCAGAGACGGC3'; nucleotides 6865 to 6886) and downstream primer HCPr 382 (34). The two rounds of PCR were performed with 2.5 U of Taq DNA polymerase (Pharmacia Biotech, Uppsala, Sweden) under the same conditions, i.e., a 5-min denaturation at 94°C followed by 35 cycles (94°C for 30 s, 60°C for 30 s, and 72°C for 30 s) and then by a final PCR extension at 72°C for 5 min. Amplified products were analyzed by electrophoresis through a 3% NuSieve agarose gel (FMC, Rockland, Maine) and staining with ethidium bromide.
Cloning. PCR products were purified with the Sephaglas BandPrep kit (Pharmacia Biotech) as specified by the manufacturer. Purified products were quantified by ethidium bromide staining with DNA standards as controls; 50 ng was directly ligated into 50 ng of pTAg vector (LigATor cloning kit; R&D Systems, Abingdon, United Kingdom). Transformation of recombinant plasmid DNA into Escherichia coli competent cells was performed as specified by the manufacturer (R&D Systems), and transformants were grown on ampicillin-tetracycline plates. Cloned DNA was reamplified by the same NS5A-specific PCR procedure as that described above and used for SSCP analysis.
SSCP analysis. Amplified products were extracted from the agarose gel and purified with the Sephaglas BandPrep kit (Pharmacia Biotech) as specified by the manufacturer. Purified PCR products were eluted in 20 ml of dilution buffer. SSCP analysis was performed with the PCR fragment analysis kit (Pharmacia Biotech). An average of 50 ng of amplified DNA recovered from each serum sample was diluted in 4.5 µl of sterile distilled water plus 4.5 µl of a solution containing 10 mM NaOH and 2 mM EDTA, and bromophenol blue was added. The samples were denatured for 10 min at 100°C and chilled on ice immediately. Then 8-µl portions of the denatured samples were loaded into the wells of a discontinuous polyacrylamide gel (CleanGel; Pharmacia Biotech) which had been rehydrated to 0.5-mm thickness with a buffer specially designed for DNA separation (pH 7.3). Horizontal electrophoresis was performed in a Multiphor II electrophoresis apparatus (Pharmacia Biotech) at 3°C and 100 V for 20 min (penetration) and 600 V for 70 min (migration and stacking). The gel was then subjected to a rapid, sensitive silver-staining procedure with a silver-staining DNA kit (Pharmacia Biotech), a procedure that can detect 0.5 to 2 ng of DNA. After electrophoresis, the gel was fixed for 30 min at room temperature in 10% acetic acid, washed, and incubated for 20 min in 200 ml of a solution containing 0.1% (wt/vol) AgNO3 and 0.1% formaldehyde. The gel was rinsed, placed in 200 ml of a solution containing 2.5% Na2CO3, 0.1% formaldehyde, and 0.002% sodium thiosulfate, and slowly agitated until staining became visible. The reaction was stopped by incubation for 20 min in 40 mM EDTA, and the stain was fixed by incubation for 20 min at room temperature in a solution containing 10% glycerol.
Sequencing. After cloning and PCR amplification of the clones, the PCR products were amplified by the dye termination method in an ABI 377 automated DNA sequencer (Applied Biosystems, Foster City, Calif.) with the ABI Prism Dye Terminator Cycle Sequencing Ready Reaction (Applied Biosystems) as specified by the manufacturer. The sequencing primers were HCPr 379 and HCPr 382.
Calculation of genetic diversity and genetic distances.
We
determined the genetic diversity of HCV strains in the region of
interest by calculating entropy, which is defined in terms of the
probabilities of the different sequences or clusters of sequences that
can appear at a given time point. This measure, also known as Shannon
entropy (74), is calculated as S = 
i (pi ln
pi), where pi is the
frequency of each sequence in the viral quasispecies. The normalized
entropy, Sn, was calculated as
Sn = S/ln N, where N is
the total number of sequences analyzed. Sn
theoretically varies from 0 (no diversity) to 1 (maximum diversity). Normalized entropy was calculated at both the nucleotide and amino acid
levels on the basis of the first 30 clones isolated before treatment in
the 13 patients.
Construction of phylogenetic trees. The PHYLIP program version 3.572 (20) was used to construct phylogenetic trees by means of the neighbor-joining method (64) with a sequence matrix determined by the two-parameter method of Kimura. Bootstrap support was determined by 100 resamplings of the sequences (19).
| |
RESULTS |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
Quasispecies distribution of HCV in the NS5A gene.
A 185-bp
NS5A PCR product was generated from the pretreatment samples from 45 HCV-1b-infected patients. This fragment included, upstream, the three
serine residues mandatory for hyperphosphorylation of the NS5A protein
(68) and, downstream, the region containing the putative
IFN- sensitivity-determining sequences (15, 16). The PCR
products were initially analyzed by SSCP. As shown in Fig.
2, sera were characterized by specific
SSCP patterns, with two to eight bands (mean ± SD, 3.5 ± 1.5) migrating to different positions in the gel. This suggested that
different mixtures of NS5A sequences were circulating in the patients,
i.e., that the NS5A gene of HCV-1b had a quasispecies distribution.
|
|
|
|
Relationship between NS5A and sensitivity to IFN-.
We then
compared nucleotide sequence entropy, amino acid sequence entropy, the
average within-sample genetic distances, and viral load between the
sustained virological responders and nonresponders. As shown in Fig.
5, the genetic diversity of the region of
interest, as evaluated by normalized nucleotide sequence entropy, was
significantly lower in the sustained virological responders than in the
nonresponders (0.244 ± 0.058 and 0.564 ± 0.066, respectively; P < 0.02). Moreover, only one sustained
virological responder had a nucleotide sequence entropy higher than
0.300, while only one nonresponder had a nucleotide sequence entropy
lower than 0.400 (Table 1). There was also a strong tendency toward a
lower viral load in sustained responders than in nonresponders (mean
log10 viral load, 4.84 ± 0.38 and 5.38 ± 0.19, respectively; P < 0.08) (Fig. 5; Table 1). In
contrast, neither the amino acid sequence entropy nor the average
within-sample genetic distance was related to the response to IFN
therapy (Fig. 5).
|
withdrawal, showing that the
HCV-J sequence is not intrinsically resistant to IFN- treatment.
Finally, both the nonresponders and the sustained responders harbored
quasispecies variants with one to seven mutations relative to the HCV-J
sequence, showing that these mutations are not characteristic of
sensitive strains (Fig. 4).
Evolution of NS5A quasispecies during and after IFN-
treatment.
NS5A PCR products were generated from sera sampled 12 months after initiation of therapy, i.e., at the end of follow-up, to determine the evolutionary pattern of NS5A quasispecies during this
period. PCR products were cloned into the pTAg vector, and 36 to 48 clones per patient were studied by SSCP for clonal frequency (Table
2). One to three clones (when available)
per SSCP pattern were sequenced and compared with pretreatment
sequences. As shown in Table 2, the average between-sample
(posttreatment versus pretreatment) genetic distances were
significantly higher than the average pretreatment within-sample
genetic distances, indicating that changes in sequences occurred and
that these changes were evolutionary. In addition, when pre- and
posttreatment sequences were compared, the proportion of synonymous
mutations was always significantly higher than the proportion of
nonsynonymous mutations (Table 2). Phylogenetic analysis was used (see
Materials and Methods) to study the evolution and viral diversification
of NS5A sequences over time. As shown in Fig.
6, variants isolated at treatment
initiation and variants isolated 12 months later showed distinctive
clustering with the sampling time, compatible with shifts in the
population of viruses. This suggested that a true evolutionary process
occurred during the study period. Intermingling of sequences was rarely
observed, possibly suggesting that pretreatment variants survived.
|
|
or that it tolerates amino acid replacements. The
HCV-J sequence was present in the quasispecies from the four patients
before treatment and was the dominant sequence in three of the
patients. This sequence was still found 12 months later in all four
patients but was the dominant sequence in only one. Sequences with 1 to
6 amino acid substitutions relative to HCV-J were present in
significant proportions in the four patients before and after
treatment, indicating that NS5A sequences with mutations relative to
HCV-J are not intrinsically sensitive to IFN- treatment. Finally, it
is noteworthy that the serine residues involved in NS5A protein
phosphorylation (61, 68) remained highly conserved among the
quasispecies variants from the four patients after treatment.
| |
DISCUSSION |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
This study shows that the NS5A gene of HCV genotype 1b has a quasispecies distribution, which is a characteristic of other regions of the HCV genome, including the 5' untranslated region, E2, NS2, and NS3 (18, 44, 45, 73). Nucleotide and amino acid sequence analysis of quasispecies variants provides valuable information on how a virus behaves in a constant or changing environment, provided that a sufficient number of clones are analyzed per time point and per patient, i.e., more than 20 (12, 23). We analyzed 30 to 48 clones from each of 13 patients with chronic hepatitis C related to HCV-1b. Calculation of normalized nucleotide sequence entropy showed a high genetic diversity of the region of interest. The three serine residues at positions 2197, 2201, and 2204 showed remarkable conservation, both within quasispecies in a given patient and among the various patients, and also before and after treatment, as did (although to a slightly lesser extent) the other serine residues involved in phosphorylation of the NS5A protein (68). This finding, together with the recent observation that seryl phosphorylation of NS5A protein is a feature conserved among divergent HCV isolates (61), suggests that phosphorylation of NS5A protein, a protein thought to be integrated into the polymerase complex during replication (27, 75), is important for its function (which is unknown). In contrast, amino acid substitutions were frequently observed at positions 2217 to 2218, both within quasispecies in a given patient and among the various patients. This suggested either tolerance to amino acid replacements at these positions or strong selection pressure acting on this short amino acid stretch. Although an HLA B38-restricted cytotoxic epitope including these two amino acids was recently identified in the liver biopsy specimen of an HCV-infected patient (74a), this region does not seem to be a major target for cytotoxic responses. Therefore, selection might instead be due to interactions with host cellular proteins.
In contrast to HVR1, another highly diverse region of the HCV genome subjected to strong selection pressure by neutralizing antibodies (17, 62, 73), the proportion of synonymous mutations was significantly higher than the proportion of nonsynonymous mutations in the portion of the NS5A gene studied here. Entropy measures the repertoire size of viral quasispecies, which results from the accumulation of nucleotide substitutions over time under the variable influence of three parameters: (i) viral production, i.e., replication rates; (ii) rates of misincorporation of viral RNA-dependent RNA polymerases; and (iii) selection of the fittest newly produced variants (13, 14). The significantly higher proportion of synonymous mutations suggests that the overall genetic diversity of the region studied, as measured by nucleotide sequence entropy, reflects a combination of high mutation rates, viral replication kinetics, and limitations to acceptance of amino acid substitutions rather than the positive selection of viral variants (74).
An important finding in this study was that pretreatment nucleotide
sequence entropy was significantly lower in the patients who eliminated
HCV than in the nonresponders (Fig. 5). The predictive value of low
pretreatment entropy for a sustained virological response cannot be
deduced from our data, because the eight nonresponders were randomly
selected from a larger group of patients. In contrast, all five
sustained virological responders were studied. Our results therefore
show that patients with a high pretreatment entropy in the region of
interest are very unlikely to eradicate HCV when given the classical
IFN- regimen. The viral load was also lower in sustained responders
than in nonresponders, and the difference was close to statistical
significance. It is noteworthy that in a multivariate analysis of the
series of patients from whom the present study group was extracted, a
low viral load emerged as an independent predictor of a sustained
virological response to IFN-, in keeping with numerous reports
(8, 25, 42, 46, 49, 58).
As recently reported, it can be assumed that the viral load and
infected-cell numbers are in steady state before treatment, with a
minimal estimated production of the order of 1010 to
1011 virions per day (41, 77), and a maximal
estimated half-life of free virions of 0.3 day (41). In this
model, the viral load is a good estimate of the level of virus
production (41), while our findings indicate that nucleotide
sequence entropy in the region of the NS5A gene we studied is dependent
largely on viral replication kinetics. Our results therefore suggest
that replication kinetics when treatment is started is a major
determinant of the response of HCV-1b to 3 MU of IFN- three times a
week. On the other hand, the fact that no major selection pressure
appeared to be exerted on the region of the NS5A gene studied (except
possibly at amino acid positions 2217 to 2218) suggests that its
genetic diversity reflects the overall diversity of the HCV strain
whereas other regions subjected to strong pressure, such as HVR1, might be less representative. Since only patients with low nucleotide sequence entropy, i.e., a small HCV quasispecies repertoire, can have
sustained HCV RNA clearance, HCV resistance to therapy is unlikely to
be related to a small number of specific mutations on the genome, which
could be achieved by rapid viral replication starting from a small
quasispecies repertoire. The resistance of HCV to IFN- would instead
depend on the presence of complex (i.e., numerous and/or related)
mutations, which could be achieved only by starting from a large
quasispecies repertoire. Indeed, in quasispecies with low entropy,
there is a low probability that all the mutations needed for resistance
will be present before treatment or will occur after the initiation of
therapy, given the initial effect of IFN- on virus production
(41). In contrast, high pretreatment entropy is associated
with a higher probability that the resistance mutations are present,
even in minor poorly fit variants, and that these variants can be
selected (7).
IFN- acts on HCV through two phenomena: (i) it causes direct
inhibition of HCV replication through activation of the expression of
various proteins, such as 2',5'-oligoadenylate synthetase, Mx protein,
or double-stranded RNA-activated protein kinase (PKR), that act as
nonspecific antiviral agents in infected cells (2, 51);
and (ii) it is a multifunctional immunomodulatory cytokine which
induces a number of immunological changes, including expression of
class I and class II major histocompatibility complex antigens, activation of cytotoxic T cells and macrophages, and complex
interactions with the cytokine cascade (51, 70). Early loss
of HCV RNA in serum is necessary for long-term eradication of HCV. This
results from the direct antiviral effect of IFN- (41) and
could be largely dependent on the viral kinetics at the time treatment is started. Indeed, the antiviral effect of a single injection of
IFN- was recently shown to be dose dependent and short-lived (less
than 24 h) (41). It is therefore possible that primary HCV resistance is due mainly to a mismatch between the recommended IFN- (3 MU three times per week) and the viral kinetics, which would
strongly support the use of higher IFN- doses and more frequent
administration at the outset (41). It must be stressed, however, that in spite of prolonged IFN- treatment, sustained HCV
eradication is obtained in a relatively small proportion of the
patients who initially clear HCV RNA, owing to subsequent breakthroughs
and relapses (58, 60). It is therefore possible that
quasispecies variants against which the host has mounted an immune
response are eliminated during IFN- treatment but that the remaining
variants bear mutations giving a selective advantage to escape immune
system elimination (36, 50). Such mutations would be
numerous, possibly related, and located at different positions
throughout the viral genome corresponding to the various epitopes
involved in immune system-mediated viral clearance, a hypothesis
supported by our results. If so, the mutations conferring IFN-
resistance on HCV-1b would differ among patients, being strictly
dependent on the state of the immune system relative to HCV epitopes
during therapy. The better efficacy of longer maintenance IFN-
therapy on sustained HCV clearance (30, 60) could then be
explained by the fact the IFN- stimulated immune system has more
time to mount an efficient response to escape variants selected during
the first months of therapy.
Altogether, these findings suggest that the resistance of HCV-1b to
IFN- is mediated through viral replication kinetics and complex
nonspecific mutations related to the host immune response, rather than
through specific sequences in the NS5A gene of HCV-1b. Indeed, the
HCV-J sequence does not appear to be intrinsically resistant to
IFN-, and mutant sequences are not intrinsically sensitive to
IFN-, while their presence does not appear to confer sensitivity.
Nevertheless, the HCV-J sequence was consistently found more often in
the nonresponders than in the sustained virological responders. This
could explain why the HCV-J sequence or sequences with few mutations
relative to HCV-J were more frequently found in nonresponders than in
sustained responders in studies based on direct sequencing, which gives
access only to dominant or consensus sequences (15, 16, 40, 47,
48).
The presence of the HCV-J sequence in all the
nonresponders and in the only sustained virological
responder with high entropy suggests that NS5A quasispecies mutations
could play a role in the resistance of HCV-1b to IFN- by influencing
viral kinetics and, as a consequence, genomic entropy. Indeed,
NS5A protein seems to be integrated into the polymerase
complex during replication (27) and could
therefore play a critical role in the regulation of viral replication.
Recent studies have suggested that the amino acid sequences in the
region we studied could be important in the structure and function of
the protein. First, the NS5A gene product was recently shown to
repress, in vitro, the IFN--induced PKR, a mediator of the antiviral
effect of IFN- which directly inhibits the protein synthesis
initiation factor eIF2- (21). Interestingly, the HCV-J
sequence bound PKR and inhibited the phosphorylation of eIF2-, while
certain forms with as few as two mutations lost their ability to
bind PKR and to inhibit eIF2- phosphorylation (33a).
The relative proportion of these two functionally distinct sets
of sequences at a given time point in a given patient might participate
in the regulation of HCV replication rates in infected cells, in which
antiviral conditions exist naturally through endogenous IFN-
production (57). It could also play a role in IFN-
resistance by influencing replication kinetics at the time treatment is
started and/or by at least partly inhibiting the antiviral effect of
IFN- through the interaction with PKR and possibly other mediators
of IFN- action. Second, it has recently been found, in vitro and in
cultured cells, that NS5A protein is phosphorylated in the region we
studied by an associated cellular serine/threonine kinase that differed
from PKR (61). The action of this kinase seems to be highly
dependent on the amino acid sequences found immediately upstream and
downstream of the phosphate acceptor sites, namely, serines and, to a
lesser extent, threonines (61). In this respect, it must be
noted that amino acid 2217 in the HCV-J sequence is a threonine which
follows another threonine and that the kinase would prefer to
phosphorylate serine or threonine residues followed by acidic amino
acids (61), which is the case in the region immediately
following amino acids 2217 to 2218 in the HCV-J sequence. It is
therefore possible that quasispecies mutations regulate the rate of
phosphorylation of the protein. It is also possible that, as reported
for dengue virus type 2 NS5 protein, the phosphorylation state of NS5A
protein correlates with its subcellular location (32). Since
replication seems to occur on cytoplasmic membranes surrounding
the nucleus and since PKR is mostly a cytoplasmic enzyme, the
coexistence of unequally phosphorylated NS5A variants in infected
cells might conceivably participate in the regulation of viral
replication during chronic infection and might therefore play a role in
the resistance of HCV-1b to IFN- therapy. Strong selection pressures
exerted on amino acid positions 2217 to 2218 would be consistent with
the involvement of these two amino acids in the interaction with host proteins and/or in the phosphorylation processes. Both in vitro and in
vivo structure-function studies are now needed to determine the
relative biological activities of NS5A quasispecies variants isolated
from individual patients.
The results of the analysis of NS5A quasispecies at the end of the
follow-up period in four nonresponders were compatible with a true
evolutionary process characterized by shifts in the populations of
viruses. No control group of untreated patients was studied, but it has
recently been shown that the IFN- regimen used in this study is
associated with significantly higher rates of accumulation of
mutations in various regions of the HCV genome than during the natural
progression of the disease in untreated patients
(22a). Again, most amino acid changes occurred at
positions 2217 to 2218, suggesting that viral variants were selected or that substitutions at these positions were tolerated. It must be noted,
however, that the posttreatment sequences were different from one
patient to the next, indicating that no specific NS5A amino acid
sequence is resistant to IFN- and reinforcing our hypothesis that
resistant variants could be specific to each patient. In contrast,
nucleotide substitutions not involving amino acids 2217 to 2218 were
synonymous in most cases, suggesting that the observed changes
reflected enhanced replication kinetics (74). This is
consistent with our recent observation of replication rebound during
and after treatment (breakthrough and relapse, respectively) in
patients who do not clear HCV (58a). It is possible that
this rebound is dependent on changes in regions of the HCV genome that
are more directly involved both in replication and in elimination by
the immune system. In this respect, we recently observed profound
changes in the composition of HCV quasispecies in the HVR1, the target
of neutralizing responses, during and after IFN- treatment
(58a). These changes could at least partly account for the
changes in viral replication kinetics caused by treatment.
| |
ACKNOWLEDGMENTS |
|---|
This work was supported by a grant from the French Ministry of Health (Programme Hospitalier de Recherche Clinique 1996, contract AOM96-136) and a grant from Roche Products (Neuilly-sur-Seine, France).
We thank Lieven Stuyver for designing NS5A-specific primers for PCR; Anne Bastie, Jean-Michel Métreau, Ariane Mallat, Jean-Philippe Mavier, Gilles Duverlie, and Laurent Castéra for providing patient samples; Isabelle Da Silva, Jocelyne Rémiré, and Françoise Darthuy for excellent technical assistance; and Jean-Marc Josse, Carole Dupont, and the Management Staff of Pharmacia Biotech, Orsay, France, for their support in this study. We are also grateful to Marie-France Saint-Marc Girardin (Produits Roche) for her help. We are indebted to Margaret J. Koziel for critical review of the manuscript.
| |
FOOTNOTES |
|---|
* Corresponding author. Mailing address: Service de Bactériologie-Virologie, Hôpital Henri Mondor, 51 ave. du maréchal de Lattre de Tassigny, 94010 Créteil, France. Phone: (33) 1.49.81.28.26. Fax: (33) 1.49.81.28.39. E-mail: pawlotsky{at}univ-paris12.fr.
| |
REFERENCES |
|---|
|
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References
|
|---|
| 1. |
Alter, H. J.
1995.
To C or not to C: these are the questions.
Blood
85:1681-1695 |
| 2. |
Baron, S.,
S. K. Tyring,
W. R. Fleischmann,
D. H. Coppenhaver,
D. W. Niesel,
G. R. Klimpel,
G. J. Stanton, and T. K. Hughes.
1991.
The interferons. Mechanisms of action and clinical applications.
JAMA
266:1375-1383 |
| 3. | Chayama, K., A. Tsubota, M. Kobayashi, K. Okamoto, M. Hashimoto, Y. Miyano, H. Koike, M. Kobayashi, I. Koida, Y. Arase, S. Saitoh, Y. Suzuki, N. Murashima, K. Ikeda, and H. Kumada. 1997. Pretreatment virus load and multiple amino acid substitutions in the interferon sensitivity-determining region predict the outcome of interferon treatment in patients with chronic genotype 1b hepatitis C virus infection. Hepatology 25:745-749[Medline]. |
| 4. |
Chemello, L.,
L. Cavalletto,
C. Casarin,
P. Bonetti,
E. Bernardinello,
P. Pontisso,
C. Donada,
F. Belussi,
S. Martinelli,
A. Alberti, and the TriVeneto Viral Hepatitis Group.
1996.
Persistent hepatitis C viremia predicts late relapse after sustained response to interferon- in chronic hepatitis C.
Ann. Intern. Med.
124:1058-1060 |
| 5. |
Chumakov, K. M.
1996.
PCR engineering of viral quasispecies: a new method to preserve and manipulate genetic diversity of RNA virus populations.
J. Virol.
70:7331-7334 |
| 6. |
Clarke, D. K.,
E. A. Duarte,
S. F. Elena,
A. Moya,
E. Domingo, and J. Holland.
1994.
The red queen reigns in the kingdom of RNA viruses.
Proc. Natl. Acad. Sci. USA
91:4821-4824 |
| 7. | Coffin, J. M. 1995. HIV population dynamics in vivo: implications for genetic variation, pathogenesis, and therapy. Science 267:483-489. |
| 8. | Conjeevaram, H. S., J. E. Everhart, and J. H. Hoofnagle. 1995. Predictors of a sustained beneficial response to interferon alfa therapy in chronic hepatitis C. Hepatology 22:1326-1329[Medline]. |
| 9. | Davis, G. L. 1994. Prediction of response to interferon treatment of chronic hepatitis C. J. Hepatol. 21:1-3[Medline]. |
| 10. |
Delwart, E. L.,
H. W. Sheppard,
B. D. Walker,
J. Goodsmit, and J. I. Mullins.
1994.
Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays.
J. Virol.
68:6672-6683 |
| 11. | Dockter, J., C. F. Evans, A. Tishon, and M. B. A. Oldstone. 1996. Competitive selection in vivo by a cell for one variant over another: implications for RNA virus quasispecies in vivo. J. Virol. 70:1799-1803[Abstract]. |
| 12. | Domingo, E. 1996. Biological significance of viral quasispecies. Viral Hepatitis Rev. 2:247-261. |
| 13. | Duarte, E. A., I. S. Novella, S. C. Weaver, E. Domingo, S. Wain-Hobson, D. K. Clarke, A. Moya, S. F. Elena, J. C. de la Torre, and J. J. Holland. 1994. RNA virus quasispecies: significance for viral disease and epidemiology. Infect. Agents Dis. 3:201-214[Medline]. |
| 14. | Eigen, M., and C. Biebricher. 1988. Role of genome variation in virus evolution, p. 211-245. In E. Domingo, J. Holland, and P. Ahlquist (ed.), RNA genetics, vol. 3. Variability of RNA genomes. CRC Press, Inc., Boca Raton, Fla. |
| 15. | Enomoto, N., I. Sakuma, Y. Asahina, M. Kurosaki, T. Murakami, C. Yamamoto, N. Izumi, F. Marumo, and C. Sato. 1995. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b. Sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J. Clin. Invest. 96:224-230. |
| 16. |
Enomoto, N.,
I. Sakuma,
Y. Asahina,
M. Kurosaki,
T. Murakami,
C. Yamamoto,
Y. Ogura,
N. Izumi,
F. Marumo, and C. Sato.
1996.
Mutations in the nonstructural protein 5A gene and response to interferon in patients with chronic hepatitis C virus 1b infection.
N. Engl. J. Med.
334:77-81 |
| 17. |
Farci, P.,
H. J. Alter,
D. C. Wong,
R. H. Miller,
S. Govindarajan,
R. Engle,
M. Shapiro, and R. H. Purcell.
1994.
Prevention of hepatitis C virus infection in chimpanzees after antibody-mediated in vitro neutralization.
Proc. Natl. Acad. Sci. USA
91:7792-7796 |
| 18. | Feller, J. A., K. Grace, B. E. Clarke, and J. Y. N. Lau. 1996. Variations in the translational efficiency of naturally occurring hepatitis C virus (HCV) variants. Implication for the design of antiviral therapy. Hepatology 24:263A. |
| 19. | Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39:783-791. |
| 20. | Felsenstein, J. 1995. . PHYLIP (phylogeny inference package): version 3.57. Distributed by the author. Department of Genetics, University of Washington, Seattle. |
| 21. | Gale, M. J., M. J. Korth, N. M. Tang, S. L. Tan, D. A. Hopkins, T. E. Dever, S. J. Polyak, D. R. Gretch, and M. G. Katze. 1997. Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 230:217-227[Medline]. |
| 22. | Gonzalez-Peralta, R. P., K. Qian, J. Y. She, G. L. Davis, T. Ohno, M. Mizokami, and J. Y. N. Lau. 1996. Clinical implications of viral quasispecies heterogeneity in chronic hepatitis C. J. Med. Virol. 49:242-247[Medline]. |
| 22a. | Gretch, D. R. Personal communication. |
| 23. | Gretch, D. R., and S. J. Polyak. 1997. The quasispecies nature of hepatitis C virus: research methods and biological implications, p. 57-72. Groupe Français d'Etudes Moléculaires des Hépatites (GEMHEP) (ed.), Hepatitis C virus: genetic heterogeneity and viral load. John Libbey Eurotext, Paris, France. |
| 24. | Gretch, D. R., S. J. Polyak, J. J. Wilson, R. L. Carithers, J. D. Perkins, and L. Corey. 1996. Tracking hepatitis C virus quasispecies major and minor variants in symptomatic and asymptomatic liver transplant recipients. J. Virol. 70:7622-7631[Abstract]. |
| 25. | Hagiwara, H., N. Hayashi, E. Mita, T. Takehara, A. Kasahara, H. Fusamoto, and T. Kamada. 1993. Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. Gastroenterology 104:877-883[Medline]. |
| 26. | Halimi, G., P. Halfon, V. Gerolami, F. Castets, H. Khiri, M. Bourliere, A. P. Gauthier, and G. Cartouzou. 1996. Mutations in NS5A region and interferon response in hepatitis C-1b-infected patients. Hepatology 24:162A. |
| 27. |
Hijikata, M.,
H. Mizushima,
Y. Tanji,
Y. Komoda,
Y. Hirowatari,
T. Akagi,
N. Kato,
K. Kimura, and K. Shimotohno.
1993.
Proteolytic processing and membrane association of putative nonstructural proteins of hepatitis C virus.
Proc. Natl. Acad. Sci. USA
90:10773-10777 |
| 28. | Hirowatari, Y., M. Hijikata, and K. Shimotohno. 1995. A novel method for analysis of viral proteinase activity encoded by hepatitis C virus in cultured cells. Anal. Biochem. 225:113-120[Medline]. |
| 29. | Holland, J. J., J. C. De La Torre, and D. A. Steinhauer. 1992. RNA virus populations as quasispecies. Curr. Top. Microbiol. Immunol. 176:1-20[Medline]. |
| 30. | Jouët, P., F. Roudot-Thoraval, D. Dhumeaux, J. M. Métreau, and le Groupe Français pour l'Etude du Traitement des Hépatites Chroniques NANB/C. 1994. Comparative efficacy of interferon alfa in cirrhotic and noncirrhotic patients with non-A, non-B, C hepatitis. Gastroenterology 106:686-690[Medline]. |
| 31. | Jukes, T. H., and T. R. Cantor. 1969. Evolution of protein molecules, p. 21-132. In H. N. Munro (ed.), Mammalian protein metabolism. Academic Press, Inc., New York, N.Y. |
| 32. |
Kapoor, M.,
L. Zhang,
M. Ramachandra,
J. Kusukawa,
K. E. Ebner, and R. Padmanabhan.
1995.
Association between NS3 and NS5 proteins of dengue virus type 2 in the putative RNA replicase is linked to differential phosphorylation of NS5.
J. Biol. Chem.
270:19100-19106 |
| 33. |
Kato, N.,
M. Hijikata,
Y. Ootsuyama,
M. Nakagawa,
S. Ohkoshi,
T. Sugimura, and K. Shimotohno.
1990.
Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis.
Proc. Natl. Acad. Sci. USA
87:9524-9528 |
| 33a. | Katze, M. G. Personal communication. |
| 34. | Khorsi, H., S. Castelain, A. Wyseur, J. Izopet, V. Canva, A. Rombout, D. Capron, J. P. Capron, F. Lunel, L. Stuyver, and G. Duverlie. 1997. Mutations of hepatitis C virus 1b NS5A 2209-2248 amino acid sequence do not predict the response to recombinant interferon alfa therapy in French patients. J. Hepatol. 27:72-77[Medline]. |
| 35. | Kim, J. L., K. A. Morgenstern, C. Lin, T. Fox, M. D. Dwyer, J. A. Landro, S. P. Chambers, W. Markland, C. A. Lepre, E. T. O'Malley, S. L. Harbeson, C. M. Rice, M. A. Murcko, P. R. Caron, and J. A. Thomson. 1996. Crystal structure of the hepatitis C virus NS3 protease domain complexed with a synthetic NS4A cofactor peptide. Cell 87:343-365[Medline]. |
| 36. |
Koup, R. A.
1994.
Virus escape from CTL recognition.
J. Exp Med.
180:779-782 |
| 37. |
Koziel, M. J.,
D. Dudley,
N. Afdhal,
Q. L. Choo,
M. Houghton,
R. Ralston, and B. D. Walker.
1993.
Hepatitis C virus (HCV)-specific cytotoxic T-lymphocytes recognize epitopes in the core and envelope proteins of HCV.
J. Virol.
67:7522-7532 |
| 38. | Koziel, M. J., D. Dudley, N. Afdhal, A. Grakoui, C. M. Rice, Q. L. Choo, M. Houghton, and B. D. Walker. 1995. HLA class I-restricted cytotoxic T lymphocytes specific for hepatitis C virus. Identification of multiple epitopes and characterization of patterns of cytokines release. J. Clin. Invest. 96:2311-2321. |
| 39. |
Kumar, S.,
K. Tamura, and M. Nei.
1993.
MEGA: molecular evolutionary genetic analysis for microcomputers.
Comput. Appl. Biosci.
10:189-191 |
| 40. |
Kurosaki, M.,
N. Enomoto,
T. Murakami,
I. Sakuma,
Y. Asahina,
C. Yamamoto,
T. Ikeda,
S. Tozuka,
N. Izumi,
F. Marumo, and C. Sato.
1997.
Analysis of genotypes and amino acid residues 2209 to 2248 of the NS5A region of hepatitis C virus in relation to the response to interferon- therapy.
Hepatology
25:750-753[Medline].
|
| 41. | Lam, N. P., A. U. Neumann, D. R. Gretch, T. E. Wiley, A. S. Perelson, and T. J. Layden. 1997. Dose-dependent acute clearance of hepatitis C genotype 1 virus with interferon alfa. Hepatology 26:226-231[Medline]. |
| 42. |
Magrin, S.,
A. Craxi,
C. Fabiano,
R. G. Simonetti,
G. Fiorentino,
L. Marino,
O. Diquattro,
V. di Marco,
O. Loiacono,
R. Volpes,
P. Almasio,
M. S. Urdea,
P. Neuwald,
R. Sanchez-Pescador,
J. Detmer,
J. C. Wilber, and L. Pagliaro.
1994.
Hepatitis C viremia in chronic liver disease: relationship to interferon- or corticosteroid treatment.
Hepatology
19:273-279[Medline].
|
| 43. | Mahaney, K., V. Tedeschi, G. Maertens, A. M. Di Bisceglie, J. Vergalla, J. H. Hoofnagle, and R. Sallie. 1994. Genotypic analysis of hepatitis C virus in American patients. Hepatology 20:1405-1411[Medline]. |
| 44. |
Martell, M.,
J. I. Esteban,
J. Quer,
J. Genesca,
A. Weiner,
R. Esteban,
J. Guardia, and J. Gomez.
1992.
Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution.
J. Virol.
66:3225-3229 |
| 45. |
Martell, M.,
J. I. Esteban,
J. Quer,
V. Vargas,
R. Esteban,
J. Guardia, and J. Gomez.
1994.
Dynamic behavior of hepatitis C virus quasispecies in patients undergoing orthotopic liver transplantation.
J. Virol.
68:3425-3436 |
| 46. | Martinot-Peignoux, M., P. Marcellin, M. Pouteau, C. Castelnau, N. Boyer, M. Poliquin, C. Degott, I. Descombes, V. Le Breton, V. Milotova, J. P. Benhamou, and S. Erlinger. 1995. Pretreatment serum hepatitis C virus RNA levels and hepatitis C virus genotype are the main and independent prognostic factors of sustained response to interferon alfa therapy in chronic hepatitis C. Hepatology 22:1050-1056[Medline]. |
| 47. | Murakami, T., N. Enomoto, Y. Asahina, N. Izumi, F. Marumo, and C. Sato. 1996. Mutations in NS5A region and response to interferon in HCV genotype 2 infection. Hepatology 24:158A. |
| 48. | Niiyama, G., T. Kimura, K. Mitani, H. Tsugeno, N. Sengoku, S. Kinoyama, T. Ito, M. Kinoshita, and G. Yamada. 1996. Mutations in the nonstructural protein 5A gene in chronic hepatitis C virus 1b infection patients with interferon treatment. Hepatology 24:164A. |
| 49. |
Nousbaum, J. B.,
S. Pol,
B. Nalpas,
P. Landais,
P. Berthelot,
C. Bréchot, and the Collaborative Study Group.
1995.
Hepatitis C virus type 1b (II) infection in France and Italy.
Ann. Intern. Med.
122:161-168 |
| 50. | Nowak, M. A., R. M. May, R. E. Phillips, S. Rowland-Jones, D. G. Lalloo, S. McAdam, P. Klenerman, B. Koppe, K. Sigmund, C. R. M. Bangham, and A. J. McMichael. 1995. Antigenic oscillations and shifting immunodominance in HIV-1 infections. Nature 375:606-611[Medline]. |
| 51. | O'Connell, J. F. 1997. Mechanisms of action of interferon: potential role in hepatitis C. Viral Hepatitis Rev. 3:121-128. |
| 52. | Orita, M., Y. Suzuki, T. Sekiya, and K. Hayashi. 1989. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874-879[Medline]. |
| 53. |
Orito, E.,
M. Mizokami,
K. Suzuki,
K. I. Ohba,
T. Ohno,
M. Mori,
K. Hayashi,
K. Kato,
S. Iino, and J. Y. N. Lau.
1995.
Loss of serum HCV RNA at week 4 of interferon- therapy is associated with more favorable long-term response in patients with chronic hepatitis C.
J. Med. Virol.
46:109-115[Medline].
|
| 54. |
Overton, H.,
D. McMillan,
F. Gillespie, and J. Mills.
1995.
Recombinant baculovirus-expressed NS3 proteinase of hepatitis C virus shows activity in cell-based and in vitro assays.
J. Gen. Virol.
76:3009-3019 |
| 55. | Pawlotsky, J. M. 1997. Measuring hepatitis C viremia in clinical samples: can we trust the assays? Hepatology 26:1-4[Medline]. |
| 56. |
Pawlotsky, J. M.,
A. Fleury,
V. Choukroun,
L. Deforges,
F. Roudot-Thoraval,
P. Aumont,
J. Duval, and D. Dhumeaux.
1994.
Significance of highly positive c22-3 "indeterminate" second-generation hepatitis C virus (HCV) recombinant immunoblot assay (RIBA) and resolution by third-generation HCV RIBA.
J. Clin. Microbiol.
32:1357-1359 |
| 57. | Pawlotsky, J. M., A. G. Hovanessian, F. Roudot-Thoraval, P. Lebon, N. Robert, M. Bouvier, G. Babany, J. Duval, and D. Dhumeaux. 1995. Activity of the interferon-induced 2'-5'-oligoadenylate synthetase in patients with chronic hepatitis C. J. Interferon Cytokines Res. 15:857-862. |
| 58. |
Pawlotsky, J. M.,
F. Roudot-Thoraval,
A. Bastie,
F. Darthuy,
J. Rémiré,
J. M. Métreau,
E. S. Zafrani,
J. Duval, and D. Dhumeaux.
1996.
Factors affecting treatment responses to interferon- in chronic hepatitis C.
J. Infect. Dis.
174:1-7[Medline].
|
| 58a. | Pawlotsky, J. M., et al. Unpublished data. |
| 59. | Plyusnin, A., Y. Cheng, H. Lehvaslaiho, and A. Vaheri. 1996. Quasispecies in wild-type Tula hantavirus populations. J. Virol. 70:9060-9063[Abstract]. |
| 60. | Poynard, T., V. Leroy, M. Cohard, T. Thevenot, P. Mathurin, P. Opolon, and J. P. Zarski. 1996. Meta-analysis of interferon randomized trials in the treatment of viral hepatitis C: effects of dose and duration. Hepatology 24:778-789[Medline]. |
| 61. | Reed, K. E., J. Xu, and C. M. Rice. 1997. Phosphorylation of the hepatitis C virus NS5A protein in vitro and in vivo: properties of the NS5A-associated kinase. J. Virol. 71:7187-7197[Abstract]. |
| 62. |
Rosa, D.,
S. Campagnoli,
C. Moretto,
E. Guenzi,
L. Cousens,
M. Chin,
C. Dong,
A. J. Weiner,
J. Y. N. Lau,
Q. L. Choo,
D. Chien,
P. Pileri,
M. Houghton, and S. Abrignani.
1996.
A quantitative test to estimate neutralizing antibodies to the hepatitis C virus: cytofluorometric assessment of envelope glycoprotein 2 binding to target cells.
Proc. Natl. Acad. Sci. USA
93:1759-1763 |
| 63. | Roudot-Thoraval, F., A. Bastie, J. M. Pawlotsky, D. Dhumeaux, and the Study Group for the Prevalence and the Epidemiology of Hepatitis C Virus. 1997. Epidemiological factors affecting the severity of hepatitis C virus-related liver disease: a French survey of 6664 patients. Hepatology 26:485-490[Medline]. |
| 64. | Saitou, N., and N. Mei. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4:406-425[Abstract]. |
| 65. | Sekiya, T. 1993. Detection of mutant sequences by single-strand conformation polymorphism analysis. Mutat. Res. 288:79-83[Medline]. |
| 66. | Serfaty, L., P. Giral, A. Loria, T. Andréani, C. Legendre, and R. Poupon. 1994. Factors predictive of the response to interferon in patients with chronic hepatitis C. J. Hepatol. 21:12-17[Medline]. |
| 67. | Squadrito, G., F. Leone, M. Sartori, B. Nalpas, P. Berthelot, G. Raimondo, S. Pol, and C. Bréchot. 1997. Mutations in the nonstructural 5A region of hepatitis C virus and response of chronic hepatitis C to interferon alfa. Gastroenterology 113:567-572[Medline]. |
| 68. | Tanji, Y., T. Kaneko, S. Satoh, and K. Shimotohno. 1995. Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A. J. Virol. 69:3980-3986[Abstract]. |
| 69. |
Thompson, J. D.,
D. G. Higgins, and T. J. Gibson.
1994.
Clustal W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:4673-4680 |
| 70. | Tilg, H. 1997. New insights into the mechanisms of interferon alfa: an immunoregulatory and anti-inflammatory cytokine. Gastroenterology 112:1017-1021[Medline]. |
| 71. | Wain-Hobson, S. 1992. Human immunodeficiency virus type 1 quasispecies in vivo and ex vivo. Curr. Top. Microbiol. Immunol. 176:181-193[Medline]. |
| 72. |
Weiner, A.,
A. L. Erickson,
J. Kansopon,
K. Crawford,
E. Muchmore,
A. L. Hughes,
M. Houghton, and C. M. Walker.
1995.
Persistent hepatitis C virus infection in a chimpanzee is associated with emergence of a cytotoxic T lymphocyte escape variant.
Proc. Natl. Acad. Sci. USA
92:2755-2759 |
| 73. |
Weiner, A. J.,
H. M. Geysen,
C. Christopherson,
J. E. Hall,
T. J. Mason,
G. Saracco,
F. Bonino,
K. Crawford,
C. D. Marion,
K. A. Crawford,
M. Brunetto,
P. J. Barr,
T. Miyamura,
J. McHutchison, and M. Houghton.
1992.
Evidence for immune selection of hepatitis C virus (HCV) putative envelope glycoprotein variants: potential role in chronic HCV infections.
Proc. Natl. Acad. Sci. USA
89:3468-3472 |
| 74. | Wolinsky, S. M., B. T. M. Korber, A. U. Neumann, M. Daniels, K. J. Kunstman, A. J. Whetsell, M. R. Furtado, Y. Cao, D. D. Ho, J. T. Safrit, and R. A. Koup. 1996. Adaptative evolution of human immunodeficiency virus type 1 during the natural course of infection. Science 272:537-542[Abstract]. |
| 74a. | Wong, D., M. J. Koziel, and B. D. Walker. Personal communication. |
| 75. | Yamashita, T., Y. Shirota, S. Kaneko, K. Kobayashi, and S. Murakami. 1997. RNA-dependent RNA polymerase activity of purified bacterial recombinant hepatitis C virus (HCV) NS5B and its binding activity to HCV NS5A, p. 35. Abstracts of the 4th International Meeting on Hepatitis C Virus and Related Viruses . |
| 76. | Zeuzem, S., J. H. Lee, and W. K. Roth. 1997. Mutations in the nonstructural 5A gene of European hepatitis C virus isolates and response to interferon alfa. Hepatology 25:740-744[Medline]. |
| 77. | Zeuzem, S., J. M. Schmidt, J. H. Lee, B. Rüster, and W. K. Roth. 1996. Effect of interferon alfa on the dynamics of hepatitis C virus turnover in vivo. Hepatology 23:366-371[Medline]. |
J Virol, April 1998, p. 2795-2805, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Pawlotsky, J.-M.
(2009). Review: Therapeutic implications of hepatitis C virus resistance to antiviral drugs. Therapeutic Advances in Gastroenterology
2: 205-219
[Abstract] -
Sanz-Ramos, M., Diaz-San Segundo, F., Escarmis, C., Domingo, E., Sevilla, N.
(2008). Hidden Virulence Determinants in a Viral Quasispecies In Vivo. J. Virol.
82: 10465-10476
[Abstract] [Full Text] -
Masaki, T., Suzuki, R., Murakami, K., Aizaki, H., Ishii, K., Murayama, A., Date, T., Matsuura, Y., Miyamura, T., Wakita, T., Suzuki, T.
(2008). Interaction of Hepatitis C Virus Nonstructural Protein 5A with Core Protein Is Critical for the Production of Infectious Virus Particles. J. Virol.
82: 7964-7976
[Abstract] [Full Text] -
Wohnsland, A., Hofmann, W. P., Sarrazin, C.
(2007). Viral Determinants of Resistance to Treatment in Patients with Hepatitis C. Clin. Microbiol. Rev.
20: 23-38
[Abstract] [Full Text] -
Puig-Basagoiti, F., Forns, X., Furcic, I., Ampurdanes, S., Gimenez-Barcons, M., Franco, S., Sanchez-Tapias, J. M., Saiz, J.-C.
(2005). Dynamics of hepatitis C virus NS5A quasispecies during interferon and ribavirin therapy in responder and non-responder patients with genotype 1b chronic hepatitis C. J. Gen. Virol.
86: 1067-1075
[Abstract] [Full Text] -
Chambers, T. J., Fan, X., Droll, D. A., Hembrador, E., Slater, T., Nickells, M. W., Dustin, L. B., DiBisceglie, A. M.
(2005). Quasispecies Heterogeneity within the E1/E2 Region as a Pretreatment Variable during Pegylated Interferon Therapy of Chronic Hepatitis C Virus Infection. J. Virol.
79: 3071-3083
[Abstract] [Full Text] -
Tellinghuisen, T. L., Marcotrigiano, J., Gorbalenya, A. E., Rice, C. M.
(2004). The NS5A Protein of Hepatitis C Virus Is a Zinc Metalloprotein. J. Biol. Chem.
279: 48576-48587
[Abstract] [Full Text] -
Martell, M., Briones, C., de Vicente, A., Piron, M., Esteban, J. I., Esteban, R., Guardia, J., Gomez, J.
(2004). Structural analysis of hepatitis C RNA genome using DNA microarrays. Nucleic Acids Res
32: e90-e90
[Abstract] [Full Text] -
Alfonso, V., Flichman, D. M., Sookoian, S., Mbayed, V. A., Campos, R. H.
(2004). Evolutionary study of HVR1 of E2 in chronic hepatitis C virus infection. J. Gen. Virol.
85: 39-46
[Abstract] [Full Text] -
Castet, V., Fournier, C., Soulier, A., Brillet, R., Coste, J., Larrey, D., Dhumeaux, D., Maurel, P., Pawlotsky, J.-M.
(2002). Alpha Interferon Inhibits Hepatitis C Virus Replication in Primary Human Hepatocytes Infected In Vitro. J. Virol.
76: 8189-8199
[Abstract] [Full Text] -
Cabot, B., Martell, M., Esteban, J. I., Piron, M., Otero, T., Esteban, R., Guardia, J., Gomez, J.
(2001). Longitudinal Evaluation of the Structure of Replicating and Circulating Hepatitis C Virus Quasispecies in Nonprogressive Chronic Hepatitis C Patients. J. Virol.
75: 12005-12013
[Abstract] [Full Text] -
Lusida, M. I., Nagano-Fujii, M., Nidom, C. A., Soetjipto, , Handajani, R., Fujita, T., Oka, K., Hotta, H.
(2001). Correlation between Mutations in the Interferon Sensitivity-Determining Region of NS5A Protein and Viral Load of Hepatitis C Virus Subtypes 1b, 1c, and 2a. J. Clin. Microbiol.
39: 3858-3864
[Abstract] [Full Text] -
Hall, J. S., French, R., Morris, T. J., Stenger, D. C.
(2001). Structure and Temporal Dynamics of Populations within Wheat Streak Mosaic Virus Isolates. J. Virol.
75: 10231-10243
[Abstract] [Full Text] -
Samuel, C. E.
(2001). Antiviral Actions of Interferons. Clin. Microbiol. Rev.
14: 778-809
[Abstract] [Full Text] -
Polyak, S. J., Khabar, K. S. A., Paschal, D. M., Ezelle, H. J., Duverlie, G., Barber, G. N., Levy, D. E., Mukaida, N., Gretch, D. R.
(2001). Hepatitis C Virus Nonstructural 5A Protein Induces Interleukin-8, Leading to Partial Inhibition of the Interferon-Induced Antiviral Response. J. Virol.
75: 6095-6106
[Abstract] [Full Text] -
Polyak, S. J., Khabar, K. S. A., Rezeiq, M., Gretch, D. R.
(2001). Elevated Levels of Interleukin-8 in Serum Are Associated with Hepatitis C Virus Infection and Resistance to Interferon Therapy. J. Virol.
75: 6209-6211
[Abstract] [Full Text] -
Arias, A., Lázaro, E., Escarmís, C., Domingo, E.
(2001). Molecular intermediates of fitness gain of an RNA virus: characterization of a mutant spectrum by biological and molecular cloning. J. Gen. Virol.
82: 1049-1060
[Abstract] [Full Text] -
Mao, Q., Ray, S. C., Laeyendecker, O., Ticehurst, J. R., Strathdee, S. A., Vlahov, D., Thomas, D. L.
(2001). Human Immunodeficiency Virus Seroconversion and Evolution of the Hepatitis C Virus Quasispecies. J. Virol.
75: 3259-3267
[Abstract] [Full Text] -
Harris, K. A., Teo, C. G.
(2001). Diversity of Hepatitis C Virus Quasispecies Evaluated by Denaturing Gradient Gel Electrophoresis. CVI
8: 62-73
[Abstract] [Full Text] -
Nousbaum, J.-B., Polyak, S. J., Ray, S. C., Sullivan, D. G., Larson, A. M., Carithers, R. L. Jr., Gretch, D. R.
(2000). Prospective Characterization of Full-Length Hepatitis C Virus NS5A Quasispecies during Induction and Combination Antiviral Therapy. J. Virol.
74: 9028-9038
[Abstract] [Full Text] -
White, P. A., Zhai, X., Carter, I., Zhao, Y., Rawlinson, W. D.
(2000). Simplified Hepatitis C Virus Genotyping by Heteroduplex Mobility Analysis. J. Clin. Microbiol.
38: 477-482
[Abstract] [Full Text] -
Leyssen, P., De Clercq, E., Neyts, J.
(2000). Perspectives for the Treatment of Infections with Flaviviridae. Clin. Microbiol. Rev.
13: 67-82
[Abstract] [Full Text] -
Sandres, K., Dubois, M., Pasquier, C., Payen, J. L., Alric, L., Duffaut, M., Vinel, J. P., Pascal, J. P., Puel, J., Izopet, J.
(2000). Genetic Heterogeneity of Hypervariable Region 1 of the Hepatitis C Virus (HCV) Genome and Sensitivity of HCV to Alpha Interferon Therapy. J. Virol.
74: 661-668
[Abstract] [Full Text] -
Cabot, B., Martell, M., Esteban, J. I., Sauleda, S., Otero, T., Esteban, R., Guàrdia, J., Gómez, J.
(2000). Nucleotide and Amino Acid Complexity of Hepatitis C Virus Quasispecies in Serum and Liver. J. Virol.
74: 805-811
[Abstract] [Full Text] -
Oliver Koch, J., Bartenschlager, R.
(1999). Modulation of Hepatitis C Virus NS5A Hyperphosphorylation by Nonstructural Proteins NS3, NS4A, and NS4B. J. Virol.
73: 7138-7146
[Abstract] [Full Text] -
Pawlotsky, J.-M., Germanidis, G., Frainais, P.-O., Bouvier, M., Soulier, A., Pellerin, M., Dhumeaux, D.
(1999). Evolution of the Hepatitis C Virus Second Envelope Protein Hypervariable Region in Chronically Infected Patients Receiving Alpha Interferon Therapy. J. Virol.
73: 6490-6499
[Abstract] [Full Text] -
Gale, M. Jr., Kwieciszewski, B., Dossett, M., Nakao, H., Katze, M. G.
(1999). Antiapoptotic and Oncogenic Potentials of Hepatitis C Virus Are Linked to Interferon Resistance by Viral Repression of the PKR Protein Kinase. J. Virol.
73: 6506-6516
[Abstract] [Full Text] -
Ray, S. C., Wang, Y.-M., Laeyendecker, O., Ticehurst, J. R., Villano, S. A., Thomas, D. L.
(1999). Acute Hepatitis C Virus Structural Gene Sequences as Predictors of Persistent Viremia: Hypervariable Region 1 as a Decoy. J. Virol.
73: 2938-2946
[Abstract] [Full Text] -
Neumann, A. U., Lam, N. P., Dahari, H., Gretch, D. R., Wiley, T. E., Layden, T. J., Perelson, A. S.
(1998). Hepatitis C Viral Dynamics in Vivo and the Antiviral Efficacy of Interferon- Therapy. Science
282: 103-107
[Abstract] [Full Text] -
Wang, Y.-M., Ray, S. C., Laeyendecker, O., Ticehurst, J. R., Thomas, D. L.
(1998). Assessment of Hepatitis C Virus Sequence Complexity by Electrophoretic Mobilities of Both Single-and Double-Stranded DNAs. J. Clin. Microbiol.
36: 2982-2989
[Abstract] [Full Text]
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Copyright © 2009 by the American Society for Microbiology. For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»