Previous Article | Next Article 
J Virol, April 1998, p. 2723-2732, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The I Domain Is Required for Efficient Plasma
Membrane Binding of Human Immunodeficiency Virus Type 1 Pr55Gag
Stephanie
Sandefur,
Vasundhara
Varthakavi, and
Paul
Spearman*
Departments of Pediatrics and Microbiology
and Immunology, Vanderbilt University, Nashville, Tennessee 37232-2581
Received 24 September 1997/Accepted 24 December 1997
 |
ABSTRACT |
The interaction of the human immunodeficiency virus type 1 (HIV-1)
Pr55Gag molecule with the plasma membrane of an infected
cell is an essential step of the viral life cycle. Myristic acid and
positively charged residues within the N-terminal portion of MA
constitute the membrane-binding domain of Pr55Gag. A
separate assembly domain, termed the interaction (I) domain, is located
nearer the C-terminal end of the molecule. The I domain is required for
production of dense retroviral particles, but has not previously been
described to influence the efficiency of membrane binding or the
subcellular distribution of Gag. This study used a series of Gag-green
fluorescent protein fusion constructs to define a region outside of MA
which determines efficient plasma membrane interaction. This function
was mapped to the nucleocapsid (NC) region of Gag. The minimal region
in a series of C-terminally truncated Gag proteins conferring plasma
membrane fluorescence was identified as the N-terminal 14 amino acids
of NC. This same region was sufficient to create a density shift in
released retrovirus-like particles from 1.13 to 1.17 g/ml. The
functional assembly domain previously termed the I domain is thus
required for the efficient plasma membrane binding of Gag, in addition
to its role in determining the density of released particles. We
propose a model in which the I domain facilitates the interaction of
the N-terminal membrane-binding domain of Pr55Gag with the
plasma membrane.
 |
INTRODUCTION |
The assembly of human
immunodeficiency virus (HIV) particles occurs on the cytoplasmic face
of the plasma membrane of infected cells. Interactions between HIV type
1 (HIV-1) Pr55Gag and cellular membranes are mediated
through the N-terminal membrane-binding domain of Gag. This domain
consists of myristic acid as well as regions of the matrix protein (MA)
downstream from the myristylation site (40, 47). Ionic
interactions between negatively charged membrane phospholipids and
positively charged residues within the first 31 amino acids of MA
contribute to the stability of membrane binding. The MA region of Gag
is also essential for plasma membrane targeting of Gag, as demonstrated
by studies using mutagenesis of MA which redirected the site of
particle assembly from the plasma membrane to intracellular locations
(16, 18, 40, 46). However, results of membrane-binding
studies performed with mammalian cells and with cell-free systems have
demonstrated that MA interacts with membranes less efficiently than the
intact Pr55Gag molecule (39, 48). Moreover,
Pr55Gag was found by immunofluorescence localization at
discrete plasma membrane sites, while MA was predominantly
intracellular and cytoplasmic in distribution (39).
The Pr55Gag molecule is cleaved in the maturing particle by
the viral protease to produce the major cleavage products MA, capsid (CA), nucleocapsid (NC), and p6 (22, 42). Small peptide
sequences, termed spacer peptides 1 and 2 (SP1 and SP2), are also
present between CA and NC (SP1) and between NC and p6 (SP2) (26,
29, 35). The structure of NC as determined by molecular modeling based on nuclear magnetic resonance spectroscopy data consists of a
central globular domain flanked by flexible N- and C-terminal domains
(11, 31). The central globular region is made up of two zinc
finger domains separated by the highly basic linker RAPRKKG. NC plays
multiple roles in the viral life cycle, including an essential role in
genomic RNA encapsidation and dimerization (4, 5, 9, 10, 24, 33,
37), annealing of the tRNA to its binding site on the viral RNA
(2, 12, 38), and strand transfer during reverse
transcription (1, 34). The NC portion of Pr55Gag
also plays a role in particle assembly. Gag molecules lacking p6 and
most of NC remain competent for particle formation, but truncation at
the level of the CA-NC junction eliminates particle formation
(27). An assembly domain termed the interaction (I) domain
which is required for the formation of dense retroviral particles has
been identified within NC. Studies with Rous sarcoma virus (RSV)
Pr76Gag indicate that mutants lacking this assembly domain
release particles of abnormally light density and that domains within
the HIV-1 NC can substitute for the RSV I domain in allowing the
formation of particles of authentic retroviral density (3,
44). Two separate subdomains of HIV-1 NC, each containing a zinc
finger motif, are capable of conferring dense particle formation upon RSV Gag (3). The mechanism underlying the dense particle
formation mediated by the I domain is unknown, although it has been
postulated that this region itself may be involved in the tight packing
of Gag molecules in the developing particle (3).
The existence of an assembly domain within Pr55Gag but
outside of MA which increases the efficiency of membrane binding has
been suggested by previous work (39). The present study was
undertaken to determine the location of this proposed domain within
Pr55Gag, to define its relationship, if any, to the
previously described I domain, and to determine if this same domain
influences the intracellular versus plasma membrane distribution of
Gag. A small region in the N-terminal one-third of NC was determined to
be sufficient to confer plasma membrane distribution of Gag in the context of the myristylated N-terminal sequences. Membrane-binding efficiency was significantly increased by this same domain. The appearance of Gag protein on the plasma membrane by fluorescence microscopic studies correlated precisely with the shift in released retroviruslike particles from low- to high-density particles which defines the I domain. The formation of dense particles mediated by the
I domain did not require the zinc finger motifs or the basic linker
region of NC, although inclusion of these regions contributed to
overall membrane-binding efficiency. We conclude that the I domain of
HIV-1 contributes significantly to the efficiency of plasma membrane
binding and to the subcellular appearance of Gag at the plasma membrane
in addition to allowing packing of Gag molecules to form retroviruslike
particles of native density.
 |
MATERIALS AND METHODS |
Construction of plasmids expressing Gag-GFP fusion proteins.
Gag protein expression constructs fused to a human codon-optimized form
of green fluorescence protein (GFP) were used in this study. The Gag
coding sequences for all constructs were derived from the full-length
proviral DNA clone HXB2gpt. The GFP sequence originated from plasmids
pEGFP-N2 or pEGFP-N3 (Clontech, Palo Alto, Calif.). Plasmids pTM1 and
pTM3, which employ the T7 promoter and the untranslated region from
encephalomyocarditis virus for cap-independent translation of mRNA,
were used for all expression plasmid construction (32). For
all Gag expression constructs except GAGP/GFP and GAGB/GFP, PCR cloning
was used to generate gag gene fragments with an
NcoI site at the 5' ATG and a BamHI site at the
3' fusion site. The resulting PCR product was ligated into pTM1, using
the NcoI and BamHI sites of the polylinker region to generate intermediate cloning constructs. GFP fusion constructs were
then generated from the appropriate enhanced GFP vector by digestion
with BamHI and NotI and ligation of the
BamHI-NotI GFP cassette into the pTM/Gag
intermediate construct digested with BamHI and
EagI. GAGP/GFP and GAGB/GFP were constructed from the previously described expression construct p55G1, which contains the
HXB2 gag gene in a pTM3 backbone, through ligation of the GFP cassette from pEGFP-N3 or pEGFP-N2 into the PstI or
BglII site, respectively, of the gag gene within
p55G1 (40). The expression plasmid design allows production
of full-length MA fused to GFP (MA/GFP), the MA and CA regions of Gag
up the C-terminal CA proteolytic cleavage site (final Gag residue,
Leu-363) fused to GFP (MACA/GFP), and full-length Gag fused to GFP
(55GAG/GFP), as well as intermediate fusion sites within the N-terminal
portion of CA (GAGP/GFP) and within SP2 which follows NC (GAGB/GFP).
The amino acid number of the last intact gag codon for each
fusion construct is indicated at the fusion site in Fig.
1A and shown directly in Fig. 1B, with the numbering beginning with the gag initiator ATG (Met-1).
Use of the BamHI site from the pEGFP-N vectors placed a
short amino acid sequence corresponding to codons of the polylinker
region between the Gag protein and the GFP initiator methionine codon (Gly-Ile-His-Arg-Pro-Val-Ala-Thr for MA/GFP; Gly-Ser-Ile-Ala-Thr for
55GAG/GFP, MACA/GFP, GAG377/GFP, GAG391/GFP, GAG405/GFP, and GAG411/GFP; and slightly larger intervening sequences for
GAGB/GFP and GAGP/GFP). A myristylation-deficient construct (myr
GAGB/GFP) was constructed by transfer of an
NcoI-PstI fragment from plasmid p55A1, which
contains a mutation of the N-terminal glycine codon to alanine, into
the identical position within GAGB/GFP. The GFP expression plasmid was
generated by ligation of the 724-bp NcoI-NotI fragment containing the gfp gene from pEGFP-N2 into pTM1
which had been digested with NcoI and EagI. All
Gag-GFP fusions were completely sequenced through the Gag open reading
frame and across the fusion boundary to confirm correct construction.

View larger version (25K):
[in this window]
[in a new window]
|
FIG. 1.
Construction of Gag-GFP chimeric constructs. (A) The
initial panel of Gag-GFP constructs. Shaded regions represent the
27-kDa GFP protein fused to truncated or full-length HIV Gag protein
(open bars). The number above the fusion site represents the C-terminal
Gag residue expressed (numbered from the amino acid sequence of HXB2CG,
with the initiator methionine as residue 1). Note that GAGB/GFP and
GAGP/GFP utilize restriction sites as the sites of truncation of Gag
and fusion to GFP; fusion sites for the other constructs were created
at proteolytic cleavage sites (MA/GFP and MACA/GFP) or following the
final residue of Gag (55GAG/GFP) by PCR cloning techniques. (B) Gag-GFP
chimeric constructs subdividing HIV NC. Asterisks indicate the sites of
Gag truncation and fusion with GFP; numbering is as in panel A. Cleavage sites used by HIV protease are indicated by arrows.
|
|
Oligonucleotides used in the above-described constructions were
GAAGGAGAGCCATGGGTGCGAGAGCG (N-terminal MA oligonucleotide,
all Gag-GFP fusion constructs except myr

GAGB/GFP),
AGAGCCATGGCTGCGAGAGCGTCAGTA
(N-terminal MA oligonucleotide,
myr

GAGB/GFP), CGCGGATCCCGTAATTTTGGCTGACCTGATT
(MA/GFP,
C-terminal fusion), GGTGGATCCCAAAACTCTTGCCTTATG (MACA/GFP),
CGGGATCCA TTATGGTAGCTGAATTTG (GAG377/GFP),
GGTGGATCCCTTAACAA TCTTTCTTTG
(GAG391/GFP),
GGTGGATCCGCAATTTCTGGCTGTGTG (GAG405/GFP),
GGTGGATCCCTTTTTCCTAGGGGCCCTG
(GAG411/GFP), and
TTGGATCCTTGTGACGAGGGGTC (55GAG/GFP).
Expression of Gag-GFP fusion proteins.
The vaccinia virus-T7
RNA polymerase hybrid system was used to express Gag-GFP fusion
proteins in the African green monkey kidney cell line BSC-40 as
previously described (39, 40). T7 RNA polymerase was
provided by infection with 10 PFU of the recombinant vaccinia virus VTF
7-3 per cell. Cells were grown in 100-mm3 tissue culture
dishes for subcellular fractionation experiments or on glass coverslips
within 35-mm3 dishes for microscopic analysis. Cells were
examined by microscopy or collected for analysis at 4 to 5 h
posttransfection unless otherwise indicated.
Conventional epifluorescence and laser confocal fluorescence
microscopy.
Living cells expressing Gag-GFP fusion proteins and
grown on glass coverslips in 35-mm3 dishes were
photographed without fixation by using a Nikon Diaphot inverted
microscope equipped for epifluorescence photomicrography (Nikon, Tokyo,
Japan). Confocal microscopy was performed in a similar manner, using a
Zeiss LSM410 confocal laser scanning microscope (Carl Zeiss, Thornwood,
N.Y.) equipped for simultaneous fluorescence and Nomarski differential
interference contrast (DIC) imaging and optical sectioning with
three-dimensional z-plane reconstruction. Images were
reconstructed by using Zeiss LSM software, and levels were adjusted
with Adobe Photoshop version 4.0 for Macintosh (Adobe Systems, Mountain
View, Calif.). Photomicrographs were obtained from cells which were
representative of the subcellular distribution observed in at least
80% of the fluorescing cells examined during three independent
experiments with each construct.
Subcellular fractionation and quantitation of protein.
BSC-40 cells grown in 100-mm3 plates and expressing Gag-GFP
fusion proteins were harvested 4 to 5 h posttransfection and
processed for differential sedimentation centrifugation as previously
described (40). Briefly, cells were subjected to Dounce
homogenization in 1 ml of hypotonic buffer with protease inhibitors and
then centrifuged at 1,000 × g for 10 min to remove
unbroken cells and nuclei. Supernatants containing cytosolic components
and cellular membranes were subjected to centrifugation at 100,000 × g for 30 min in a Sorvall RCM120EX microultracentrifuge.
Soluble and membrane pellet fractions were collected and analyzed by
Western blotting or by fluorescence spectrophotometry. Samples for
Western blotting were immunoprecipitated with pooled HIV patient sera, separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred to nitrocellulose, and detected with monoclonal antibodies directed against HIV MA. Supernatants and pellets for quantitation were adjusted to 0.5% Triton X-100 in NTE buffer (100 mM
NaCl, 10 mM Tris [pH 8.0], 1 mM EDTA); vigorous vortexing of the
membrane/cytoskeletal pellet was required for generation of a uniform
suspension. Standards of recombinant EGFP (Clontech) were prepared in
the same solution. Four serial 10-fold dilutions were prepared
beginning from an initial concentration of 1 µg/ml, and fluorescence
was measured to generate a standard curve. Fluorescence intensity of
Gag-GFP samples and of standards was determined with a Perkin-Elmer
(Foster City, Calif.) model 650-40 fluorescence spectrophotometer with
an excitation filter of 450 nm and emission filter of 510 nm. The
percentage of membrane-bound protein in each experiment was calculated
as protein in membrane pellet/protein in pellet plus protein in soluble
fraction.
Equilibrium density measurements of Gag-GFP pseudovirions.
Gag-GFP fusion proteins were produced in BSC-40 cells as described
above. HIV-1 strain H9/IIIB (III B) cells were obtained from Robert
Gallo through the NIH/NIAID AIDS Research and Reference Reagent Program
and maintained in RPMI medium supplemented with 10% fetal bovine sera
and antibiotics. Culture medium was removed 3 to 4 h
posttransfection and replaced with Dulbecco Modified Eagle medium
deficient in cysteine and methionine and supplemented with 200 µCi of
[35S]cysteine-methionine per ml. Following an overnight
incubation, supernatants were collected, layered on top of a 20%
sucrose cushion in NTE, and subjected to centrifugation at 100,000 × g for 60 min. The media and cushion were removed; the
pelleted material was resuspended in NTE and layered on the top of a
linear 20 to 60% (wt/vol) sucrose gradient. The gradient and pelleted
material were subjected to centrifugation at 100,000 × g for 16 h, after which equal fractions were collected.
Ninety percent of each fraction was used for immunoprecipitation with
pooled HIV patient sera, separation via SDS-PAGE, and autoradiographic
analysis. The remaining 10% was saved and used for meticulous
determination of sucrose density with a refractometer. Analysis of
autoradiograms was accompanied in some cases by scanning of the film on
a flatbed scanner with a transparency adapter and quantitation of the
relative density of the bands by using NIH Image software, version
1.61.
 |
RESULTS |
Design of Gag-GFP fusion constructs.
To define the differences
in subcellular distribution exhibited by HIV-1 Pr55Gag and
HIV-1 MA, we adopted a Gag-GFP fusion approach. This approach was taken
to allow simultaneous and rapid subcellular localization by
fluorescence microscopy and quantitation of protein in subcellular fractions generated by differential sedimentation centrifugation. Fusion proteins were constructed with Gag proteins fused to the N
terminus of GFP so that the myristylated N terminus of Gag was preserved. An initial series of Gag-GFP fusions was generated to
identify the region(s) responsible for the enhanced membrane binding
and plasma membrane localization of Pr55Gag compared to MA
(Fig. 1A). Four additional constructs were designed to further refine
the region between MACA/GFP and GAGB/GFP following initial results
(Fig. 1B). We used the vaccinia virus-T7 expression system because of
its proven utility in subcellular fractionation studies of retroviral
Gag proteins and for its ability to readily produce Gag retroviruslike
particles which are released into the cellular supernatant (13,
39, 40).
Differential membrane binding of Gag proteins.
Previous work
has demonstrated that HIV-1 Pr55Gag binds more efficiently
to cellular or phospholipid vesicle membranes than MA (39, 40,
48). To validate the Gag-GFP fusion strategy for identification
of the domains outside of MA which contribute this membrane-binding
efficiency, the cytosolic versus membrane-associated distribution of a
full-length Pr55Gag molecule fused to GFP (55GAG/GFP) was
compared to that of MA fused to GFP (MA/GFP), using differential
sedimentation centrifugation. Western blot analysis demonstrated that
most of 55GAG/GFP sedimented with the membrane pellet, consistent with
previous results (Fig. 2A). The
distribution of MA/GFP was markedly different, with more protein
present in the soluble fraction. To obtain more accurate quantitation
of this result, the quantity of fusion protein present in the soluble
and pellet fractions from identically transfected plates harvested at
three separate timepoints was measured by fluorometric quantitation
methods (Fig. 2B). The percentage of 55GAG/GFP in the pelleted fraction
varied from 74 to 84%, while the percentage of MA/GFP in the membrane
pellet ranged from 14 to 18%. Remarkably, the difference in percentage
of membrane-bound protein between the full-length Gag construct and the
MA construct varied very little over time (Fig. 2B). The total amount
of Gag protein present at the 5- and 30-h time points differed
dramatically in this experiment, from 27 ng/100-mm3 plate
at 5 h to 221 ng/100-mm3 plate at 30 h for MA/GFP
and from 6 ng/100-mm3 plate at 5 h to 121 ng/100-mm3 plate at 30 h for 55GAG/GFP. Thus, the
difference in efficiency of membrane binding between the full-length
Gag and MA constructs was consistent over a wide range of protein
concentration and did not vary significantly with time.

View larger version (33K):
[in this window]
[in a new window]
|
FIG. 2.
Differential sedimentation analysis of Gag-GFP fusion
constructs. (A) Western blot of soluble (S) and pellet (P) fractions
from cells expressing 55GAG/GFP and MA/GFP. The positions of molecular
mass markers are indicated in kilodaltons at the left. (B) Quantitation
of Gag-GFP membrane binding by fluorescence spectrophotometry. Results
of differential sedimentation for identically transfected cells
collected at three different time points are shown. Percent
membrane-bound protein was calculated as protein in membrane-enriched
pellet/protein in pellet plus protein in supernatant.
|
|
Differential subcellular localization of Gag proteins.
The MA
region of Pr55Gag has been demonstrated to be essential for
plasma membrane targeting of the precursor polyprotein and for
efficient particle assembly (18, 39, 40, 46). Myristic acid
plays a key role in this process, along with additional domain(s) within MA. We recently observed, however, that the specific plasma membrane localization of Pr55Gag was not demonstrated when
the Gag cleavage product MA was produced within mammalian cells
(39). To determine the relationship of the subcellular
localization of Gag to the membrane-binding studies illustrated above,
we created a panel of Gag-GFP fusion constructs spanning the region
from the end of MA (MA/GFP) to full-length Pr55Gag
(55GAG/GFP). The subcellular distribution of the fusion constructs within living cells was examined by epifluorescence microscopy (Fig.
3). A control plasmid expressing GFP
alone revealed bright cytoplasmic fluorescence (Fig. 3A). Fusion
constructs expressing MA, MA and the N-terminal segment of CA, and all
of MA and CA also demonstrated a diffuse intracellular fluorescence
pattern (Fig. 3B to D). A marked difference in subcellular localization was noted with GAGB/GFP, which exhibited bright, punctate membrane fluorescence (Fig. 3E). Similarly, 55GAG/GFP was found in a plasma membrane distribution, with little intracellular fluorescence (Fig.
3F).

View larger version (97K):
[in this window]
[in a new window]
|
FIG. 3.
Epifluorescence microscopy of BSC-40 cells expressing
the Gag-GFP fusion constructs. Photographs were obtained 5 h after
transfection with the indicated Gag-GFP expression plasmid. Photographs
were taken of unfixed cells attached to a glass coverslip and are
representative of more than 80% of Gag-GFP-expressing cells viewed for
each construct. (A) GFP control; (B) MA/GFP; (C) GAGP/GFP; (D)
MACA/GFP; (E) GAGB/GFP; (F) 55GAG/GFP.
|
|
Laser confocal microscopy was next performed to verify the results of
the epifluorescence studies and to obtain localization
data in three
dimensions. Serial 1- to 2- µm two-dimensional images
through cells
expressing each Gag-GFP construct were obtained.
The data were then
used to construct a view of Gag protein intracellular
distribution in
the third dimension. A representative image from
optical sectioning of
a cell expressing MACA/GFP is shown in Fig.
4A. The diffuse cytoplasmic fluorescence
pattern previously observed
by conventional wide-field epifluorescence
microscopy was confirmed,
as represented by the bottom image (the
x-y plane). Analysis of
a reconstructed optical slice in the
third dimension (the
z plane)
through this cell is presented
at the top of Fig.
4A. This technique
also revealed diffuse cytoplasmic
fluorescence and lack of peripheral
signal. In contrast, 55GAG/GFP
analyzed in a similar manner demonstrated
a peripheral pattern in all
three dimensions (Fig.
4B). To further
demonstrate the differential
distribution of these constructs,
we used a combination of laser
confocal sectioning and Nomarski
DIC microscopy. The appearance of
GAGB/GFP is shown with this
technique in Fig.
4C as bright peripheral
signal. MA/GFP was again
demonstrated to be cytoplasmic in distribution
(Fig.
4D). Inclusion
of the region of Gag between MACA/GFP and GAGB/GFP
(Fig.
1B) thus
resulted in a marked change in subcellular distribution
of GFP
fluorescence. To determine whether the plasma membrane
distribution
influenced by this region was dependent on myristylation
of the
N terminus of Gag, a similar analysis was carried out with a
myristylation-deficient
mutant construct (myr

GAGB/GFP). Elimination
of the myristylation
of Gag resulted in the complete loss of the
membrane fluorescence
pattern (Fig.
4E). The punctate nature of the
peripheral staining
pattern of 55GAG/GFP was confirmed by obtaining
1-µm sections
through the attachment site of the cell to the
coverglass. As
shown in Fig.
4F, the Gag-GFP fusion proteins localize
to focal
regions along this attachment plane.

View larger version (89K):
[in this window]
[in a new window]
|
FIG. 4.
Laser scanning confocal microscopy of BSC-40 cells
expressing Gag-GFP constructs. Digital images of living cells were
acquired with a Zeiss LSM410 laser confocal microscope; reconstructed
views were created by using Zeiss LSM software, version 3.84. (A)
Confocal reconstructed view of a series of optical sections of MACA/GFP
(bottom). The line indicates plane used for reconstructing the
z-plane section (top). (B) Confocal section of cell
expressing 55GAG/GFP (bottom). The line indicates plane of optical
z section displayed on top of the figure. (C) Confocal and
transmission DIC image, GAGB/GFP represented by bright peripheral
signal. (D) Confocal and transmission DIC image, MA/GFP. (E) Confocal
and transmission DIC image, myr GAGB/GFP. (F) Confocal section from a
series of 1-µm optical sections corresponding to the plane of the
coverslip, 55GAG/GFP.
|
|
Mapping the domain within NC essential for plasma membrane
localization.
Four additional Gag-GFP constructs were generated in
order to define the region between MACA/GFP and GAGB/GFP which
contributed the difference in plasma membrane fluorescence pattern
described above. The additional Gag-GFP fusion constructs were designed to test whether inclusion of SP1 was sufficient to confer plasma membrane localization (GAG377/GFP), if the N-terminal portion of NC was
sufficient to confer plasma membrane localization (GAG391/GFP), or if
the first zinc finger (GAG405/GFP), first zinc finger and basic linker
region (GAG411/GFP), or both zinc fingers and the C-terminal region
(GAGB/GFP) of NC were required. Representative epifluorescence
microscopy findings are presented in Fig.
5. SP1 did not confer plasma membrane
localization, as no plasma membrane staining was observed with
GAG377/GFP (Fig. 5A). A marked difference was noted with GAG391/GFP,
demonstrating a bright peripheral signal (Fig. 5B). Distinctive plasma
membrane fluorescence was evident also for GAG405/GFP, GAG411/GFP, and
GAGB/GFP (Fig. 5C, D, and E, respectively). It should be noted that
although the peripheral pattern of fluorescence with all three of the
constructs containing a fusion site downstream of GAG377/GFP was
striking, there was noticeably more intracellular cytoplasmic
fluorescence with these intermediate constructs than with GAGB/GFP. The
pattern of subcellular distribution varied from entirely cytoplasmic
fluorescence (GAG377/GFP) to plasma membrane and cytoplasmic signal
(GAG391/GFP, GAG405/GFP, and GAG411/GFP) to almost entirely plasma
membrane fluorescence (GAGB/GFP). This finding is best illustrated by
comparing Fig. 5C (GAG405/GFP) to Fig. 5E or F (GAGB/GFP). Figure 5F
illustrates the marked peripheral fluorescence pattern of cells
expressing GAGB/GFP which had detached from the glass coverslip. No
apparent quenching of GFP fluorescence at membrane surfaces was noted
in these experiments, although some alteration of the relative signal intensity in a particular subcellular compartment cannot be excluded. Quantitation of the transition from cytoplasmic to plasma membrane fluorescence with the addition of portions of NC was not attempted from
the microscopic images but was instead carried out with differential sedimentation experiments described below.

View larger version (88K):
[in this window]
[in a new window]
|
FIG. 5.
Epifluorescence microscopy of Gag-GFP fusion constructs
from Fig. 1B. Acquisition of images was as for Fig. 3. (A) GAG377/GFP;
(B) GAG391/GFP; (C) GAG405/GFP; (D) GAG411/GFP; (E) GAGB/GFP; (F) cell
expressing GAGB/GFP which separated from the coverglass and assumed a
round conformation.
|
|
Defining the contribution of domains within NC to efficient
membrane binding.
Our experiments using fluorescence microscopy
revealed that focal plasma membrane staining was absent in constructs
containing MA or MA and CA alone but present in constructs containing
the N-terminal third of NC. We next used the panel of Gag-GFP
constructs to determine whether the domain conferring plasma membrane
distribution by microscopy was also responsible for the efficiency of
membrane binding as measured by differential sedimentation
centrifugation. Membrane- and cytoskeleton-enriched fractions were
separated from soluble cytosolic components by differential
sedimentation centrifugation, and the amount of Gag-GFP fusion protein
in the fractions quantified by fluorescence spectrophotometry. The
markedly higher percentage of membrane-bound 55GAG/GFP compared to
MA/GFP was again demonstrated (Fig. 6).
No significant increase in membrane-bound protein was found with
inclusion of the N-terminal portion of CA (GAGP/GFP). Extension of the
Gag sequence to include all of MA and CA (MACA/GFP) or MA, CA, and SP1
(GAG377/GFP) resulted in only a slight increase in the percentage of
membrane-bound protein. In contrast, the addition of the N-terminal 14 amino acids of NC (GAG391/GFP) resulted in a significant increase in
membrane-bound Gag protein, from a mean of 25% membrane-bound Gag
protein (GAG377/GFP) to 45%. A second significant increase in the
percentage of membrane-bound Gag-GFP protein occurred with
the addition of the six-amino-acid linker region RAPRKK,
represented by GAG411/GFP. Addition of this small linker led to an
increase in membrane-bound Gag protein from 55 to 78% (mean values).
It must be noted that the optimal membrane-binding construct in this
study measured in this manner was GAGB/GFP, which includes the entire
NC region but lacks p6. However, as is evident in Fig.
7A and B, 55GAG/GFP was more efficiently released from cells than GAGB/GFP, which may have altered the total
amount of membrane-bound protein measured. Thus, the efficient membrane
binding of myristylated Pr55Gag was mapped to the NC
region. Although the N-terminal portion and basic linker regions of NC
contributed the greatest increases in membrane binding, optimal
membrane binding required the presence of the entire NC sequence.

View larger version (64K):
[in this window]
[in a new window]
|
FIG. 6.
Quantitation of membrane binding of Gag-GFP fusion
constructs. The protein content of membrane-enriched pellet and soluble
fractions from differential sedimentation experiments was determined by
fluorescence spectrophotometry using sample measurements compared to a
standard curve generated from recombinant GFP. The percentage of
protein present in the membrane-enriched pellet was calculated as
protein in pellet/protein in soluble fraction plus protein in pellet.
Results are means of three independent experiments for each construct,
with error bars representing 1 standard deviation from the mean.
|
|

View larger version (31K):
[in this window]
[in a new window]
|
FIG. 7.
Determination of buoyant density of Gag-GFP particles.
Following overnight labeling with
[35S]cysteine-methionine, supernatants were collected and
subjected to centrifugation through 20% sucrose pellets. Pelleted
material was analyzed via equilibrium centrifugation on sucrose
gradients as described in Materials and Methods. Gradient fractions
were analyzed by SDS-PAGE and autoradiography following
immunoprecipitation with pooled HIV patient sera. The data represent
the bottom 20 fractions of a total of 30 collected fractions, with the
bottom of the gradient to the left. The precise density of each
gradient fraction was determined; densities of peak fractions are
indicated above the autoradiogram. (A) 55GAG/GFP; (B) GAGB/GFP; (C)
GAG377/GFP; (D) MACA/GFP; (E) GAGP/GFP. The positions of molecular mass
markers are indicated at the left in kilodaltons.
|
|
Dense retroviruslike particle formation conferred by the I domain
correlates with plasma membrane fluorescence pattern.
The I domain
is an assembly domain present in retroviral Gag proteins which is
distinct from N-terminal membrane-binding domains (3, 44).
The I domain is required for the formation of retroviruslike particles
of normal density (1.16 to 1.18 g/ml). To determine the relationship of
the subcellular localization domain outlined above to the I domain, the
density of retroviruslike particles formed by the Gag-GFP constructs
was assessed. [35S]cysteine-methionine-labeled Gag-GFP
particles were collected from the cellular supernatant, pelleted
through a sucrose cushion, and subjected to equilibrium density
centrifugation on sucrose gradients. Labeled products of the predicted
molecular mass were found to pellet through sucrose cushions and into
the 20 to 60% sucrose gradients for all constructs shown in Fig. 1
except the GFP control (data not shown). 55GAG/GFP attained an
equilibrium density of 1.175 g/ml; GAGB/GFP attained a similar density
but had a broader (less uniform) peak (Fig. 7A and B). MA/GFP was released, pelleted through sucrose, and attained an equilibrium density
of 1.13 g/ml (data not shown). GAG377/GFP, MACA/GFP, and GAGP/GFP were
demonstrated to have similar equilibrium densities (1.12 to 1.13 g/ml)
well below that of retroviral particles (Fig. 7C to E).
To further demonstrate the transition between light (1.12 to 1.13 g/ml)
and dense (1.16 to 1.18 g/ml) Gag-GFP particles, pelleted
retroviruslike particles from three constructs (GAGB/GFP, GAG391/GFP,
and MACA/GFP) were analyzed on a single linear sucrose gradient
together with HIV-1 isolate IIIB as a marker for normal retroviral
particle density (Fig.
8). A striking
distinction was demonstrated
in this experiment between MACA, with an
equilibrium density of
1.13 g/ml, and the denser particles. HIV-1 IIIB
virions were demonstrated
with a peak density of 1.16 g/ml. GAGB/GFP
particles were noted
to be slightly more dense than HIV-1 IIIB virions
(1.17 g/ml).
GAG391/GFP expression produced particles of normal
retroviral
particle density, as indicated by the measured density (1.16 g/ml)
which overlapped the IIIB peak. The transition between light
retroviruslike
particles, represented by MACA/GFP (Fig.
8) or
GAG377/GFP (Fig.
7D), and dense retroviruslike particles (GAG391/GFP)
thus correlated
precisely with the appearance of Gag protein in a
plasma membrane
distribution as indicated by fluorescence microscopy.

View larger version (48K):
[in this window]
[in a new window]
|
FIG. 8.
Comparison of buoyant densities of Gag-GFP constructs
and HIV IIIB. Particles were prepared and labeled as described in
Materials and Methods. Labeled supernatants from cells expressing
GAGB/GFP, GAG391/GFP, MACA/GFP, and HIV-1 IIIB were separately
centrifuged through a 20% cushion. The resuspended pellets were loaded
onto the top of a single 20 to 60% sucrose gradient and centrifuged to
equilibrium. Thirty fractions were collected; data for the bottom 20 fractions are presented. Gag proteins and Gag-GFP proteins in each
fraction were immunoprecipitated with HIV patient sera and further
analyzed by SDS-PAGE and autoradiography. Relative absorbance values
were obtained by scanning the resulting autoradiogram on a flatbed
scanner equipped for transparencies, and quantitation was performed
with NIH Image software. (A) Plot of absorbance (y axis,
relative values) for immunoprecipitated bands on the autoradiogram
shown below. The x axis indicates fraction numbers, with the
bottom of the gradient to the left. (B) Autoradiogram corresponding to
the graphed results. Arrows point to the individual Gag-GFP fusion
proteins. IIIB indicates the position of HIV-1 IIIB virions as
demonstrated by radiolabeled and immunoprecipitated p24 (CA). The
positions of molecular mass markers are indicated at the left in
kilodaltons.
|
|
 |
DISCUSSION |
Retroviral Gag proteins direct the particle assembly process; they
require no other viral gene products in order to make their way to the
plasma membrane, interact with each other, generate a budding particle,
and separate from the plasma membrane as a retroviral pseudovirion. The
means by which these complex polyproteins travel to the plasma membrane
and the specific interactions with cellular components which may occur
at the assembly site remain largely unknown. An essential function of
the Gag polyprotein is to interact with components of the plasma
membrane. This interaction is mediated by the myristylated N-terminal
region of the molecule. However, the efficiency with which myristylated
MA binds to membranes is much lower than that of the intact
Pr55Gag molecule (39, 48). Furthermore, MA
expressed in mammalian cells is found in a predominant cytoplasmic
distribution which differs markedly from the plasma membrane pattern
seen with Pr55Gag (39). The experiments
described in this report were designed to identify the region outside
of MA which contributes to the efficiency of plasma membrane binding
and to examine the relationship of this proposed domain to the
previously described I domain responsible for dense particle formation.
The I domain is required for plasma membrane localization or
retention of Gag.
In this study, we found that the
membrane-targeting/binding function within MA by itself was
insufficient to direct GFP to the plasma membrane in a manner
sufficient to produce visible fluorescence at this location. The
extension of the Gag region of a Gag-GFP fusion protein to include CA
and SP1 did not significantly alter the observed intracellular
distribution of the protein. However, when all or an N-terminal portion
of NC was included, a dramatic redistribution of fluorescence to the
plasma membrane was noted. The region required for the punctate plasma
membrane localization was thus mapped to NC, with the minimal
requirement for plasma membrane localization in a series of
C-terminally truncated Gag molecules lying within the 14-amino-acid
sequence between GAG377/GFP and GAG391/GFP. Analysis of the density of
particles released by cells expressing the Gag-GFP fusion constructs
revealed that the region responsible for the appearance of focal plasma membrane fluorescence precisely matched the region necessary for the
production of dense (1.16 to 1.18 g/ml) retroviruslike particles. The
influence of the I domain on Gag protein subcellular distribution could
reflect either an effect on Gag protein transport to the plasma
membrane or increased retention of Gag molecules on the plasma
membrane. The latter explanation is more consistent with multiple
previous studies indicating that the major transport function within
Gag lies within the MA region (16, 18, 39-41, 43, 46, 47).
The plasma membrane interaction of HIV-1 Gag requires myristylation of
the N terminus of Gag, as indicated by the purely cytoplasmic signal
seen with a myristylation-deficient mutant which included the I domain.
Thus, the I domain contributes to or facilitates the function of the
more N-terminal membrane-binding domain of Pr55Gag but is
not sufficient to direct the plasma membrane interaction of Gag in the
absence of the myristylated membrane-binding domain.
Contribution of multiple subdomains of NC to membrane-binding
efficiency.
The NC region of Gag was found in this study to be
essential for the efficient membrane binding of Gag. In contrast to the discrete mapping of the location of the minimal N-terminal portion of
the I domain required for dense particle formation, the membrane binding of Gag was not optimal with the addition of this region of NC
alone (represented by GAG391/GFP) but improved sequentially with the
inclusion of the basic linker region between the two zinc fingers and
with the addition of the second zinc finger and C-terminal portion of
NC. This result confirms previous findings from our laboratory and from
others that suggested that a domain or domains outside of MA played an
important role in membrane binding and is in agreement with several
previous studies which have localized an assembly defect to deletions
or site-specific mutations within NC (14, 27, 28, 37). It is
important to note that the appearance of Gag protein on the plasma
membrane as judged from conventional epifluorescence and confocal
fluorescence microscopy correlated well with the membrane-binding
quantitation obtained by differential sedimentation. The constructs
which efficiently bound membranes (GAGB/GFP) were seen almost
exclusively at the plasma membrane, while those that bound with
intermediate efficiency (GAG391/GFP) exhibited both cytoplasmic and
plasma membrane fluorescence, and those which bound least efficiently
(MA/GFP) demonstrated a complete lack of plasma membrane fluorescence.
We conclude from this that the membrane binding measured in this study
by differential sedimentation represents primarily plasma membrane
binding rather than interaction with intracellular membranes.
We propose the following model to explain how these two widely
separated domains contribute to plasma membrane interaction.
Gag
molecules interact with components of the plasma membrane
through the
myristylated N terminus of the molecule. However,
the binding energy of
a single membrane-binding domain to the
lipid bilayer may be
insufficient to support a stable membrane
interaction, leading to
dissociation from the membrane. In the
presence of the I domain,
Gag-Gag or Gag-RNA interactions occur
which allow Gag molecules to
coalesce in an orientation that brings
their respective
membrane-binding domains together for membrane
interaction. Thus, the
binding energy of the developing bud becomes
sufficient to maintain
stable plasma membrane interaction in a
cooperative manner. An
important aspect of this model is its application
to the understanding
of the role of MA in postentry events of
the HIV life cycle. MA plays
an essential role in events following
viral entry (
45), and
has been shown to direct nuclear targeting
of the viral preintegration
complex (
6,
19-21). To perform this
role, MA must be
released from the lipid bilayer of the entering
virion. According to
the model proposed, proteolytic cleavage
during virion maturation would
separate the I domain from the
N-terminal membrane-binding region of
Gag. Although MA remains
largely associated with the lipid bilayer in
mature virions (
23),
release of MA from the constraints
imposed by the I domain may
facilitate membrane dissociation of a
fraction of MA molecules
and thus allow their participation in
postentry events such as
the nuclear transport of the preintegration
complex.
Location of the I domain within HIV-1 NC.
In this study, we
used serially truncated Gag molecules fused to GFP to map the I domain
to the N-terminal portion of NC. Previous studies have also pointed to
an essential assembly function located in this region. Jowett et al.
described a critical assembly domain located between Gag residues 372 and 379 (27). In their study, Gag constructs which were
truncated at the C terminus at a point proximal to the SP1-NC cleavage
site were incapable of forming and releasing particles. This region is
also part of the region described as required for Gag-Gag
multimerization, although the precise location of the multimerization
domain has not yet been defined (17). Previous studies have
established that deletion of SP1 alone does not alter the density of
released particles, although it does decrease particle release and
virion infectivity (29, 35). The role of a C-terminal Gag
domain in enhancing plasma membrane interactions has also been reported
in a study using a cell-free membrane-binding assay (36).
This study reported that a domain within NC was required for Gag
protein membrane binding. The data from this study suggested that an
important determinant of membrane binding is located within the basic
linker region between the two zinc fingers of NC, which is consistent with our finding that this region contributes to overall membrane binding efficiency (Fig. 8). However, as discussed below, the basic
linker region is not required for the production of dense retroviral
particles.
Our results defining the minimal I domain will be useful in future
experiments designed to elucidate the mechanism through
which the I
domain functions to promote membrane interaction and
dense particle
formation. However, in light of the finding that
dense particle
formation correlates precisely with the appearance
of Gag molecules in
focal collections beneath the plasma membrane,
and that multiple
subdomains within NC contribute to the efficiency
of Gag protein plasma
membrane binding, the I domain may actually
represent an assembly
domain present throughout NC. This would
be consistent with the finding
of Bennett et al. that the I domain
is present in two copies within HIV
NC (
3). Using a truncated
RSV Gag construct, these
investigators demonstrated that addition
of either an N- or a
C-terminal segment of HIV-1 NC changed the
character of released
particles to that of dense retroviruslike
particles. The minimal domain
that we have mapped represents further
mapping of the N-terminal I
domain segment described by these
investigators and represented in the
RSV-HIV Gag chimera RHA (
3).
Our data indicate that the zinc finger and basic linker regions of HIV
Gag are not required for dense particle production.
This finding is
consistent with studies in which site-directed
mutagenesis of conserved
residues within the zinc finger domains
of RSV and Moloney murine
leukemia virus did not result in defects
in particle assembly or
release (
15,
25,
30). One of these
studies further
demonstrated that a mutation within the Moloney
murine leukemia virus
zinc finger which disrupted viral RNA packaging
did not alter the
density of released particles (
25). Thus,
the I domain does
not require specific viral RNA interaction in
order to allow dense
particle formation. Nonspecific RNA interactions
have been reported to
play an important role in Gag-Gag interactions
in an in vitro particle
assembly system (
7,
8). Mutant Gag
proteins which have lost
specific viral RNA-binding ability but
preserved the minimal I domain
region may retain the ability to
bind cellular RNAs and therefore
remain competent to produce dense
retroviruslike particles. Further
investigation is required to
elucidate the role that Gag-RNA
interactions may play in influencing
retroviral particle density.
Specificity of plasma membrane interaction.
The punctate
appearance of Gag protein on the plasma membrane in this study and as
previously reported (39) suggests that there is specificity
to the location of Gag protein targeting. If the I domain functions to
bring Gag molecules together and to allow multiple N-terminal
membrane-binding domains to be correctly oriented for membrane
interaction, this would explain increased membrane-binding efficiency
but not the specificity of binding to the plasma membrane. Focal
collections of Gag beneath the plasma membrane suggest the existence of
plasma membrane or cytoskeletal compartments which serve as particle
assembly sites. It is possible that Gag proteins interact with cellular
components at these focal sites. Ongoing studies in our laboratory are
directed toward further defining Gag assembly domains and
identifying the factors which determine the specificity and focality of
the plasma membrane particle assembly site.
 |
ACKNOWLEDGMENTS |
P.S. was supported through PHS awards AI40338-01A1 and
N01-AI-45210. V.V. was supported by PHS award N01-AI-45210. Experiments and analyses were performed in part through the use of the VUMC Cell
Imaging Resource Center (supported by CA68485 and DK20593).
We thank Jonathan Sheehan for technical assistance with confocal
microscopy and Chris Aiken and Terence Dermody for discussions and
critical reviews of the manuscript.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Pediatric
Infectious Diseases, D-7235 MCN, Vanderbilt University, Nashville, TN
37232-2581. Phone: (615) 322-2250. Fax: (615) 343-9723. E-mail:
paul.spearman{at}mcmail.vanderbilt.edu.
 |
REFERENCES |
| 1.
|
Allain, B.,
M. Lapadat-Tapolsky,
C. Berlioz, and J. L. Darlix.
1994.
Transactivation of the minus-strand DNA transfer by nucleocapsid protein during reverse transcription of the retroviral genome.
EMBO J.
13:973-981[Medline].
|
| 2.
|
Barat, C.,
O. Schatz,
S. Le Grice, and J. L. Darlix.
1993.
Analysis of the interactions of HIV 1 replication primer tRNA(Lys,3) with nucleocapsid protein and reverse transcriptase.
J. Mol. Biol.
231:185-190[Medline].
|
| 3.
|
Bennett, R. P.,
T. D. Nelle, and J. W. Wills.
1993.
Functional chimeras of the Rous sarcoma virus and human immunodeficiency virus Gag proteins.
J. Virol.
67:6487-6498[Abstract/Free Full Text].
|
| 4.
|
Berkowitz, R. D.,
J. Luban, and S. P. Goff.
1993.
Specific binding of human immunodeficiency virus type 1 Gag polyprotein and nucleocapsid protein to viral RNAs detected by RNA mobility shift assays.
J. Virol.
67:7190-7200[Abstract/Free Full Text].
|
| 5.
|
Berkowitz, R. D.,
A. Ohagen,
S. Hoglund, and S. P. Goff.
1995.
Retroviral nucleocapsid domains mediate the specific recognition of genomic viral RNAs by chimeric Gag polyproteins during RNA packaging in vivo.
J. Virol.
69:6445-6456[Abstract].
|
| 6.
|
Bukrinsky, M. I.,
S. Haggerty,
M. P. Dempsey,
N. Sharova,
A. Adzhubel,
L. Spitz,
P. Lewis,
D. Goldfarb,
M. Emerman, and M. Stevenson.
1993.
A nuclear localization signal within HIV-1 matrix protein that governs infection of non-dividing cells.
Nature
365:666-669[Medline].
|
| 7.
|
Campbell, S., and V. M. Vogt.
1997.
In vitro assembly of virus-like particles with Rous sarcoma virus Gag deletion mutants: identification of the p10 domain as a morphological determinant in the formation of spherical particles.
J. Virol.
71:4425-4435[Abstract].
|
| 8.
|
Campbell, S., and V. M. Vogt.
1995.
Self-assembly in vitro of purified CA-NC proteins from Rous sarcoma virus and human immunodeficiency virus type 1.
J. Virol.
69:6487-6497[Abstract].
|
| 9.
|
Dannull, J.,
A. Surovoy,
G. Jung, and K. Moelling.
1994.
Specific binding of HIV-1 nucleocapsid protein to PSI RNA in vitro requires N-terminal zinc finger and flanking basic amino acid residues.
EMBO J.
13:1525-1533[Medline].
|
| 10.
|
Darlix, J. L.,
M. Lapadat-Tapolsky,
H. de Rocquigny, and B. P. Roques.
1995.
First glimpses at structure-function relationships of the nucleocapsid protein of retroviruses.
J. Mol. Biol.
254:523-537[Medline].
|
| 11.
|
Demene, H.,
C. Z. Dong,
M. Ottmann,
M. C. Rouyez,
N. Jullian,
N. Morellet,
Y. Mely,
J. L. Darlix,
M. C. Fournie-Zaluski,
S. Saragosti, et al.
1994.
1H NMR structure and biological studies of the His23 Cys mutant nucleocapsid protein of HIV-1 indicate that the conformation of the first zinc finger is critical for virus infectivity.
Biochemistry
33:11707-11716[Medline].
|
| 12.
|
De Rocquigny, H.,
C. Gabus,
A. Vincent,
M. C. Fournie-Zaluski,
B. Roques, and J. L. Darlix.
1992.
Viral RNA annealing activities of human immunodeficiency virus type 1 nucleocapsid protein require only peptide domains outside the zinc fingers.
Proc. Natl. Acad. Sci. USA
89:6472-6476[Abstract/Free Full Text].
|
| 13.
|
Dong, J., and E. Hunter.
1993.
Analysis of retroviral assembly using a vaccinia/T7-polymerase complementation system.
Virology
194:192-199[Medline].
|
| 14.
|
Dorfman, T.,
J. Luban,
S. P. Goff,
W. A. Haseltine, and H. G. Gottlinger.
1993.
Mapping of functionally important residues of a cysteine-histidine box in the human immunodeficiency virus type 1 nucleocapsid protein.
J. Virol.
67:6159-6169[Abstract/Free Full Text].
|
| 15.
|
Dupraz, P.,
S. Oertle,
C. Meric,
P. Damay, and P. F. Spahr.
1990.
Point mutations in the proximal Cys-His box of Rous sarcoma virus nucleocapsid protein.
J. Virol.
64:4978-4987[Abstract/Free Full Text].
|
| 16.
|
Facke, M.,
A. Janetzko,
R. L. Shoeman, and H. G. Krausslich.
1993.
A large deletion in the matrix domain of the human immunodeficiency virus gag gene redirects virus particle assembly from the plasma membrane to the endoplasmic reticulum.
J. Virol.
67:4972-4980[Abstract/Free Full Text].
|
| 17.
|
Franke, E. K.,
H. E. Yuan,
K. L. Bossolt,
S. P. Goff, and J. Luban.
1994.
Specificity and sequence requirements for interactions between various retroviral Gag proteins.
J. Virol.
68:5300-5305[Abstract/Free Full Text].
|
| 18.
|
Freed, E. O.,
J. M. Orenstein,
A. J. Buckler-White, and M. A. Martin.
1994.
Single amino acid changes in the human immunodeficiency virus type 1 matrix protein block virus particle production.
J. Virol.
68:5311-5320[Abstract/Free Full Text].
|
| 19.
|
Gallay, P.,
V. Stitt,
C. Mundy,
M. Oettinger, and D. Trono.
1996.
Role of the karyopherin pathway in human immunodeficiency virus type 1 nuclear import.
J. Virol.
70:1027-1032[Abstract].
|
| 20.
|
Gallay, P.,
S. Swingler,
C. Aiken, and D. Trono.
1995.
HIV-1 infection of nondividing cells: C-terminal tyrosine phosphorylation of the viral matrix protein is a key regulator.
Cell
80:379-388[Medline].
|
| 21.
|
Gallay, P.,
S. Swingler,
J. Song,
F. Bushman, and D. Trono.
1995.
HIV nuclear import is governed by the phosphotyrosine-mediated binding of matrix to the core domain of integrase.
Cell
83:569-576[Medline].
|
| 22.
|
Gelderblom, H. R.
1991.
Assembly and morphology of HIV: potential effect of structure on viral function.
AIDS
5:617-637[Medline].
|
| 23.
|
Gelderblom, H. R.,
E. H. Hausmann,
M. Ozel,
G. Pauli, and M. A. Koch.
1987.
Fine structure of human immunodeficiency virus (HIV) and immunolocalization of structural proteins.
Virology
156:171-176[Medline].
|
| 24.
|
Gorelick, R. J.,
D. J. Chabot,
A. Rein,
L. E. Henderson, and L. O. Arthur.
1993.
The two zinc fingers in the human immunodeficiency virus type 1 nucleocapsid protein are not functionally equivalent.
J. Virol.
67:4027-4036[Abstract/Free Full Text].
|
| 25.
|
Gorelick, R. J.,
L. E. Henderson,
J. P. Hanser, and A. Rein.
1988.
Point mutants of Moloney murine leukemia virus that fail to package viral RNA: evidence for specific RNA recognition by a "zinc finger-like" protein sequence.
Proc. Natl. Acad. Sci. USA
85:8420-8424[Abstract/Free Full Text].
|
| 26.
|
Henderson, L. E.,
M. A. Bowers,
R. C. d. Sowder,
S. A. Serabyn,
D. G. Johnson,
J. W. Bess, Jr.,
L. O. Arthur,
D. K. Bryant, and C. Fenselau.
1992.
Gag proteins of the highly replicative MN strain of human immunodeficiency virus type 1: posttranslational modifications, proteolytic processings, and complete amino acid sequences.
J. Virol.
66:1856-1865[Abstract/Free Full Text].
|
| 27.
|
Jowett, J. B.,
D. J. Hockley,
M. V. Nermut, and I. M. Jones.
1992.
Distinct signals in human immunodeficiency virus type 1 Pr55 necessary for RNA binding and particle.
J. Gen. Virol.
73:3079-3086[Abstract/Free Full Text].
|
| 28.
|
Kaye, J. F., and A. M. Lever.
1996.
trans-acting proteins involved in RNA encapsidation and viral assembly in human immunodeficiency virus type 1.
J. Virol.
70:880-886[Abstract].
|
| 29.
|
Krausslich, H. G.,
M. Facke,
A. M. Heuser,
J. Konvalinka, and H. Zentgraf.
1995.
The spacer peptide between human immunodeficiency virus capsid and nucleocapsid proteins is essential for ordered assembly and viral infectivity.
J. Virol.
69:3407-3419[Abstract].
|
| 30.
|
Meric, C., and S. P. Goff.
1989.
Characterization of Moloney murine leukemia virus mutants with single-amino-acid substitutions in the Cys-His box of the nucleocapsid protein.
J. Virol.
63:1558-1568[Abstract/Free Full Text].
|
| 31.
|
Morellet, N.,
H. de Rocquigny,
Y. Mely,
N. Jullian,
H. Demene,
M. Ottmann,
D. Gerard,
J. L. Darlix,
M. C. Fournie-Zaluski, and B. P. Roques.
1994.
Conformational behaviour of the active and inactive forms of the nucleocapsid NCp7 of HIV-1 studied by 1H NMR.
J. Mol. Biol.
235:287-301[Medline].
|
| 32.
|
Moss, B.,
O. Elroy-Stein,
T. Mizukami,
W. A. Alexander, and T. R. Fuerst.
1990.
Product review. New mammalian expression vectors.
Nature
348:91-92[Medline].
|
| 33.
|
Ottmann, M.,
C. Gabus, and J. L. Darlix.
1995.
The central globular domain of the nucleocapsid protein of human immunodeficiency virus type 1 is critical for virion structure and infectivity.
J. Virol.
69:1778-1784[Abstract].
|
| 34.
|
Peliska, J. A.,
S. Balasubramanian,
D. P. Giedroc, and S. J. Benkovic.
1994.
Recombinant HIV-1 nucleocapsid protein accelerates HIV-1 reverse transcriptase catalyzed DNA strand transfer reactions and modulates RNase H activity.
Biochemistry
33:13817-13823[Medline].
|
| 35.
|
Pettit, S. C.,
M. D. Moody,
R. S. Wehbie,
A. H. Kaplan,
P. V. Nantermet,
C. A. Klein, and R. Swanstrom.
1994.
The p2 domain of human immunodeficiency virus type 1 Gag regulates sequential proteolytic processing and is required to produce fully infectious virions.
J. Virol.
68:8017-8027[Abstract/Free Full Text].
|
| 36.
|
Platt, E. J., and O. K. Haffar.
1994.
Characterization of human immunodeficiency virus type 1 Pr55gag membrane association in a cell-free system: requirement for a C-terminal domain.
Proc. Natl. Acad. Sci. USA
91:4594-4598[Abstract/Free Full Text].
|
| 37.
|
Poon, D. T.,
J. Wu, and A. Aldovini.
1996.
Charged amino acid residues of human immunodeficiency virus type 1 nucleocapsid p7 protein involved in RNA packaging and infectivity.
J. Virol.
70:6607-6616[Abstract/Free Full Text].
|
| 38.
|
Prats, A. C.,
L. Sarih,
C. Gabus,
S. Litvak,
G. Keith, and J. L. Darlix.
1988.
Small finger protein of avian and murine retroviruses has nucleic acid annealing activity and positions the replication primer tRNA onto genomic RNA.
EMBO J.
7:1777-1783[Medline].
|
| 39.
|
Spearman, P.,
R. Horton,
L. Ratner, and I. Kuli-Zade.
1997.
Membrane binding of human immunodeficiency virus type 1 matrix protein in vivo supports a conformational myristyl switch mechanism.
J. Virol.
71:6582-6592[Abstract].
|
| 40.
|
Spearman, P.,
J. J. Wang,
N. Vander Heyden, and L. Ratner.
1994.
Identification of human immunodeficiency virus type 1 Gag protein domains essential to membrane binding and particle assembly.
J. Virol.
68:3232-3242[Abstract/Free Full Text].
|
| 41.
|
Verderame, M. F.,
T. D. Nelle, and J. W. Wills.
1996.
The membrane-binding domain of the Rous sarcoma virus Gag protein.
J. Virol.
70:2664-2668[Abstract].
|
| 42.
|
Wills, J. W., and R. C. Craven.
1991.
Form, function, and use of retroviral gag proteins.
AIDS
5:639-654[Medline].
|
| 43.
|
Wills, J. W.,
R. C. Craven,
R. A. Weldon, Jr.,
T. D. Nelle, and C. R. Erdie.
1991.
Suppression of retroviral MA deletions by the amino-terminal membrane-binding domain of p60src.
J. Virol.
65:3804-3812[Abstract/Free Full Text].
|
| 44.
|
Xiang, Y.,
C. E. Cameron,
J. W. Wills, and J. Leis.
1996.
Fine mapping and characterization of the Rous sarcoma virus Pr76gag late assembly domain.
J. Virol.
70:5695-5700[Abstract/Free Full Text].
|
| 45.
|
Yu, X.,
Q. C. Yu,
T. H. Lee, and M. Essex.
1992.
The C terminus of human immunodeficiency virus type 1 matrix protein is involved in early steps of the virus life cycle.
J. Virol.
66:5667-5670[Abstract/Free Full Text].
|
| 46.
|
Yuan, X.,
X. Yu,
T. H. Lee, and M. Essex.
1993.
Mutations in the N-terminal region of human immunodeficiency virus type 1 matrix protein block intracellular transport of the Gag precursor.
J. Virol.
67:6387-6394[Abstract/Free Full Text].
|
| 47.
|
Zhou, W.,
L. J. Parent,
J. W. Wills, and M. D. Resh.
1994.
Identification of a membrane-binding domain within the amino-terminal region of human immunodeficiency virus type 1 Gag protein which interacts with acidic phospholipids.
J. Virol.
68:2556-2569[Abstract/Free Full Text].
|
| 48.
|
Zhou, W., and M. D. Resh.
1996.
Differential membrane binding of the human immunodeficiency virus type 1 matrix protein.
J. Virol.
70:8540-8548[Abstract].
|
J Virol, April 1998, p. 2723-2732, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Sherer, N. M., Swanson, C. M., Papaioannou, S., Malim, M. H.
(2009). Matrix Mediates the Functional Link between Human Immunodeficiency Virus Type 1 RNA Nuclear Export Elements and the Assembly Competency of Gag in Murine Cells. J. Virol.
83: 8525-8535
[Abstract]
[Full Text]
-
Hogue, I. B., Hoppe, A., Ono, A.
(2009). Quantitative Fluorescence Resonance Energy Transfer Microscopy Analysis of the Human Immunodeficiency Virus Type 1 Gag-Gag Interaction: Relative Contributions of the CA and NC Domains and Membrane Binding. J. Virol.
83: 7322-7336
[Abstract]
[Full Text]
-
Lehmann, M., Milev, M. P., Abrahamyan, L., Yao, X.-J., Pante, N., Mouland, A. J.
(2009). Intracellular Transport of Human Immunodeficiency Virus Type 1 Genomic RNA and Viral Production Are Dependent on Dynein Motor Function and Late Endosome Positioning. J. Biol. Chem.
284: 14572-14585
[Abstract]
[Full Text]
-
Izquierdo-Useros, N., Naranjo-Gomez, M., Archer, J., Hatch, S. C., Erkizia, I., Blanco, J., Borras, F. E., Puertas, M. C., Connor, J. H., Fernandez-Figueras, M. T., Moore, L., Clotet, B., Gummuluru, S., Martinez-Picado, J.
(2009). Capture and transfer of HIV-1 particles by mature dendritic cells converges with the exosome-dissemination pathway. Blood
113: 2732-2741
[Abstract]
[Full Text]
-
Thomas, J. A., Bosche, W. J., Shatzer, T. L., Johnson, D. G., Gorelick, R. J.
(2008). Mutations in Human Immunodeficiency Virus Type 1 Nucleocapsid Protein Zinc Fingers Cause Premature Reverse Transcription. J. Virol.
82: 9318-9328
[Abstract]
[Full Text]
-
Zhou, Y., Rong, L., Lu, J., Pan, Q., Liang, C.
(2008). Insulin-Like Growth Factor II mRNA Binding Protein 1 Associates with Gag Protein of Human Immunodeficiency Virus Type 1, and Its Overexpression Affects Virus Assembly. J. Virol.
82: 5683-5692
[Abstract]
[Full Text]
-
Kawada, S., Goto, T., Haraguchi, H., Ono, A., Morikawa, Y.
(2008). Dominant Negative Inhibition of Human Immunodeficiency Virus Particle Production by the Nonmyristoylated Form of Gag. J. Virol.
82: 4384-4399
[Abstract]
[Full Text]
-
Kenney, S. P., Lochmann, T. L., Schmid, C. L., Parent, L. J.
(2008). Intermolecular Interactions between Retroviral Gag Proteins in the Nucleus. J. Virol.
82: 683-691
[Abstract]
[Full Text]
-
Li, H., Dou, J., Ding, L., Spearman, P.
(2007). Myristoylation Is Required for Human Immunodeficiency Virus Type 1 Gag-Gag Multimerization in Mammalian Cells. J. Virol.
81: 12899-12910
[Abstract]
[Full Text]
-
Hubner, W., Chen, P., Portillo, A. D., Liu, Y., Gordon, R. E., Chen, B. K.
(2007). Sequence of Human Immunodeficiency Virus Type 1 (HIV-1) Gag Localization and Oligomerization Monitored with Live Confocal Imaging of a Replication-Competent, Fluorescently Tagged HIV-1. J. Virol.
81: 12596-12607
[Abstract]
[Full Text]
-
Morikawa, Y., Goto, T., Yasuoka, D., Momose, F., Matano, T.
(2007). Defect of Human Immunodeficiency Virus Type 2 Gag Assembly in Saccharomyces cerevisiae. J. Virol.
81: 9911-9921
[Abstract]
[Full Text]
-
Stansell, E., Apkarian, R., Haubova, S., Diehl, W. E., Tytler, E. M., Hunter, E.
(2007). Basic Residues in the Mason-Pfizer Monkey Virus Gag Matrix Domain Regulate Intracellular Trafficking and Capsid-Membrane Interactions. J. Virol.
81: 8977-8988
[Abstract]
[Full Text]
-
Jager, S., Gottwein, E., Krausslich, H.-G.
(2007). Ubiquitination of Human Immunodeficiency Virus Type 1 Gag Is Highly Dependent on Gag Membrane Association. J. Virol.
81: 9193-9201
[Abstract]
[Full Text]
-
Dalton, A. K., Ako-Adjei, D., Murray, P. S., Murray, D., Vogt, V. M.
(2007). Electrostatic Interactions Drive Membrane Association of the Human Immunodeficiency Virus Type 1 Gag MA Domain. J. Virol.
81: 6434-6445
[Abstract]
[Full Text]
-
Burnett, A., Spearman, P.
(2007). APOBEC3G Multimers Are Recruited to the Plasma Membrane for Packaging into Human Immunodeficiency Virus Type 1 Virus-Like Particles in an RNA-Dependent Process Requiring the NC Basic Linker. J. Virol.
81: 5000-5013
[Abstract]
[Full Text]
-
Joshi, A., Nagashima, K., Freed, E. O.
(2006). Mutation of dileucine-like motifs in the human immunodeficiency virus type 1 capsid disrupts virus assembly, gag-gag interactions, gag-membrane binding, and virion maturation.. J. Virol.
80: 7939-7951
[Abstract]
[Full Text]
-
Saad, J. S., Miller, J., Tai, J., Kim, A., Ghanam, R. H., Summers, M. F.
(2006). From the Cover: Structural basis for targeting HIV-1 Gag proteins to the plasma membrane for virus assembly. Proc. Natl. Acad. Sci. USA
103: 11364-11369
[Abstract]
[Full Text]
-
Booth, A. M., Fang, Y., Fallon, J. K., Yang, J.-M., Hildreth, J. E.K., Gould, S. J.
(2006). Exosomes and HIV Gag bud from endosome-like domains of the T cell plasma membrane.. JCB
172: 923-935
[Abstract]
[Full Text]
-
Lingappa, J. R., Dooher, J. E., Newman, M. A., Kiser, P. K., Klein, K. C.
(2006). Basic Residues in the Nucleocapsid Domain of Gag Are Required for Interaction of HIV-1 Gag with ABCE1 (HP68), a Cellular Protein Important for HIV-1 Capsid Assembly. J. Biol. Chem.
281: 3773-3784
[Abstract]
[Full Text]
-
Ono, A., Waheed, A. A., Joshi, A., Freed, E. O.
(2005). Association of Human Immunodeficiency Virus Type 1 Gag with Membrane Does Not Require Highly Basic Sequences in the Nucleocapsid: Use of a Novel Gag Multimerization Assay. J. Virol.
79: 14131-14140
[Abstract]
[Full Text]
-
Dalton, A. K., Murray, P. S., Murray, D., Vogt, V. M.
(2005). Biochemical Characterization of Rous Sarcoma Virus MA Protein Interaction with Membranes. J. Virol.
79: 6227-6238
[Abstract]
[Full Text]
-
Chen, X., Rock, M. T., Hammonds, J., Tartaglia, J., Shintani, A., Currier, J., Slike, B., Crowe, J. E. Jr., Marovich, M., Spearman, P.
(2005). Pseudovirion Particle Production by Live Poxvirus Human Immunodeficiency Virus Vaccine Vector Enhances Humoral and Cellular Immune Responses. J. Virol.
79: 5537-5547
[Abstract]
[Full Text]
-
Rudner, L., Nydegger, S., Coren, L. V., Nagashima, K., Thali, M., Ott, D. E.
(2005). Dynamic Fluorescent Imaging of Human Immunodeficiency Virus Type 1 Gag in Live Cells by Biarsenical Labeling. J. Virol.
79: 4055-4065
[Abstract]
[Full Text]
-
Muriaux, D., Costes, S., Nagashima, K., Mirro, J., Cho, E., Lockett, S., Rein, A.
(2004). Role of Murine Leukemia Virus Nucleocapsid Protein in Virus Assembly. J. Virol.
78: 12378-12385
[Abstract]
[Full Text]
-
Zhang, H., Fayad, R., Wang, X., Quinn, D., Qiao, L.
(2004). Human Immunodeficiency Virus Type 1 Gag-Specific Mucosal Immunity after Oral Immunization with Papillomavirus Pseudoviruses Encoding Gag. J. Virol.
78: 10249-10257
[Abstract]
[Full Text]
-
Perez-Caballero, D., Hatziioannou, T., Martin-Serrano, J., Bieniasz, P. D.
(2004). Human Immunodeficiency Virus Type 1 Matrix Inhibits and Confers Cooperativity on Gag Precursor-Membrane Interactions. J. Virol.
78: 9560-9563
[Abstract]
[Full Text]
-
Lee, E.-G., Linial, M. L.
(2004). Basic Residues of the Retroviral Nucleocapsid Play Different Roles in Gag-Gag and Gag-{Psi} RNA Interactions. J. Virol.
78: 8486-8495
[Abstract]
[Full Text]
-
Wu, Z., Alexandratos, J., Ericksen, B., Lubkowski, J., Gallo, R. C., Lu, W.
(2004). Total chemical synthesis of N-myristoylated HIV-1 matrix protein p17: Structural and mechanistic implications of p17 myristoylation. Proc. Natl. Acad. Sci. USA
101: 11587-11592
[Abstract]
[Full Text]
-
Derdowski, A., Ding, L., Spearman, P.
(2004). A Novel Fluorescence Resonance Energy Transfer Assay Demonstrates that the Human Immunodeficiency Virus Type 1 Pr55Gag I Domain Mediates Gag-Gag Interactions. J. Virol.
78: 1230-1242
[Abstract]
[Full Text]
-
Wang, S.-W., Noonan, K., Aldovini, A.
(2004). Nucleocapsid-RNA Interactions Are Essential to Structural Stability but Not to Assembly of Retroviruses. J. Virol.
78: 716-723
[Abstract]
[Full Text]
-
Cen, S., Niu, M., Saadatmand, J., Guo, F., Huang, Y., Nabel, G. J., Kleiman, L.
(2004). Incorporation of Pol into Human Immunodeficiency Virus Type 1 Gag Virus-Like Particles Occurs Independently of the Upstream Gag Domain in Gag-Pol. J. Virol.
78: 1042-1049
[Abstract]
[Full Text]
-
Resh, M. D.
(2004). A myristoyl switch regulates membrane binding of HIV-1 Gag. Proc. Natl. Acad. Sci. USA
101: 417-418
[Full Text]
-
Tang, C., Loeliger, E., Luncsford, P., Kinde, I., Beckett, D., Summers, M. F.
(2004). From the Cover: Entropic switch regulates myristate exposure in the HIV-1 matrix protein. Proc. Natl. Acad. Sci. USA
101: 517-522
[Abstract]
[Full Text]
-
Ma, Y. M., Vogt, V. M.
(2004). Nucleic Acid Binding-Induced Gag Dimerization in the Assembly of Rous Sarcoma Virus Particles In Vitro. J. Virol.
78: 52-60
[Abstract]
[Full Text]
-
Larson, D. R., Ma, Y. M., Vogt, V. M., Webb, W. W.
(2003). Direct measurement of Gag-Gag interaction during retrovirus assembly with FRET and fluorescence correlation spectroscopy. JCB
162: 1233-1244
[Abstract]
[Full Text]
-
Goff, A., Ehrlich, L. S., Cohen, S. N., Carter, C. A.
(2003). Tsg101 Control of Human Immunodeficiency Virus Type 1 Gag Trafficking and Release. J. Virol.
77: 9173-9182
[Abstract]
[Full Text]
-
Callahan, E. M., Wills, J. W.
(2003). Link between Genome Packaging and Rate of Budding for Rous Sarcoma Virus. J. Virol.
77: 9388-9398
[Abstract]
[Full Text]
-
Javanbakht, H., Halwani, R., Cen, S., Saadatmand, J., Musier-Forsyth, K., Gottlinger, H., Kleiman, L.
(2003). The Interaction between HIV-1 Gag and Human Lysyl-tRNA Synthetase during Viral Assembly. J. Biol. Chem.
278: 27644-27651
[Abstract]
[Full Text]
-
Brignati, M. J., Loomis, J. S., Wills, J. W., Courtney, R. J.
(2003). Membrane Association of VP22, a Herpes Simplex Virus Type 1 Tegument Protein. J. Virol.
77: 4888-4898
[Abstract]
[Full Text]
-
Halwani, R., Khorchid, A., Cen, S., Kleiman, L.
(2003). Rapid Localization of Gag/GagPol Complexes to Detergent-Resistant Membrane during the Assembly of Human Immunodeficiency Virus Type 1. J. Virol.
77: 3973-3984
[Abstract]
[Full Text]
-
Liang, C., Hu, J., Whitney, J. B., Kleiman, L., Wainberg, M. A.
(2003). A Structurally Disordered Region at the C Terminus of Capsid Plays Essential Roles in Multimerization and Membrane Binding of the Gag Protein of Human Immunodeficiency Virus Type 1. J. Virol.
77: 1772-1783
[Abstract]
[Full Text]
-
Ding, L., Derdowski, A., Wang, J.-J., Spearman, P.
(2003). Independent Segregation of Human Immunodeficiency Virus Type 1 Gag Protein Complexes and Lipid Rafts. J. Virol.
77: 1916-1926
[Abstract]
[Full Text]
-
Scheifele, L. Z., Rhoads, J. D., Parent, L. J.
(2002). Specificity of Plasma Membrane Targeting by the Rous Sarcoma Virus Gag Protein. J. Virol.
77: 470-480
[Abstract]
[Full Text]
-
Wang, S.-W., Aldovini, A.
(2002). RNA Incorporation Is Critical for Retroviral Particle Integrity after Cell Membrane Assembly of Gag Complexes. J. Virol.
76: 11853-11865
[Abstract]
[Full Text]
-
Khorchid, A., Halwani, R., Wainberg, M. A., Kleiman, L.
(2002). Role of RNA in Facilitating Gag/Gag-Pol Interaction. J. Virol.
76: 4131-4137
[Abstract]
[Full Text]
-
Loomis, J. S., Bowzard, J. B., Courtney, R. J., Wills, J. W.
(2001). Intracellular Trafficking of the UL11 Tegument Protein of Herpes Simplex Virus Type 1. J. Virol.
75: 12209-12219
[Abstract]
[Full Text]
-
Ono, A., Freed, E. O.
(2001). Plasma membrane rafts play a critical role in HIV-1 assembly and release. Proc. Natl. Acad. Sci. USA
98: 13925-13930
[Abstract]
[Full Text]
-
Lindwasser, O. W., Resh, M. D.
(2001). Multimerization of Human Immunodeficiency Virus Type 1 Gag Promotes Its Localization to Barges, Raft-Like Membrane Microdomains. J. Virol.
75: 7913-7924
[Abstract]
[Full Text]
-
Tritel, M., Resh, M. D.
(2001). The Late Stage of Human Immunodeficiency Virus Type 1 Assembly Is an Energy-Dependent Process. J. Virol.
75: 5473-5481
[Abstract]
[Full Text]
-
Jasenosky, L. D., Neumann, G., Lukashevich, I., Kawaoka, Y.
(2001). Ebola Virus VP40-Induced Particle Formation and Association with the Lipid Bilayer. J. Virol.
75: 5205-5214
[Abstract]
[Full Text]
-
Yu, F., Joshi, S. M., Ma, Y. M., Kingston, R. L., Simon, M. N., Vogt, V. M.
(2001). Characterization of Rous Sarcoma Virus Gag Particles Assembled In Vitro. J. Virol.
75: 2753-2764
[Abstract]
[Full Text]
-
Patnaik, A., Chau, V., Wills, J. W.
(2000). Ubiquitin is part of the retrovirus budding machinery. Proc. Natl. Acad. Sci. USA
97: 13069-13074
[Abstract]
[Full Text]
-
Doms, R. W., Trono, D.
(2000). The plasma membrane as a combat zone in the HIV battlefield. Genes Dev.
14: 2677-2688
[Full Text]
-
Hermida-Matsumoto, L., Resh, M. D.
(2000). Localization of Human Immunodeficiency Virus Type 1 Gag and Env at the Plasma Membrane by Confocal Imaging. J. Virol.
74: 8670-8679
[Abstract]
[Full Text]
-
Bowzard, J. B., Visalli, R. J., Wilson, C. B., Loomis, J. S., Callahan, E. M., Courtney, R. J., Wills, J. W.
(2000). Membrane Targeting Properties of a Herpesvirus Tegument Protein-Retrovirus Gag Chimera. J. Virol.
74: 8692-8699
[Abstract]
[Full Text]
-
Sandefur, S., Smith, R. M., Varthakavi, V., Spearman, P.
(2000). Mapping and Characterization of the N-Terminal I Domain of Human Immunodeficiency Virus Type 1 Pr55Gag. J. Virol.
74: 7238-7249
[Abstract]
[Full Text]
-
Cimarelli, A., Luban, J.
(2000). Human Immunodeficiency Virus Type 1 Virion Density Is Not Determined by Nucleocapsid Basic Residues. J. Virol.
74: 6734-6740
[Abstract]
[Full Text]
-
Tritel, M., Resh, M. D.
(2000). Kinetic Analysis of Human Immunodeficiency Virus Type 1 Assembly Reveals the Presence of Sequential Intermediates. J. Virol.
74: 5845-5855
[Abstract]
[Full Text]
-
Ono, A., Demirov, D., Freed, E. O.
(2000). Relationship between Human Immunodeficiency Virus Type 1 Gag Multimerization and Membrane Binding. J. Virol.
74: 5142-5150
[Abstract]
[Full Text]
-
Cimarelli, A., Sandin, S., Höglund, S., Luban, J.
(2000). Basic Residues in Human Immunodeficiency Virus Type 1 Nucleocapsid Promote Virion Assembly via Interaction with RNA. J. Virol.
74: 3046-3057
[Abstract]
[Full Text]
-
Ono, A., Orenstein, J. M., Freed, E. O.
(2000). Role of the Gag Matrix Domain in Targeting Human Immunodeficiency Virus Type 1 Assembly. J. Virol.
74: 2855-2866
[Abstract]
[Full Text]
-
Dettenhofer, M., Yu, X.-F.
(1999). Proline Residues in Human Immunodeficiency Virus Type 1 p6Gag Exert a Cell Type-Dependent Effect on Viral Replication and Virion Incorporation of Pol Proteins. J. Virol.
73: 4696-4704
[Abstract]
[Full Text]
-
Kiernan, R. E., Ono, A., Freed, E. O.
(1999). Reversion of a Human Immunodeficiency Virus Type 1 Matrix Mutation Affecting Gag Membrane Binding, Endogenous Reverse Transcriptase Activity, and Virus Infectivity. J. Virol.
73: 4728-4737
[Abstract]
[Full Text]
-
Ono, A., Freed, E. O.
(1999). Binding of Human Immunodeficiency Virus Type 1 Gag to Membrane: Role of the Matrix Amino Terminus. J. Virol.
73: 4136-4144
[Abstract]
[Full Text]
-
Liu, B., Dai, R., Tian, C.-J., Dawson, L., Gorelick, R., Yu, X.-F.
(1999). Interaction of the Human Immunodeficiency Virus Type 1 Nucleocapsid with Actin. J. Virol.
73: 2901-2908
[Abstract]
[Full Text]
-
Hermida-Matsumoto, L., Resh, M. D.
(1999). Human Immunodeficiency Virus Type 1 Protease Triggers a Myristoyl Switch That Modulates Membrane Binding of Pr55gag and p17MA. J. Virol.
73: 1902-1908
[Abstract]
[Full Text]