This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maillard, I.
Right arrow Articles by Diggelmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maillard, I.
Right arrow Articles by Diggelmann, H.

 Previous Article  |  Next Article 

J Virol, April 1998, p. 2638-2646, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Immune Response to Mouse Mammary Tumor Virus in Mice Lacking the Alpha/Beta Interferon or the Gamma Interferon Receptor

Ivan Maillard,1 Pascal Launois,2,3,dagger Ioannis Xenarios,3 Jacques A. Louis,2,3 Hans Acha-Orbea,3,4 and Heidi Diggelmann1,*

Institute of Microbiology1 and Institute of Biochemistry,3 University of Lausanne, and World Health Organization Immunology Research and Training Center,2 Lausanne, and Ludwig Institute for Cancer Research, Lausanne Branch, Epalinges,4 Switzerland

Received 18 August 1997/Accepted 19 December 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mouse mammary tumor virus (MMTV) is a retrovirus which induces a strong immune response and a dramatic increase in the number of infected cells through the expression of a superantigen (SAg). Many cytokines are likely to be involved in the interaction between MMTV and the immune system. In particular, alpha/beta interferon (IFN-alpha /beta ) and gamma interferon (IFN-gamma ) exert many antiviral and immunomodulatory activities and play a critical role in other viral infections. In this study, we have investigated the importance of interferons during MMTV infection by using mice with a disrupted IFN-alpha /beta or IFN-gamma receptor gene. We found that the SAg response to MMTV was not modified in IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice. This was true both for the early expansion of B and T cells induced by the SAg and for the deletion of SAg-reactive cells at later stages of the infection. In addition, no increase in the amount of proviral DNA was detected in tissues of IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice, suggesting that interferons are not essential antiviral defense mechanisms during MMTV infection. In contrast, IFN-gamma R0/0 mice had increased amounts of IL-4 mRNA and an altered usage of immunoglobulin isotypes with a reduced frequency of IgG2a- and IgG3-producing cells. This was associated with lower titers of virus-specific antibodies in serum early after infection, although efficient titers were reached later.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mouse mammary tumor virus (MMTV) is a murine retrovirus which can be transmitted either as an infectious viral particle (exogenous MMTV) (6) or as an integrated provirus through the germ line (endogenous Mtv loci) (30). Transmission of exogenous MMTV occurs from the infected mother to the offspring upon ingestion of milk during the first days of life. The virus initially infects lymphocytes in the neonatal Peyer's patches (27) and later spreads to distant target organs most probably via cells of the immune system (56, 61). Viral particles are produced in large amounts by the lactating mammary gland, allowing virus transmission to the next generation of mice.

The overall efficiency of MMTV infection is critically dependent upon the interaction between the virus and the immune system (17, 20). In addition to the usual retroviral genes gag, pol and env, the viral genome contains within the 3' long terminal repeat (LTR) (11, 12) an open reading frame (orf or sag gene) which has been shown to encode a superantigen (SAg) (3, 9). SAgs are defined by their ability to interact with a large number of T cells expressing specific variable domains in the T-cell receptor beta  chain (TCR Vbeta domains) and need to be presented by major histocompatibility complex (MHC) class II molecules (25, 26, 36, 64). The encounter with a SAg leads first to the stimulation and then to the clonal deletion of reactive T cells (35, 62, 64). The virus makes use of these properties by initially infecting B cells and expressing its SAg at the B-cell surface in association with MHC class II molecules (18). SAg-reactive T cells accumulate locally and are stimulated, providing a potent help to infected B cells via cognate T-cell-B-cell interaction. During this process, the infected B cells increase dramatically in number and differentiate, providing a large reservoir of infected cells for the later stages of the viral life cycle (17, 20). SAg-reactive T cells are then eliminated by clonal deletion.

Many cytokines are likely to be involved in the interactions between MMTV and the immune system. In particular, we were interested in the role played by alpha/beta interferon (IFN-alpha /beta ) and gamma interferon (IFN-gamma ) in these interactions in vivo. IFN-alpha /beta and IFN-gamma are pleiotropic cytokines which were originally identified as antiviral molecules (24, 63) but which also have many other important functions. For example, both types of IFN modulate the expression of MHC molecules (28, 29, 38), increase the lytic potential of natural killer (NK) cells (42), and inhibit the proliferation of many cell types in culture (45). In addition, IFN-alpha /beta was recently shown to drive the bystander proliferation of CD8+ T cells during certain viral infections (55) whereas IFN-gamma is known to activate macrophages (40), to induce the production of specific immunoglobulin (Ig) isotypes by B cells (14, 53), and to regulate the balance of cytokine production during immune responses (48).

Gene-disrupted mice proved to be very useful models to study the overall importance and effects of IFN-alpha /beta and IFN-gamma during viral infections in vivo (59). For example, mice lacking either the IFN-alpha /beta or the IFN-gamma receptor (IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice) were shown to have a defective natural resistance to vaccinia virus, lymphocytic choriomeningitis virus, and Theiler's virus (13, 23, 39). In addition, IFN-alpha /beta R0/0 but not IFN-gamma R0/0 mice had an increased susceptibility to vesicular stomatitis virus (VSV) and Semliki forest virus (39), whereas no increase in viral replication was observed upon infection of IFN-gamma R0/0 mice with pseudorabies virus (47) and upon infection of IFN-gamma 0/0 mice with Sendai virus or with murine gammaherpesvirus 68 (37, 46). However, little information is available so far on the role of IFN-alpha /beta and IFN-gamma during murine retroviral infections. In the murine AIDS (MAIDS) model, IFN-gamma contributes to the development of disease in MAIDS-susceptible mouse strains as shown through the use of neutralizing antibodies to IFN-gamma and of IFN-gamma 0/0 mice (16, 57), while the ability to produce IFN-alpha /beta has been linked to a MAIDS-resistant phenotype, although these data have not yet been corroborated by studies with IFN-alpha /beta R0/0 mice (22). Furthermore, the addition of exogenous IFN in cell culture had a variable effect on different retroviruses, with effects on early steps of the viral life cycle in some cases (5, 15, 51) and on late events in others (1, 31, 43, 50).

In this article, we provide data on MMTV infection of mice lacking either the IFN-alpha /beta or the IFN-gamma receptor. Since the immune response induced by the MMTV SAg plays a critical role in the virus-host interaction, we have studied the viral SAg activity as a way to monitor the efficiency of the viral infection and correlated it with the direct semiquantitative detection of proviral DNA in infected tissues. In addition, we have studied the influence of a functional IFN-gamma receptor gene on the isotype pattern of antibodies and on the balance of cytokine gene expression during the immune response to MMTV.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mice. BALB/c mice were obtained from Harlan Olac Ltd. (Bicester, United Kingdom). 129Sv/Ev IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice have been generated and described previously (23, 39) and were kindly provided by M. Aguet (Institute of Molecular Biology, Zürich, Switzerland). IFN-alpha /beta R0/0 or IFN-gamma R0/0 BALB/c mice were obtained by backcrossing the disrupted gene into the BALB/c background for 6 or 10 generations, respectively.

The genotype of the mice was determined by analysis of tail DNA. Southern blot analysis was used for the IFN-alpha /beta R0/0 mice, as described previously (39). Disruption of the IFN-gamma R gene was verified by PCR with the oligonucleotides 5' CCCATTTAGATCCTACATACGAAACATACGG and 3' TTTCTGTCATCATGGAAAGGAGGGATACAG. In the presence of a wild-type allele, these primers amplify a 189-bp fragment. With a disrupted allele, the amplification encompasses the inserted Neor gene and results in a 1,282-bp fragment.

Virus. We used MMTV(SW), an exogenous MMTV encoding a Vbeta 6-specific SAg (19). MMTV(SW)-infected mice were derived from mice originally purchased from IFFA Credo (L'Arbresle, France). Milk was collected from lactating virus-infected mothers by suction, as described previously (19). It was diluted 1:3 in phosphate-buffered saline (PBS), centrifuged at 600 × g for 10 min to skim, and stored in aliquots at -70°C.

Injections and samplings. In all experiments, female or male mice were used at 6 to 12 weeks of age. Mouse milk containing MMTV(SW) was diluted in PBS, and 20 µl was injected subcutaneously into the hind footpad of naive IFN-alpha /beta R0/0 BALB/c mice, IFN-gamma R0/0 BALB/c mice, or control heterozygous littermates. The milk was diluted to obtain a reproducible threefold increase, from about 12% to about 36%, in the percentage of Vbeta 6+ cells among CD4+ T cells on day 4 after footpad injection, as verified by titer determinations. This dose was chosen to give a strong but not maximal stimulation of SAg-reactive T cells, so that we could detect both an potential increase and potential decrease in the response of the knockout mice. At various time points after injection, the draining popliteal lymph node was isolated. Alternatively, mice were tail bled and leukocytes were recovered from heparinized blood samples by centrifugation through a Ficoll cushion.

Flow cytometric analysis. The following monoclonal antibodies were used: fluorescein isothiocyanate (FITC)-labeled anti-TCR Vbeta 6 (44.22.1) (41), FITC-labeled anti-B220 (RA3-3A1) (Caltag, San Francisco, Calif.), phycoerythrin (PE)-labeled anti-CD4 (H129.19), and PE-labeled anti-CD8 (53-6.7) (Boehringer, Mannheim, Germany). Lymph node or peripheral blood lymphocytes were stained in one step with a mixture of FITC-labeled and PE-labeled antibodies. Analysis was performed with a FACScan (Becton Dickinson, Mountain View, Calif.). Dead cells were excluded by a combination of forward- and side-scatter characteristics.

PCR. DNA was isolated from 106 lymph node cells after digestion at 52°C in 50 mM Tris-HCl (pH 8)-100 mM EDTA-0.5% sodium dodecyl sulfate-100 µg of proteinase K per ml. The DNA was extracted, precipitated, and resuspended at a DNA equivalent of 106 cells per 50 µl in 10 mM Tris-HCl-0.1 mM EDTA; 10% of this, corresponding to approximately 0.5 µg of genomic DNA, was used per PCR.

Semiquantitative PCR amplification of proviral DNA was performed with primers matching the conserved regions of the LTR, as described previously with some modifications (20). DNA extracted from mixtures of cells from BALB.D2 (Mtv-6, Mtv-7, Mtv-8, and Mtv-9) and BALB/c mice (Mtv-6, Mtv-8, and Mtv-9) at variable ratios was included as a control titer determination since Mtv-7 is closely related to MMTV(SW) in the target region for amplification (19). The PCR was performed with 1× PCR buffer containing 67 mM Tris-HCl (pH 8.8), 16 mM (NH4)2SO4, 0.01% Tween 20, 2.5 mM MgCl2, 200 µM deoxynucleoside triphosphates, 2 µCi of [alpha -32P]dATP, 1.5 U of Taq polymerase (Eurobiotaq; Eurobio, Les Vlis, France), and 200 nM each oligonucleotide (5' oligonucleotide CTCAGGAAGAAAAAGACGACAT, 3' oligonucleotide CAAACCAAGTCAGAAACCACTTG). The cycling conditions were 5 min at 94°C followed by 28 cycles of 1 min at 94°C, 1 min at 60°C, and 1 min at 72°C, with a final 10 min at 72°C. The PCR products were separated on an 8 M urea-6% polyacrylamide gel. Quantification was performed with an Instant Imager (Packard, Meriden, Conn.).

Competitive reverse transcription PCR (RT-PCR) analysis of IL-4 gene expression. Total RNA was extracted from cells of the draining popliteal lymph node with the Trizol reagent (Gibco, Basel, Switzerland) on day 5 or 6 after injection of MMTV. First-strand cDNA synthesis was performed with a kit as specified by the manufacturer (Pharmacia, Uppsala, Sweden). The cytokine polycompetitor plasmid pQRS was used to quantitate the amounts of transcripts originating from the interleukin-4 (IL-4) and the constitutively expressed hypoxanthine guanine phosphoribosyltransferase (HPRT) genes, with the primers and PCR conditions as described previously (44). Briefly, the cDNA was used as a template in the presence of serial fivefold dilutions of pQRS. After separation of the PCR products by agarose gel electrophoresis, the ratio of IL-4 to HPRT transcripts was calculated. The results are shown as the fold increase in the amount of IL-4 mRNA in mice infected with MMTV with respect to uninfected mice with the same genotype.

Enzyme-linked immunospot (ELISPOT) assay. The numbers of Ig-secreting cells in the draining lymph node were determined as described previously (49) with some modifications. Briefly, 96-well plates (Nunc Maxisorb; Gibco, Basel, Switzerland) were coated with 2 µg of goat anti-mouse IgG plus IgM (Tago, Burlingame, Calif.) per ml and blocked with PBS-1% bovine serum albumin. Freshly isolated lymph node cells were washed and resuspended in Dulbecco modified Eagle medium with 5% fetal calf serum, 1.7 mM L-glutamine, 10 mM HEPES, and 50 µM beta -mercaptoethanol. Cells were added to the plates as duplicates and in twofold titer determination series starting with 105 cells/well. After a 5-h incubation at 37°C, the plates were washed with PBS-0.1% Tween 20 and incubated overnight at 4°C with biotinylated goat anti-mouse IgM, IgG1, IgG2a, IgG2b, or IgG3 (Caltag). After incubation with a streptavidin-alkaline phosphatase conjugate (Boehringer Mannheim), the plates were developed with the substrate 5-bromo-4-chloro-3-indolyl phosphate (Sigma Chemical Co., St. Louis, Mo.) at 1 mg/ml in a buffer of 9% 2-amino-2-methyl-1-propanol (Sigma). The spots were counted by projection on an overhead projector.

Enzyme-linked immunosorbent assay (ELISA). Serum was collected by tail bleeding of infected mice. For this experiment, 96-well plates (Nunc Maxisorp) were coated with 6 µg of bacterial recombinant envelope protein gp52 per ml and blocked with PBS-1% bovine serum albumin. The serum samples were added and incubated at room temperature for 3 to 4 h. Specific IgG antibodies were detected with biotinylated antibodies against IgG isotypes (Caltag) followed by a streptavidin-alkaline phosphatase conjugate (Boehringer). The reaction was developed with p-nitrophenyl phosphate (pNPP) substrate (Sigma), and the optical density at 405 nm was read. A standard curve was prepared with the gp52-specific mouse monoclonal antibodies 2B5 (IgG1), H149.5 and H141.16 (IgG2a), and VE7 (IgG3). Serum titers were calculated from the serum dilution giving an optical density at 405 nm of 0.5.

In vivo neutralization assay. After depletion of complement by heating for 30 min at 56°C, the serum was mixed with virus and with PBS in equal volumes and was incubated on ice for 1 h. The mixture was injected into the hind footpad of naive BALB/c mice, and the draining popliteal lymph node was removed after 4 days. The percentage of Vbeta 6+ cells among the CD4+ T cells was measured by flow cytometry. Virus neutralization by the serum was determined from the reduction in the level of SAg-reactive Vbeta 6+ cells in comparison to the level reached after injection of the virus with a control serum from an uninfected mouse, as described previously (33). The results are shown as a percentage of neutralization by comparison with a titer determination curve obtained after injection of serial dilutions of the virus preparation with control serum.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Backcrossing of the disrupted IFN receptor genes to the BALB/c mouse strain. The susceptibility to MMTV infection differs widely among different mouse strains (2). In particular, efficient presentation of the viral SAg is critical for the establishment of a high-level infection. MHC class II molecules differ in their ability to present the MMTV SAgs, and I-E molecules are the best presenters of all MMTV SAgs (2, 21). Since the disruption of the IFN-alpha /beta R or of the IFN-gamma R gene was performed in 129Sv/Ev mice (H-2b, I-E-), a mouse strain which is not highly susceptible to MMTV and has not been used as a classical model of MMTV infection, we decided to backcross the disrupted genes to the susceptible BALB/c background (H-2d, I-E+). Backcrossing of the disrupted IFN-alpha /beta R or IFN-gamma R gene was performed for 6 or 10 generations, respectively, and heterozygous littermates were included as controls in all experiments, since heterozygous mice have not been shown to differ from wild-type animals in other studies (3a).

Early immune response induced by the viral SAg. To study the early immune response to MMTV in the presence or absence of a functional IFN-alpha /beta or IFN-gamma receptor, we injected MMTV(SW) into the footpad of adult IFN-alpha /beta R0/0, IFN-alpha /beta R+/0, IFN-gamma R0/0, or IFN-gamma R+/0 BALB/c mice and used flow cytometry to study the response in the draining popliteal lymph node at various time points after injection. Such an infection protocol has been shown previously to mimic the natural infection and to lead to a SAg-induced immune response in the draining lymph node, which is much easier to study than the small neonatal Peyer's patches (19, 27). All groups of mice showed a large increase in the percentage of SAg-reactive Vbeta 6+ CD4+ T cells, which peaked on day 4 after infection (Fig. 1A and B). During the same period, the percentage of control SAg-unreactive Vbeta populations did not change or showed only slight compensatory decreases (data not shown). No significant difference was observed between IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice and their respective control heterozygous littermates. Since the overall efficiency of MMTV infection ultimately depends upon the absolute magnitude of this early T-cell response, in particular upon the increase in the number of infected B cells resulting from this response, we also studied the absolute increase in the number of cells in the draining lymph node at various time points after infection. The number of B cells increased more than 10-fold during the response, with a peak on days 4 to 6 after infection (Fig. 1C and D). Here again, although the variability was higher, no significant difference in the absolute number of B cells (Fig. 1C and D) or T cells (data not shown) could be observed among the various groups. Finally, a dose-response experiment was performed to study the SAg-induced immune response after injection of increasing amounts of virus (Fig. 1E and F). Maximal doses of MMTV(SW) induced an increase in the percentage of Vbeta 6+ cells among CD4+ T cells to 40 to 48% in all groups of mice. Importantly, no significant shift was observed in the dose-response curve of IFN-alpha /beta R0/0 or IFN-gamma R0/0 BALB/c mice in comparison to their respective control littermates, showing that disruption of the IFN receptor does not cause an increased sensitivity to small amounts of MMTV, in contrast to the data reported for other viruses (23, 39).


View larger version (30K):
[in this window]
[in a new window]
 
FIG. 1.   Early immune response induced by the MMTV superantigen in mice lacking either the IFN-alpha /beta receptor (IFN-alpha /beta R) or the IFN-gamma receptor (IFN-gamma R). MMTV(SW) was injected into the hind footpad of BALB/c IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice or control heterozygous littermates. Cells of the draining popliteal lymph node were studied by flow cytometry at various time points after injection. (A and B) Percentage of SAg-reactive Vbeta 6+ cells among CD4+ T cells in IFN-alpha /beta R0/0 and IFN-alpha /beta R+/0 mice (A) or IFN-gamma R0/0 and IFN-gamma R+/0 mice (B). (C and D) Absolute number of B cells (B220+ CD4- CD8-) in the draining popliteal lymph node of IFN-alpha /beta R0/0 and IFN-alpha /beta R+/0 mice (C) or IFN-gamma R0/0 and IFN-gamma R+/0 mice (D). Data in panels A to D are shown as means ± 2 standard errors (SE) for groups of three to six mice per time point. (E and F) Dose-response experiment. IFN-alpha /beta R0/0 and IFN-alpha /beta R+/0 mice (E) or IFN-gamma R0/0 and IFN-gamma R+/0 mice (F) were infected with increasing doses of MMTV(SW), as indicated by the amount of purified milk (microliters) present in the 20 µl injected in the footpad. The percentage of Vbeta 6+ cells among CD4+ T cells in the draining lymph node is shown on day 4 after injection (mean for two or three mice per dose).

These results show that the early SAg-induced immune response is not modified in the absence of a functional IFN-alpha /beta or IFN-gamma system.

Detection of proviral DNA by PCR. A semi-quantitative PCR assay was used to correlate the viral SAg activity with a more direct estimate of the viral load in infected tissues (Fig. 2). PCR amplification was performed on genomic DNA extracted from infected lymph nodes with oligonucleotides matching conserved regions of the LTR and amplifying the variable 3' end of the sag gene (20). In such a PCR, the MMTV(SW) proviral DNA is amplified together with the DNA of endogenous Mtv (Mtv-6, Mtv-8, and Mtv-9 in BALB/c mice) and the PCR products are separated according to their size. The endogenous Mtv can be considered natural internal controls of the reaction. DNA extracted from mixtures of cells from BALB.D2 mice (Mtv-6, Mtv-7, Mtv-8, and Mtv-9) and BALB/c mice (Mtv-6, Mtv-8, and Mtv-9) at variable ratios was included as a titer determination, since Mtv-7 is closely related to MMTV(SW) and gives a PCR product of approximately the same size (Fig. 2A). The results are shown for samples of the draining lymph node on day 6 after injection of the virus, a time point when a peak of proviral DNA signal was demonstrated previously (18). No significant difference could be observed among the different groups of mice, as shown by a representative set of PCR products (Fig. 2B) or by the quantification of a larger number of samples (Fig. 2C). Similar results were obtained on days 4 and 10 after infection. These data correlate with measurements of the viral SAg activity and argue against a substantial antiretroviral effect of IFNs during the early immune response to MMTV.


View larger version (35K):
[in this window]
[in a new window]
 
FIG. 2.   Semiquantitative PCR analysis of proviral DNA from infected lymph node cells. DNA was extracted from cells of the draining popliteal lymph node on day 6 after footpad injection of MMTV(SW) into BALB/c IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice or control heterozygous littermates. PCR amplification was performed with primers matching conserved regions of the LTR. PCR products from MMTV(SW) provirus and from endogenous Mtv were separated according to their size. Endogenous Mtv are natural internal controls of the reaction. (A) Control titer determination with mixtures of cells from BALB/c (Mtv-6, Mtv-8, and Mtv-9) or BALB.D2 mice (Mtv-6, Mtv-8, and Mtv-9 + Mtv-7). (B) Representative set of samples from BALB/c IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice or control heterozygous littermates. C, control uninfected BALB/c mouse. (C) Quantification of a large number of samples (8 to 12 independent draining lymph nodes per group). The results are shown as a ratio between the MMTV(SW) and the Mtv-6 PCR products (mean ± 2 SE).

Long-term deletion of SAg-reactive cells. The MMTV infection was monitored by studying the viral SAg activity at later time points. A classical feature of SAgs is the clonal deletion of reactive T cells after the initial phase of stimulation (35, 62, 64). Such a deletion can be easily monitored in peripheral blood lymphocytes of infected mice. Furthermore, the kinetics and magnitude of the deletion correlate with the efficiency of the SAg presentation and with the initial dose of virus (18). A progressive decrease in the percentage of Vbeta 6+ CD4+ T cells was observed in IFN-alpha /beta R0/0 mice, IFN-gamma R0/0 mice, and control heterozygous littermates, reaching an almost complete deletion after 15 weeks (Fig. 3). During this period, the percentage of control SAg-unreactive Vbeta populations did not change or showed only slight compensatory increases (data not shown). Here again, no significant difference was seen between knockout mice and their respective control littermates. In addition, no increase in the amount of MMTV(SW) proviral DNA was seen in a set of target organs, including the spleen and mammary gland, during the late phase of the infection, and all groups of mice transmitted the virus with a similar efficiency to the first litter of the next generation of mice (data not shown). These results show that the two types of IFNs do not seem to play a significant antiviral role in MMTV infection. If minor differences cannot be excluded at late stages of the infection, they would be irrelevant, since they would not result in any change in the completion of the viral life cycle.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 3.   Kinetics of the deletion of SAg-reactive cells after infection with MMTV. BALB/c IFN-alpha /beta R0/0 (A) or IFN-gamma R0/0 (B) mice or control heterozygous littermates were injected in the hind footpad with MMTV(SW). Peripheral blood lymphocytes were isolated at various time points after infection, and the percentage of SAg-reactive Vbeta 6+ cells among CD4+ T lymphocytes was determined by flow cytometry. The results are shown as mean ± 2 SE for at least five mice per group.

Balance of cytokine gene expression during the SAg-induced immune response. In addition to its antiviral activity, IFN-gamma is known to modulate the production of several cytokines and, in particular, to play a central role in the regulation of Th1-Th2 CD4+ T-cell subsets. To study the importance of IFN-gamma on the expression of cytokine genes during the strong immune response triggered by the MMTV SAg, we extracted RNA from infected lymph nodes of IFN-gamma R0/0 or IFN-gamma R+/0 mice on day 5 or 6 after injection of MMTV(SW) and used a semiquantitative competitive RT-PCR assay for IL-4 mRNA. The basal levels of IL-4 mRNA in uninjected mice were very low and did not differ by more than twofold (data not shown). Despite variations in the results for individual mice, the amounts of IL-4 mRNA after injection of MMTV were significantly larger in the draining lymph node in the absence of a functional IFN-gamma receptor (Fig. 4). These results show that IFN-gamma negatively regulates the production of IL-4 during the early immune response to MMTV. Using the same technique, we also assessed the levels of IFN-gamma mRNA in the same samples (data not shown). The fold increase in the level of IFN-gamma mRNA after MMTV infection was smaller in IFN-gamma R0/0 mice than in control heterozygous littermates. However, the basal values were also higher in IFN-gamma R0/0 mice and the peak levels of IFN-gamma mRNA were thus similar in the presence and absence of IFN-gamma receptor.


View larger version (10K):
[in this window]
[in a new window]
 
FIG. 4.   Increase in IL-4 mRNA levels in the draining lymph node after infection with MMTV. BALB/c IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice or control heterozygous littermates were injected in the hind footpad with MMTV(SW). Total RNA was isolated from the draining popliteal lymph node on day 5 or 6 after infection. A semiquantitative competitive RT-PCR analysis of IL-4 transcripts was performed with HPRT mRNA to normalize the results. The data are shown as the fold increase in cytokine mRNA in the infected lymph node in comparison to a control lymph node from an uninfected mouse.

Antibody secretion during the SAg-induced immune response. In the course of the early immune response to MMTV, the T-cell-B-cell interaction induced by the viral SAg leads to the activation of the B cells, which differentiate and secrete large amounts of antibodies with a peak production on day 6 after infection (18, 34). We used an ELISPOT assay to study the isotype pattern of antibodies produced by cells of the draining lymph node after footpad injection of MMTV(SW). Dramatic differences were observed between IFN-gamma R0/0 mice and control littermates (Fig. 5A), whereas no changes were seen in IFN-alpha /beta R0/0 mice (data not shown). In the absence of a functional IFN-gamma receptor, at least 10-fold-fewer cells produced IgG2a at the peak of secretion on day 6. The number of cells secreting IgG3 was also significantly reduced. In contrast, the number of cells producing IgG1 was not increased and the number of cells producing IgM was even slightly reduced in the IFN-gamma R0/0 mice. As a result, the total number of IgM- and IgG-producing cells was smaller in the absence of IFN-gamma receptor (Fig. 5B) even if the total number of B cells in the draining lymph node was similar (Fig. 1D). These data confirm that IFN-gamma plays a critical role in inducing the switch to IgG2a and IgG3 production in vivo. However, the lack of increase in the number of IgG1-producing cells in IFN-gamma R0/0 mice is surprising in view of the increased amounts of IL-4 mRNA detected by RT-PCR (Fig. 4), since IL-4 has been shown to upregulate the production of IgG1 reciprocally to IFN-gamma (14, 53).


View larger version (23K):
[in this window]
[in a new window]
 
FIG. 5.   Quantification of the number of B cells producing Igs in the draining lymph node after infection with MMTV. BALB/c IFN-gamma R0/0 mice or control heterozygous littermates were injected in the hind footpad with MMTV(SW). Cells of the draining popliteal lymph node were isolated on day 6 after infection and used in an ELISPOT assay. The results are shown as the number of spot-forming cells per 105 B cells (mean ± SE for four mice per group) for individual Ig isotypes (A) or for all IgM- and IgG-producing cells (B).

Virus-specific antibody response. In parallel to the polyclonal antibody production triggered by the viral SAg, a viral envelope-specific humoral response can be observed quickly after MMTV infection, appearing on day 3 to 4 and persisting for life (32, 33). We were interested to study the influence of IFN-gamma on the generation and maintenance of this virus-specific response. The presence of MMTV-specific antibodies in the serum of infected mice was studied by an ELISA with recombinant viral envelope protein gp52 (Fig. 6). The results are shown for env-specific IgG of all isotypes (Fig. 6A) and of the IgG1 and IgG2a isotype only (Fig. 6B and C). Both IFN-gamma R0/0 and IFN-gamma R+/0 mice generated significant titers of virus-specific IgGs, especially at late time points after infection. However, the IgG titers tended to be lower in IFN-gamma R0/0 mice early after infection. In particular, the levels of env-specific IgG2a antibodies were markedly reduced and even undetectable on day 8 in mice lacking the IFN-gamma receptor. This reduction was no longer seen on day 200. Interestingly, titers of virus-specific IgG1 antibodies were similar but not increased in the absence of the IFN-gamma receptor, in accordance with the results of the ELISPOT assay (Fig. 5).


View larger version (11K):
[in this window]
[in a new window]
 
FIG. 6.   Virus-specific antibody response in the serum of BALB/c IFN-gamma R0/0 mice or control heterozygous littermates after infection with MMTV. Serum was collected at various time points after injection of MMTV(SW) and analyzed by ELISA for gp52-specific total IgG (A), IgG1 (B), or IgG2a (C). The results are shown for individual mice as the reciprocal serum dilution giving an optical density at 405 nm of 0.5. The horizontal line indicates the value obtained with control serum from an uninfected mouse.

To assess these antibodies functionally, an in vivo neutralization test was performed (Fig. 7), as described previously (33). A high neutralizing potential was observed for sera taken on day 8 after infection, even in IFN-gamma R0/0 mice with low IgG titers, probably because of the presence of neutralizing IgM antibodies. The serum neutralization potential was also not significantly different between IFN-gamma R0/0 and IFN-gamma R+/0 mice when the serum was used at higher dilutions (data not shown). In contrast, the virus neutralization observed with day 24 and day 50 sera from IFN-gamma R0/0 mice seemed to be less efficient than with sera from IFN-gamma R+/0 mice, although it was far from being completely abolished. Finally, all sera collected on day 200 were comparably neutralizing, with one exception. In summary, IFN-gamma seems to contribute to the generation of an early neutralizing IgG antibody titer after MMTV infection. Mice lacking the IFN-gamma receptor have a delayed increase in the titer of MMTV-specific IgG antibodies but eventually reach similar antibody titers to those of heterozygous littermates.


View larger version (16K):
[in this window]
[in a new window]
 
FIG. 7.   Virus-neutralizing activity in the serum of BALB/c IFN-gamma R0/0 mice or control heterozygous littermates after infection with MMTV as assessed by an in vivo neutralization test. Serum was collected at various time points after injection of MMTV(SW), coincubated with a virus preparation, and injected into naive BALB/c mice. Neutralization of the virus by the serum resulted in a smaller increase in the percentage of SAg-reactive CD4+ T cells in the draining lymph node on day 4 after infection. The results are shown for individual mice as a percentage of virus neutralization by using a standard curve obtained by injection of serial dilutions of the virus preparation.

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

We have used mice with a disrupted IFN-alpha /beta or IFN-gamma receptor gene to study the overall effects of these IFNs during MMTV infection in vivo. The MMTV SAg activity was taken as a measure of the viral infection, since there are no conventional methods available to measure MMTV titers in infected organs. The amplitude of the SAg response was shown previously to differ according to the dose of injected virus, with greater amplitudes of response for higher doses of virus (18). We therefore assumed that the SAg response would allow us to assess indirectly the level of viral replication in vivo and in particular to determine whether IFNs have a significant antiviral activity during MMTV infection.

We found that the SAg response to MMTV(SW) was not affected by disruption of either the IFN-alpha /beta or IFN-gamma receptor. In addition, no increase in the amount of proviral DNA could be observed in the infected lymph nodes of IFN-alpha /beta R0/0 or IFN-gamma R0/0 mice. These observations imply that IFNs do not play an essential role in the immunological events triggered by the SAg. Furthermore, they suggest that IFNs are not part of the important defense mechanisms of the host during MMTV infection. Similar results were obtained in the original 129Sv/Ev IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice, showing that the lack of a functional IFN-alpha /beta or IFN-gamma system does not convert a poorly susceptible mouse strain to a highly susceptible one (36a).

Our data do not necessarily imply that IFN-alpha /beta or IFN-gamma per se cannot have an effect on MMTV replication. It is possible that these molecules are produced in insufficient amounts and/or for too short a time to have a measurable antiviral effect in vivo. Such a paradox has already been reported for vesicular stomatitis virus (VSV), which does not replicate more effectively in IFN-gamma R0/0 mice but is usually sensitive to the addition of IFN-gamma to the cell culture (23, 60). Indeed, the production of MMTV particles has been previously reported to be inhibited by the addition of IFN-alpha /beta to infected mammary tumor cells in culture (4, 50). However, the effects observed upon addition of large doses of exogenous IFNs either in cell culture or in vivo might not be representative of the true role of these molecules in the course of a natural infection. IFNs have many effects on cell growth and metabolism which may exert profound changes on the replication of certain viruses, especially if they are applied at high concentrations. Therefore, we believe that gene-disrupted mice are particularly useful in distinguishing relevant antiviral effects of interferons in vivo from the different phenomena observed in cell culture.

MMTV is a noncytopathic retrovirus which establishes a lifelong infection of the host and does not cause acute pathologic effects. The lack of an apparent antiviral effect of IFNs on MMTV infection in vivo must be interpreted in this context. Indeed, the effects of IFNs might be more relevant for the control of acutely pathogenic cytopathic viruses such as VSV or vaccinia virus (23, 39). In the future, IFN-alpha /beta R0/0 and IFN-gamma R0/0 mice could be interesting models for use in studies of the course of infection with other retroviruses and for determinations of whether our observations with MMTV are representative of a general property of retroviruses or are specific for this virus. We already have preliminary evidence that IFNs might play a more important role in the course of infection with Moloney murine leukemia virus (36a).

The similar course of MMTV infection in IFN-gamma R0/0 BALB/c mice and heterozygous controls is also interesting, since IFN-gamma might have been expected to play an important role in the activation of MMTV-infected B cells. Indeed, the SAg-mediated amplification of MMTV infection clearly relies on a T-cell-dependent B-cell activation, and IFN-gamma might have been one of the signals mediating this interaction. However, the absolute increase in the number of B cells as well as in the amount of proviral DNA did not differ in IFN-gamma R0/0 BALB/c mice and control littermates, even though fewer antibody-producing cells were observed in these mice (Fig. 5B). Interestingly, there are data suggesting that cell-cell interactions (e.g., through CD40L-CD40 or CD28-B7 interaction) might play a more critical role than cytokine-mediated signals in the T-cell-B-cell interaction which is driving the amplification of the infected B cells during MMTV infection (7, 8).

Environmental and host genetic factors are known to influence the pattern of the Th1-Th2 CD4+ T-cell response in several experimental systems (48). In our study, the increased amounts of IL-4 mRNA observed in IFN-gamma R0/0 mice during the MMTV SAg-induced immune response are consistent with a skewing of the CD4+ T-cell response to a Th2 phenotype. In contrast, other groups have shown that IFN-gamma R0/0 mice failed to switch to a Th2 response when infected with pseudorabies virus or with the parasite Leishmania major (47, 54). These contrasting results might be explained by differences between the experimental systems or between mouse strains, since pseudorabies and L. major infections were studied in mice from the 129Sv/Ev background whereas we worked with IFN-gamma R0/0 mice backcrossed on the BALB/c background.

Studying the Ig isotype pattern is an indirect way to assess the Th1/Th2 cytokine balance, because the switch to IgG2a is known to be induced by IFN-gamma secretion (Th1 response) and the switch to IgG1 is induced by IL-4 secretion (Th2 response) (14, 53). We observed an at least 10-fold reduction in the number of IgG2a-secreting cells in IFN-gamma R0/0 mice, confirming that IFN-gamma is one of the key factors for the switch to this isotype in vivo. Interestingly, this reduction was most apparent in the polyclonal antibody response triggered by the viral SAg, as shown in the ELISPOT assay, and in the virus-specific antibody response at early time points after infection. At later time points, the titers of env-specific IgG2a also rose in the IFN-gamma R0/0 mice, indicating that other cytokines might ultimately compensate for the lack of IFN-gamma -mediated signals in the induction of the switch to IgG2a production. Data from others suggest that IFN-alpha /beta could have such an effect, since undetectable levels of specific IgG2a antibodies were observed during lymphocytic choriomeningitis virus infection in mice lacking both IFN-alpha /beta and IFN-gamma systems (58). In addition, the production of IgG3 antibodies was reduced in the IFN-gamma R0/0 mice, although to a lower extent than the production of IgG2a, in accordance with data from other groups (23, 52). In contrast, no significant increase in the number of IgG1-producing cells or in the virus-specific IgG1 titers were observed after infection. This finding is surprising in view of the increased amounts of IL-4 mRNA already detected by RT-PCR by days 5 and 6 after infection. It is possible, however, that the increased IL-4 production is not sufficiently high or sustained to have a measurable effect on the secretion of IgG1 in our experimental system.

Infection with MMTV induces the appearance of virus-specific neutralizing antibodies in the serum, which can be detected as early as 3 or 4 days after infection and persist for life (32, 33). Although this humoral response seems to be very efficient, its functional significance in the course of the viral life cycle remains unclear, as discussed previously (33). Since IgG2a is an important component of the early antibody response to MMTV as well as many other viruses (10), it was interesting to study the neutralizing activity of serum from IFN-gamma R0/0 and IFN-gamma R+/0 mice at various times after MMTV infection. A similar neutralizing activity was observed for sera taken on day 8 after infection, probably due to the presence of a virus-specific IgM response. A moderate decrease in neutralization was observed later in IFN-gamma R0/0 mice. However, this decrease was no longer apparent on day 200 after infection. These results show that IFN-gamma contributes to the early virus-specific antibody response during MMTV infection but is not required to maintain the response in the long term. They contrast with data from Schijns et al. showing more drastic effects of disruption of the IFN-gamma receptor on the neutralizing antibody response to pseudorabies virus (47).

In conclusion, our data show that IFN-alpha /beta and IFN-gamma systems do not seem to play an essential antiviral role during MMTV infection in vivo. Furthermore, the lack of a functional IFN-gamma receptor was observed to affect the cytokine balance during the immune response to MMTV, with an increased production of IL-4 mRNA compatible with a skewing of the T-cell response toward a Th2 phenotype. Finally, IFN-gamma R0/0 mice mounted an antibody response with a perturbed isotype pattern and exhibited transiently lower virus-specific antibody titers and neutralizing activity in serum than did control animals.

    ACKNOWLEDGMENTS

I.M. is supported by a grant from the Foundation Max Cloëtta (M.D.-Ph.D. program of the Swiss Academy of Medical Sciences). I.X., H.A.O., J.A.L. and H.D. are supported by grants from the Swiss National Science Foundation (SNSF 31-42468-94, 32-40489-94 and 31-46667-96).

We thank Frédéric Luthi for the production of bacterial recombinant MMTV gp 52, Christophe Von Garnier for help with the ELISA, and Michel Aguet and Sanjiv Luther for helpful discussions and critical reading of the manuscript.

    FOOTNOTES

* Corresponding author. Mailing address: Institute of Microbiology, Rue du Bugnon 44, 1011 Lausanne, Switzerland. Phone: 41-21-3144096. Fax: 41-21-3144095. E-mail: heidi.diggelmann{at}chuv.hospvd.ch.

dagger Permanent address: Pasteur Institute, Paris, France.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Aboud, M., and Y. Hassan. 1983. Accumulation and breakdown of RNA-deficient intracellular virus particles in interferon-treated NIH 3T3 cells chronically producing Moloney murine leukemia virus. J. Virol. 45:489-495[Abstract/Free Full Text].
2. Acha-Orbea, H., and H. R. MacDonald. 1995. Superantigens of mouse mammary tumor virus. Annu. Rev. Immunol. 13:459-486[Medline].
3. Acha-Orbea, H., A. N. Shakhov, L. Scarpellino, E. Kolb, V. Müller, A. Vessaz-Shaw, R. Fuchs, K. Blöchlinger, P. Rollini, J. Billotte, M. Sarafidou, H. R. MacDonald, and H. Diggelmann. 1991. Clonal deletion of Vbeta 14-bearing T cells in mice transgenic for mammary tumour virus. Nature 350:207-211[Medline].
3a. Aguet, M. Personal communication.
4. Arya, S. K., C. W. Czarniecki, and R. M. Friedman. 1980. Interferon induced inhibition of mouse mammary tumor virus production. J. Interferon Res. 1:147-154[Medline].
5. Avery, R. J., J. D. Norton, J. S. Jones, D. C. Burke, and A. G. Morris. 1980. Interferon inhibits transformation by murine sarcoma viruses before integration of provirus. Nature 288:93-95[Medline].
6. Bittner, J. J. 1936. Some possible effects of nursing on the mammary gland tumor incidence in mice. Science 84:162[Free Full Text].
7. Champagne, E., L. Scarpellino, P. Lane, and H. Acha-Orbea. 1996. CD28/CTLA4-B7 interaction is dispensable for T cell stimulation by mouse mammary tumor virus superantigen but not for B cell differentiation and virus dissemination. Eur. J. Immunol. 26:1595-1602[Medline].
8. Chervonski, A. V., J. Xu, A. K. Barlow, M. Khery, R. A. Flavell, and C. A. J. Janeway. 1995. Direct physical interaction involving CD40 ligand on T cells and CD40 on B cells is required to propagate MMTV infection. Immunity 3:139-146[Medline].
9. Choi, Y., J. W. Kappler, and P. Marrack. 1991. A superantigen encoded in the open reading frame of the 3' long terminal repeat of mouse mammary tumour virus. Nature 350:203-207[Medline].
10. Coutelier, J. P., J. T. van der Logt, F. W. Heessen, G. Warnier, and J. Van Snick. 1987. IgG2a restriction of murine antibodies elicited by viral infections. J. Exp. Med. 165:64-69[Abstract/Free Full Text].
11. Donehower, L. A., A. L. Huang, and G. L. Hager. 1981. Regulatory and coding potential of the mouse mammary tumor virus long terminal repeat: nucleotide sequence of an endogenous proviral long terminal repeat. J. Virol. 37:226-238[Abstract/Free Full Text].
12. Fasel, N., K. Pearson, E. Buetti, and H. Diggelmann. 1982. The region of mouse mammary tumor virus DNA containing the long terminal repeat includes a long coding sequence and signals for hormonally regulated transcription. EMBO J. 1:3-7[Medline].
13. Fiette, L., C. Aubert, U. Muller, S. Huang, M. Aguet, M. Brahic, and J. F. Bureau. 1995. Theiler's virus infection of 129Sv mice that lack the interferon alpha /beta or interferon gamma  receptors. J. Exp. Med. 181:2069-2076[Abstract/Free Full Text].
14. Finkelman, F. D., J. Holmes, I. M. Katona, J. F. Urban, Jr., M. P. Beckmann, L. S. Park, K. A. Schooley, R. L. Coffman, T. R. Mosmann, and W. E. Paul. 1990. Lymphokine control of in vivo immunoglobulin isotype selection. Annu. Rev. Immunol. 8:303-333[Medline].
15. Gendelman, H. E., L. M. Baca, J. Turpin, D. C. Kalter, B. Hansen, J. M. Orenstein, C. W. Dieffenbach, R. M. Friedman, and M. S. Meltzer. 1990. Regulation of HIV replication in infected monocytes by IFN-alpha . Mechanisms for viral restriction. J. Immunol. 145:2669-2676[Abstract].
16. Giese, N. A., R. T. Gazzinelli, J. K. Actor, R. A. Morawetz, M. Sarzotti, and H. C. Morse, III. 1996. Retrovirus-elicited interleukin-12 and tumour necrosis factor-alpha as inducers of interferon-gamma -mediated pathology in mouse AIDS. Immunology 87:467-474[Medline].
17. Golovkina, T. V., A. Chervonsky, J. P. Dudley, and S. R. Ross. 1992. Transgenic mouse mammary tumor virus superantigen expression prevents viral infection. Cell 69:637-645[Medline].
18. Held, W., A. N. Shakhov, S. Izui, G. A. Waanders, L. Scarpellino, H. R. MacDonald, and H. Acha-Orbea. 1993. Superantigen-reactive CD4+ T cells are required to stimulate B cells after infection with mouse mammary tumor virus. J. Exp. Med. 177:359-366[Abstract/Free Full Text].
19. Held, W., A. N. Shakhov, G. Waanders, L. Scarpellino, R. Luethy, J.-P. Kraehenbuhl, H. R. MacDonald, and H. Acha-Orbea. 1992. An exogenous mouse mammary tumor virus with properties of Mls-1a (Mtv-7). J. Exp. Med. 175:1623-1633[Abstract/Free Full Text].
20. Held, W., G. A. Waanders, A. N. Shakhov, L. Scarpellino, H. Acha-Orbea, and H. R. MacDonald. 1993. Superantigen-induced immune stimulation amplifies mouse mammary tumor virus infection and allows virus transmission. Cell 74:529-540[Medline].
21. Held, W., G. A. Waanders, H. R. MacDonald, and H. Acha-Orbea. 1994. MHC class II hierarchy of superantigen presentation predicts efficiency of infection with mouse mammary tumor virus. Int. Immunol. 6:1403-1407[Abstract/Free Full Text].
22. Heng, J. K. M., P. Price, C. M. Lai, and M. W. Beilharz. 1996. Alpha/beta interferons increase host resistance to murine AIDS. J. Virol. 70:4517-4522[Abstract].
23. Huang, S., W. Hendriks, A. Althage, S. Hemmi, H. Bluethmann, R. Kamijo, J. Vilcek, R. Zinkernagel, and M. Aguet. 1993. Immune response in mice that lack the interferon-gamma receptor. Science 259:1742-1745[Abstract/Free Full Text].
24. Isaacs, A., and J. Lindenmann. 1957. Virus interference. 1. The interferon. Proc. R. Soc. London Ser. B 147:258-267[Medline].
25. Kappler, J. W., U. Staerz, J. White, and P. C. Marrack. 1988. Self-tolerance eliminates T cells specific for Mls-modified products of the major histocompatibility complex. Nature 332:35-40[Medline].
26. Kappler, J. W., T. Wade, J. White, E. Kushnir, M. Blackman, J. Bill, N. Roehm, and P. Marrack. 1987. A T cell receptor Vbeta segment that imparts reactivity to a class II major histocompatibility complex product. Cell 49:263-271[Medline].
27. Karapetian, O., A. N. Shakhov, J.-P. Kraehenbuhl, and H. Acha-Orbea. 1994. Retroviral infection of neonatal Peyer's patch lymphocytes through an intact epithelium. J. Exp. Med. 180:1511-1516[Abstract/Free Full Text].
28. King, D. P., and P. P. Jones. 1983. Induction of Ia and H-2 antigens on a macrophage cell line by immune interferon. J. Immunol. 131:315-318[Abstract].
29. Korber, B., N. Mermod, L. Hood, and I. Stroynowski. 1988. Regulation of gene expression by interferons: control of H-2 promoter responses. Science 239:1302-1306[Abstract/Free Full Text].
30. Kozak, C., R. Callahan, G. Peters, V. Morris, R. Michalides, J. Dudley, M. Green, M. Davisson, O. Prakash, A. Vaidja, J. Hilgers, A. Verstraeten, N. Hynes, H. Diggelmann, D. Peterson, J. C. Cohen, C. Dickson, N. Sarkar, and R. Nusse. 1987. A standardized nomenclature for endogenous mouse mammary tumor viruses. J. Virol. 61:1651-1654[Abstract/Free Full Text].
31. Luftig, R. B., J. F. Conscience, A. Skoultchi, P. McMillan, M. Revel, and F. H. Ruddle. 1977. Effect of interferon on dimethyl sulfoxide-stimulated Friend erythroleukemic cells: ultrastructural and biochemical study. J. Virol. 23:799-810[Abstract/Free Full Text].
32. Luther, S. A., A. Gulbranson-Judge, H. Acha-Orbea, and I. C. MacLennan. 1997. Viral superantigen drives extrafollicular and follicular B cell differentiation leading to virus-specific antibody production. J. Exp. Med. 185:551-562[Abstract/Free Full Text].
33. Luther, S. A., I. Maillard, F. Luthi, L. Scarpellino, H. Diggelmann, and H. Acha-Orbea. 1997. Early neutralizing antibody response against mouse mammary tumor virus: critical role of viral infection and superantigen-reactive T cells. J. Immunol. 159:2807-2814[Abstract].
34. Luther, S., A. N. Shakhov, I. Xenarios, S. Haga, S. Imai, and H. Acha-Orbea. 1994. New infectious mammary tumor virus superantigen with Vbeta -specificity identical to staphylococcal enterotoxin B (SEB). Eur. J. Immunol. 24:1757-1764[Medline].
35. MacDonald, H. R., S. Baschieri, and R. K. Lees. 1991. Clonal expansion precedes anergy and death of Vbeta 8+ peripheral T cells responding to staphylococcal enterotoxin B in vivo. Eur. J. Immunol. 21:1963-1966[Medline].
36. MacDonald, H. R., R. Schneider, R. K. Lees, R. C. Howe, H. Acha-Orbea, H. Festenstein, R. M. Zinkernagel, and H. Hengartner. 1988. T cell receptor Vbeta use predicts reactivity and tolerance to Mlsa-encoded antigens. Nature 332:40-45[Medline].
36a. Maillard, I. Unpublished observations.
37. Mo, X. Y., R. A. Tripp, M. Y. Sangster, and P. C. Doherty. 1997. The cytotoxic T-lymphocyte response to Sendai virus is unimpaired in the absence of gamma interferon. J. Virol. 71:1906-1910[Abstract].
38. Mond, J. J., J. Carman, C. Sarma, J. Ohara, and F. D. Finkelman. 1986. Interferon-gamma suppresses B cell stimulation factor (BSF-1) induction of class II MHC determinants on B cells. J. Immunol. 137:3534-3537[Abstract].
39. Muller, U., U. Steinhoff, L. F. Reis, S. Hemmi, J. Pavlovic, R. M. Zinkernagel, and M. Aguet. 1994. Functional role of type I and type II interferons in antiviral defense. Science 264:1918-1921[Abstract/Free Full Text].
40. Murray, H. W., G. L. Spitalny, and C. F. Nathan. 1985. Activation of mouse peritoneal macrophages in vitro and in vivo by interferon-gamma . J. Immunol. 134:1619-1622[Abstract].
41. Payne, J., B. T. Huber, N. A. Cannon, R. Schneider, M. W. Schilham, H. Acha-Orbea, H. R. MacDonald, and H. Hengartner. 1988. Two monoclonal rat antibodies with specificity for the beta -chain variable region Vbeta 6 of the murine T-cell receptor. Proc. Natl. Acad. Sci. USA 85:7695-7698[Abstract/Free Full Text].
42. Perussia, B. 1991. Lymphokine-activated killer cells, natural killer cells and cytokines. Curr. Opin. Immunol. 3:49-55[Medline].
43. Pitha, P. M., W. P. Rowe, and M. N. Oxman. 1976. Effect of interferon on exogenous, endogenous, and chronic murine leukemia virus infection. Virology 70:324-338[Medline].
44. Reiner, S. L., S. Zheng, D. B. Corry, and R. M. Locksley. 1993. Constructing polycompetitor cDNAs for quantitative PCR. J. Immunol. Methods 165:37-46[Medline].
45. Rubin, B. Y., and S. L. Gupta. 1980. Differential efficacies of human type I and type II interferons as antiviral and antiproliferative agents. Proc. Natl. Acad. Sci. USA 77:5928-5932[Abstract/Free Full Text].
46. Sarawar, S. R., R. D. Cardin, J. W. Brooks, M. Mehrpooya, A. M. Hamilton-Easton, X. Y. Mo, and P. C. Doherty. 1997. Gamma interferon is not essential for recovery from acute infection with murine gammaherpesvirus 68. J. Virol. 71:3916-3921[Abstract].
47. Schijns, V. E. C. J., B. L. Haagmans, E. O. Rijke, S. Huang, M. Aguet, and M. C. Horzinek. 1994. IFN-gamma receptor deficient mice generate antiviral Th1-characteristic cytokine profiles but altered antibody responses. J. Immunol. 153:2029-2037[Abstract].
48. Seder, R. A., and W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635-673[Medline].
49. Sedgwick, J. D., and P. G. Holt. 1983. A solid-phase immunoenzymatic technique for the enumeration of specific antibody-secreting cells. J. Immunol. Methods 57:301-309[Medline].
50. Sen, G. C., and N. H. Sarkar. 1980. Effects of interferon on the production of murine mammary tumor virus by mammary tumor cells in culture. Virology 102:431-443[Medline].
51. Shirazi, Y., and P. M. Pitha. 1992. Alpha interferon inhibits early stages of the human immunodeficiency virus type 1 replication cycle. J. Virol. 66:1321-1328[Abstract/Free Full Text].
52. Snapper, C. M., T. M. McIntyre, R. Mandler, L. M. Pecanha, F. D. Finkelman, A. Lees, and J. J. Mond. 1992. Induction of IgG3 secretion by interferon gamma : a model for T cell-independent class switching in response to T cell-independent type 2 antigens. J. Exp. Med. 175:1367-1371[Abstract/Free Full Text].
53. Snapper, C. M., and W. E. Paul. 1987. Interferon-gamma and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236:944-947[Abstract/Free Full Text].
54. Swihart, K., U. Fruth, N. Messmer, K. Hug, R. Behin, S. Huang, G. Del Giudice, M. Aguet, and J. A. Louis. 1995. Mice from a genetically resistant background lacking the interferon gamma  receptor are susceptible to infection with Leishmania major but mount a polarized T helper cell 1-type CD4+ T cell response. J. Exp. Med. 181:961-971[Abstract/Free Full Text].
55. Tough, D. F., P. Borrow, and J. Sprent. 1996. Induction of bystander T cell proliferation by viruses and type I interferon in vivo. Science 272:1947-1950[Abstract].
56. Tsubura, A., I. Muneo, S. Imai, A. Murakami, N. Oyaizu, R. Yasumizu, Y. Ohnishi, H. Tanaka, S. Morii, and S. Ikehara. 1988. Intervention of T-cells in transportation of mouse mammary tumor virus (milk factor) to mammary gland cells in vivo. Cancer Res. 48:6555-6559[Abstract/Free Full Text].
57. Uehara, S., Y. Hitoshi, F. Numata, M. Makino, M. Howard, T. Mizuochi, and K. Takatsu. 1994. An IFN-gamma -dependent pathway plays a critical role in the pathogenesis of murine immunodeficiency syndrome induced by LP-BM5 murine leukemia virus. Int. Immunol. 6:1937-1947[Abstract/Free Full Text].
58. van den Broek, M. F., U. Muller, S. Huang, M. Aguet, and R. M. Zinkernagel. 1995. Antiviral defense in mice lacking both alpha/beta and gamma interferon receptors. J. Virol. 69:4792-4796[Abstract].
59. van den Broek, M. F., U. Muller, S. Huang, R. M. Zinkernagel, and M. Aguet. 1995. Immune defence in mice lacking type I and/or type II interferon receptors. Immunol. Rev. 148:5-18[Medline].
60. Vilcek, J., and G. C. Sen. 1996. Interferons and other cytokines, p. 375-399. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Virology Lippincott-Raven Publishers, Philadelphia, Pa.
61. Waanders, G. A., A. N. Shakhov, W. Held, O. Karapetian, H. Acha-Orbea, and H. R. MacDonald. 1993. Peripheral T cell activation and deletion induced by transfer of lymphocyte subsets expressing endogenous or exogenous mouse mammary tumor virus. J. Exp. Med. 177:1359-1366[Abstract/Free Full Text].
62. Webb, S., C. Morris, and J. Sprent. 1990. Extrathymic tolerance of mature T cells: clonal elimination as a consequence of immunity. Cell 63:1249-1256[Medline].
63. Wheelock, E. F. 1965. Interferon-like virus-inhibitor induced in human leukocytes by phytohemagglutinin. Science 149:310[Abstract/Free Full Text].
64. White, J., A. Herman, A. M. Pullen, R. Kubo, J. W. Kappler, and P. Marrack. 1989. The Vbeta -specific superantigen staphylococcal enterotoxin B: stimulation of mature T cells and clonal deletion in neonatal mice. Cell 56:27-35[Medline].


J Virol, April 1998, p. 2638-2646, Vol. 72, No. 4
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.



This article has been cited by other articles:

  • Lopez, C. B., Yount, J. S., Moran, T. M. (2006). Toll-like receptor-independent triggering of dendritic cell maturation by viruses.. J. Virol. 80: 3128-3134 [Full Text]  
  • Czarneski, J., Meyers, J., Peng, T., Abraham, V., Mick, R., Ross, S. R. (2001). Interleukin-4 Up-Regulates Mouse Mammary Tumor Virus Expression yet Is Not Required for In Vivo Virus Spread. J. Virol. 75: 11886-11890 [Abstract] [Full Text]  
  • Gao, N., Dang, T., Yuan, D. (2001). IFN-{gamma}-Dependent and -Independent Initiation of Switch Recombination by NK Cells. J. Immunol. 167: 2011-2018 [Abstract] [Full Text]  
  • Mustafa, F., Lozano, M., Dudley, J. P. (2000). C3H Mouse Mammary Tumor Virus Superantigen Function Requires a Splice Donor Site in the Envelope Gene. J. Virol. 74: 9431-9440 [Abstract] [Full Text]  
  • Himmelrich, H., Parra-Lopez, C., Tacchini-Cottier, F., Louis, J. A., Launois, P. (1998). The IL-4 Rapidly Produced in BALB/c Mice After Infection with Leishmania major Down-Regulates IL-12 Receptor {beta}2-Chain Expression on CD4+ T Cells Resulting in a State of Unresponsiveness to IL-12. J. Immunol. 161: 6156-6163 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maillard, I.
Right arrow Articles by Diggelmann, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maillard, I.
Right arrow Articles by Diggelmann, H.