Previous Article | Next Article 
J Virol, February 1998, p. 1616-1622, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Functional Analysis of Ground Squirrel Hepatitis Virus
Enhancer II
Geneviève
Fourel,1,
François
Ringeisen,2
Marc
Flajolet,1
Pierre
Tiollais,1 and
Marie
Annick
Buendia1,*
Unité de Recombinaison et Expression
Génétique, INSERM U163,1 and
Unité des Virus Oncogènes, CNRS
URA1644,2 Institut Pasteur, 75724 Paris Cedex
15, France
Received 2 July 1997/Accepted 15 October 1997
 |
ABSTRACT |
We have characterized a major regulatory element of ground squirrel
hepatitis virus (GSHV) located within a 90-nucleotide fragment of the
core promoter upstream sequences and have compared its organization to
that of woodchuck hepatitis virus (WHV) enhancer II (We2). The GSHV
element (Ge2) stimulates transcription from the viral core promoter and
heterologous promoters in an orientation-independent manner but
displays a lower level of activity than We2 in transient transfection
assays in human hepatoma cells. The general organization of Ge2 into
binding sites for the liver-enriched HNF-1 and HNF-4 proteins and for
ubiquitous factors of the NF1 and Oct families was found to be mostly
conserved with respect to the homologous We2 region. Accordingly,
transactivation by HNF-1 and HNF-4 plays an essential role in the
liver-specific transcriptional activity of both the GSHV and WHV core
promoters. Distinctive features of the GSHV enhancer consist of its
ability to bind C/EBP family factors in a central motif that overlaps
with one of the two HNF-4 sites and its differential binding affinities
for HNF-4.
 |
TEXT |
Hepadnaviruses are small enveloped
DNA viruses that replicate in the host liver through reverse
transcription of an RNA intermediate called pregenome and that cause
acute and chronic hepatitis. They include the human hepatitis B virus
(HBV) and related viruses infecting several rodents and birds. Chronic
infections with HBV, woodchuck hepatitis virus (WHV), and ground
squirrel hepatitis virus (GSHV) have been causally related to the
development of primary liver cancer in the hosts (reviewed in reference
2). It is therefore important to elucidate the
mechanisms that control the expression of viral genes and the
hepadnavirus life cycle. A key event in hepadnavirus infection is the
production of the 3.5-kb pregenome RNA, which also encodes the core
antigen and the polymerase (reviewed in reference
12).
While hepadnavirus genomes have similar genetic organization and
transcription patterns, they show marked evolutionary divergence in the
enhancer sequences that modulate transcription from the viral
promoters. The activity of the basal core/pregenomic promoter of HBV is
controlled in a liver-specific manner by its coordinated interactions
with two enhancers, distally located enhancer I (EnI) and enhancer II
(EnII), the latter of which overlaps with the core promoter upstream
regulatory sequences (28, 33, 43). In sharp contrast, a
single enhancer, located immediately upstream of the core promoter, was
characterized in the duck hepatitis B virus (6, 22). Recent
studies of the WHV transcription control sequences similarly identified
a single autonomous regulatory element (We2) which also maps to the
core promoter upstream sequences (11, 38). It has been shown
that WHV sequences homologous to HBV EnI display inefficient intrinsic
activity in transient transfection assays (7, 37) but that
they are essential for the establishment of an active enhancer complex
in conjunction with We2 (9, 11). The tissue specificity of
hepadnavirus core promoters and enhancers was found to be determined by
different combinations of binding motifs for liver-enriched and
ubiquitous factors. We have recently shown that the activity of WHV
EnII is primarily controlled by the liver-enriched HNF-1 and HNF-4 proteins, although members of the NF1 and Oct families of transcription factors also bind in a central region (11). The GSHV
regulatory sequences have so far received little attention. In a recent
study, Ueda and coworkers observed qualitatively similar properties of the GSHV and WHV enhancer elements, although significant differences in
the levels of EnII activity between the two related viruses were noted
(37). Here we report a detailed analysis of GSHV sequences
homologous to WHV EnII, showing that the GSHV element (Ge2) shares with
We2 a common structural and functional organization but exhibits
distinctive nuclear factor binding ability and reduced transcriptional
activation properties.
Alignment of the GSHV and WHV core promoter sequences reveals 85%
nucleotide homology in this region, as well as over the entire genome
(Fig. 1A). In the basal core promoter
sequences, a variant TATA box/initiator element and two distinct
transcription initiation sites for the precore and core/pregenomic
transcripts are well conserved among all mammalian hepadnaviruses
(3, 8, 11, 23, 44). The proximal HNF-1 site of WHV
(nucleotides 1830 to 1845; numbering according to Girones et al.
[14]) is perfectly conserved in GSHV sequences. In
contrast, some sequence divergence in the upstream region (nucleotides
1766 to 1810) might alter protein-DNA interactions previously
identified in the We2 element, notably at binding motifs for the HNF-4,
NF1, and octamer families of transcription factors (11, 38).

View larger version (29K):
[in this window]
[in a new window]
|
FIG. 1.
(A) Nucleotide sequence analysis of the GSHV and WHV
core promoter regions. Only nucleotides that differ between the two
sequences are represented in the WHV sequence. Numbering is as in
reference 14. Initiation sites of precore and
pregenomic RNAs are indicated by arrows, and the translation initiation
codon for precore protein is indicated by an oval. The partially
conserved basal core promoter element is boxed. WHV sequences known to
bind HNF-1, HNF-4, and NF1 are shaded. The C/EBP-binding motif in GSHV
is overlined by a black bar. Oct-binding sequences containing either a
canonical octamer motif (overlapping with the NF1b site) or
noncanonical motifs (overlapping with the GSHV C/EBP or WNF1a site) are
boxed. DR1 is one of the two direct viral repeats involved in the
replication process. (B) Transcriptional activation capacities of the
We2 and Ge2 elements. At the left is a schematic representation of the
constructs used in transient transfections of HepG2 cells. LUC,
luciferase gene; N-myc2, minimal N-myc2 promoter.
Numbers indicate positions relative to the transcription initiation
site (solid arrows). The black box indicates the noncoding region; the
grey box indicates the coding region. promC, WHV or GSHV sequences used
in direct orientation as promoter sequences. The simian virus 40 bidirectional polyadenylation signal (SV40pA) was placed upstream of
the inserted viral sequences (insert; broken arrows) to arrest
transcripts putatively arising from cryptic-vector or viral insert
promoters. The right side shows mean values of luciferase activity from
at least three independent experiments. Numbers indicate fold
activation relative to the WHV basal core promoter (lanes 1 to 3) or
N-myc2 promoter (lanes 4 to 6).
|
|
Transcriptional activation potency of GSHV upstream core promoter
sequences.
We previously reported that the We2 element is a
potent, liver-specific transcriptional activator, acting both on the
homologous WHV core promoter and on heterologous promoters in an
orientation-independent manner (11). The activity of the
corresponding GSHV sequences was assessed in transient transfections of
HepG2 cells, by using as a reporter the firefly luciferase gene.
Culture and transient transfection of human hepatoma cell line HepG2
were performed as described previously (41). Semiconfluent
HepG2 cells were transfected by the calcium phosphate coprecipitation
method using 13 µg of luciferase construct and 2 µg of
-galactosidase expression vector pCH110 per duplicate 6-cm-diameter
dish. The constructs used in transient assays are represented in Fig.
1B. Homologous GSHV and WHV sequences known to encompass the viral core
promoter were either inserted immediately upstream of the luciferase
gene in the same orientation or fused in reverse orientation to a
chimeric N-myc2 promoter/luciferase construct by a
previously described cloning strategy (11). The data shown
in Fig. 1B indicate that GSHV sequences corresponding in position to
the We2 element are functionally homologous to the latter, activating
transcription from the viral basal core promoter or from the promoter
of the N-myc2 oncogene. In both cases however, the GSHV
construct was less active than its WHV counterpart, the observed
differences ranging from 2.3-fold with the N-myc2 promoter
to 2.8-fold with the core promoter (compare lines 5 and 6 and lines 2 and 3). Similar results were obtained by using as a reporter the
luciferase gene driven by the HSV thymidine kinase minimal promoter
(data not shown). Our data are compatible with a recent report in which GSHV EnII was found to be fourfold less active than its WHV counterpart in N-myc2 promoter stimulation (37).
HNF-1 and HNF-4 binding sites in the GSHV core promoter.
DNase
I footprinting analysis of the GSHV core promoter region was performed
as described previously (11). The GSHV and control WHV
probes used in DNase I footprinting were generated by PCR amplification
of cloned GSHV (27) and WHV type 8 (WHV8) genomes
(14) from positions 1696 to 1960. As shown in Fig.
2A, a large domain extending from
positions 1755 to 1892 on the plus strand appeared similarly protected,
to a first approximation, in GSHV and WHV sequences by proteins from
mouse liver nuclear extract. HNF-1 and HNF-4 recombinant proteins both
induced footprinting over one and two sites, respectively, on the GSHV
probe (Fig. 2A, lanes 3 and 4), as previously shown for the WHV probe
(11). Conversely, protection of these sites by mouse liver
nuclear proteins was specifically abolished when double-stranded
oligonucleotides representing the WHV HNF-1 and HNF-4a sites (WHNF1 and
WHNF4a) were included as competitors in the reaction (Fig. 2B, lanes 5 and 6). Thus, liver-enriched factors HNF-1 and HNF-4 can bind at one
and two sites, respectively, within the GSHV element, as previously
shown for the homologous We2 sequence.

View larger version (57K):
[in this window]
[in a new window]
|
FIG. 2.
Comparative DNase I footprinting analysis of the core
promoter regions of GSHV and WHV. (A) The DNA fragment (nucleotides
1696 to 1960) of WHV (plus strand; We2+) or GSHV (Ge2+) 5'-end-labeled
at nucleotide 1696 was incubated in the presence of bovine serum
albumin, mouse liver nuclear extract (NE), the His-tagged HNF-1
DNA-binding domain, or HNF-4 protein, as indicated. The positions of
transcription factor binding motifs are indicated (Fig. 1A). (B) The
corresponding regions of WHV and GSHV (minus strand) were analyzed with
mouse liver nuclear extracts and with the indicated double-stranded
oligonucleotides (50 ng) as competitors. The WHNF1, WHNF4a, and WNF1a
oligonucleotides have been described previously (11), and
Gola was a 20-bp GSHV oligonucleotide spanning nucleotides 1788 to
1808. Chemical cleavage products of the viral probes at A and G
residues were used as size markers. The sequence ladder has to be read
as C plus T for minus-strand analysis to refer to Fig. 1A where only
the plus strand is represented. The positions of protein-binding motifs
and of the footprints induced by mouse liver nuclear extract are
indicated as bars. DNase I-hypersensitive sites are diagrammed as
arrows.
|
|
While the HNF-1 site is strictly conserved between GSHV and WHV
sequences, both GSHV HNF-4 sites (GHNF4a and GHNF4b) display
slight
nucleotide divergences from the corresponding WHNF-4 motifs
(Fig.
3A). To compare the relative
protein-binding affinities
of the HNF-4a and -4b sites between GSHV and
WHV, double-stranded
oligonucleotides corresponding to all four sites
were synthesized
and their abilities to compete for the interaction of
HNF-4 with
the GHNF4b site were analyzed by electrophoretic mobility
shift
assay (EMSA), by using mouse liver nuclear extracts as described
previously (
11). As shown in Fig.
3B, the unlabeled WHNF4a
oligonucleotide
competed as efficiently as the GHNF4b oligonucleotide
in binding
the HNF-4 protein to the GHNF4b probe but WHNF4b and GHNF4a
did
not compete as efficiently as WHNF4a. In a quantitative analysis,
the molar excess of unlabeled WHNF4b or GHNF4a oligonucleotides
required to reduce binding to the labeled probe to 50% of its
original
value was estimated to be threefold and sevenfold higher,
respectively,
than the required molar excess of the WHNF4a oligonucleotide.
Similar
results were obtained with recombinant His-tagged HNF-4
protein (data
not shown). These results strongly suggest that
the HNF-4 binding sites
of Ge2 and We2 display marked differences
in binding affinities, with
apparent decreasing affinity order
as follows: WHNF4a = GHNF4b > WHNF4b > GHNF4a. Strikingly, the
low-affinity WHNF4b and GHNF4a sites differ from the high-affinity
sites by one nucleotide exchange (G

A) at the second position
of
either direct repeat. An identical mutation is found in the
distal
HNF-4 site of HBV EnII (
16) (Fig.
3A). This site was
recently shown to bind primarily HNF-4, while other members of
the
nuclear receptor superfamily, including COUP-TF1, ARP1, RXR,
and PPAR,
can interact with the proximal HNF-4 site of HBV EnII
(
25).
Further studies are required to evaluate the possible
contribution of
these nuclear receptors to the activity of the
GSHV and WHV core
promoters.

View larger version (28K):
[in this window]
[in a new window]
|
FIG. 3.
HNF-4 binding by Ge2 and We2. (A) The HNF-4 consensus
binding site (29) was aligned with WHNF4a and -b sites, with
putative HNF-4-binding sites found in the GSHV core promoter, and with
the proximal and distal HNF-4 sites of the HBV core promoter. +, plus
strand; , minus strand. Arrows indicate repeats. The top line gives
the nucleotide most frequently found at each position. Less-frequent
nucleotides are shown underneath, with the lowercase letters
representing nucleotides at 10 to 20% of the sites. In the WHV and
GSHV sequences, nucleotides are underlined when they match the
consensus, not underlined when they are represented in 10 to 20% of
the previously characterized sites, and indicated by a double dot when
they are present in less than 10% of the sites. (B) Relative binding
activities of the GSHV and WHV HNF-4 sites. EMSAs were performed with
mouse liver nuclear extracts and the end-labeled GHNF4b oligonucleotide
(0.5 ng). Assay mixtures contained either no competitor (lanes 1 and
14) or a 20-, 60-, or 200-fold molar excesses of the unlabeled
oligonucleotides representing the HNF-4-binding sites in We2 and Ge2.
The bound complexes were resolved in 6% polyacrylamide gels and
quantified with a PhosphorImager (Molecular Dynamics). F, free probe.
|
|
A C/EBP binding site in Ge2 that partially overlaps with the
low-affinity HNF-4 site.
We previously reported that the We2
region lying between the HNF-4a and HNF-4b sites harbors two variant
NF1 sites [termed NF1(1*) sites], in which inverted repeats are
separated by only one nucleotide (11). These WHV NF1a and
NF1b motifs overlap with canonical and noncanonical Oct motifs
(18, 32) (Fig. 1A). They constitute an extended, composite
binding area for members of the NF1 and octamer families of
transcription factors, although the in vitro footprinting activity
appears to be essentially contributed by NF1 binding (11).
Comparative DNase I footprinting analysis of the GSHV and WHV core
promoters revealed a distinct protection pattern in this region (Fig.
2). A strong DNase I-hypersensitive site and a short unprotected region
were specifically observed on both the plus- and minus-strand GSHV
probes around position 1780 (Fig. 2B, lane 4, and data not shown).
Immediately adjacent to this DNase I-sensitive region, a footprint
coinciding with the NF1b motif was efficiently abolished by the WHV
NF1a oligonucleotide (WNF1a), used as a competitor (Fig. 2B, lane 7).
As the NF1b motif of GSHV differs from the WHV NF1a and NF1b sites at a
single position and as WNF1a and WNF1b also differ at this position,
this competition strongly suggests that NF1 binding is responsible for
the footprint observed over the GNF1b sequence.
In contrast, the WNF1a oligonucleotide competitor did not significantly
affect the DNase I digestion pattern between the NF1b
and HNF-4a sites,
in the region corresponding to the NF1a site
in We2 (Fig.
2B, lane 7).
Moreover, a protected subdomain extending
into the HNF-4a motif up to
position 1810 emerged distinctively
on both strands upon competition
with the WHNF4a oligonucleotide
(Fig.
2B, lane 6, and data not shown).
To better explore the protein-binding
pattern in this domain, we
designed GSHV-specific oligonucleotide
Gola (5'
CTGGGCATGATGCAAAAGGAC 3', positions 1788 to 1808; Fig.
1A). Gola
used as a competitor in a DNase I footprinting analysis
of the GSHV
probe was found to restore sensitivity to DNase I
digestion in the
corresponding region (Fig.
4, lanes 4 to
6; Fig.
2B, lane 8). In contrast to the corresponding WNF1a
oligonucleotide,
Gola was unable to compete for the binding of octamer
family members
in an EMSA (data not shown). An examination of Gola
sequences
revealed a potential C/EBP binding site (ATGATGCAAA).
Accordingly,
an oligonucleotide matching the consensus C/EBP
binding site with
directly abutted GCAAT inverted repeats, but not the
WNF1a oligonucleotide,
competed for protection against DNase I
digestion over the Gola
region with stoichiometry similar to that of
the Gola oligonucleotide
itself (Fig.
4, lanes 7 to 9 and 10 to 12).
Furthermore, bacterially
expressed C/EBP

-

, and -

all induced
a protected subdomain
extending over precisely the same region (lanes
15 to 17). This
footprint was also specifically induced with mouse
liver nuclear
extract preliminarily heated at 80°C, a treatment known
to preserve
C/EBP protein-binding capacity (Fig.
4, lane 18), and
protection
over this subdomain was abolished by using Gola as a
competitor
(lane 19), while the corresponding WHV sequence (WNF1a) had
no
effect (lane 20). Under these conditions, no significant protein
binding was observed on any other area of the GSHV core promoter
region
or on the WHV probe (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
FIG. 4.
DNase I footprinting analysis of the GSHV core promoter
region, with focus on the region extending from nucleotides 1770 to
1830 (plus-strand probe). Ranges of 2 to 20 ng of competitor
oligonucleotides were included in the upper panel. Further increasing
the amount of competitors resulted in nonspecific cross-competition of
C/EBP binding. C/EBP proteins were purified from a bacterial expression
system (42). When indicated, mouse liver nuclear extract
(NE) was subjected to a 5-min treatment at 80°C before incubation
with the probe. Other symbols and terminology are as defined in the
legend for Fig. 2.
|
|
These data demonstrate that the Ge2 element harbors a C/EBP binding
site which overlaps with the distal part of the low-affinity
HNF-4a
motif. This situation is reminiscent of the organization
of HBV EnII,
in which box-

contains overlapping binding motifs
for a C/EBP-like
protein and for HNF-4 (
16,
45).
Substantial sequence divergence between the Oct-binding motifs in We2
and the corresponding GSHV region prompted us to analyze
the ability of
Oct proteins to bind Ge2 in the central region.
We first compared the
binding capacities of two oligonucleotides
spanning either the WHV
classical Oct motif (Woct; positions 1770
to 1790) (
11) or
the corresponding Ge2 sequence (Goct; 5' TGGCATGCTAAGCGACAGCTG
3')
in an EMSA. Incubation of the Woct probe with mouse liver
nuclear
extracts yielded one major retarded complex (designated
complex A), and
the unlabeled Woct oligonucleotide competed effectively
for specific
protein binding (Fig.
5, lanes 1 and 2).
Identical
results were obtained with unlabeled Goct and H2Boct (a
strong
Oct site of the histone H2B promoter [
5]) as
the competitors
(data not shown). In contrast, protein interactions
with the Goct
probe were detected as a band with a mobility identical
to that
of complex A together with a faster-migrating complex (Fig.
5).
In competition experiments, a 100-fold excess of the unlabeled
Woct
oligonucleotide competed for binding of complex A but not
of the
faster-migrating complex (Fig.
5, lanes 2 and 4), while
a similar
excess of the unlabeled Goct competitor prevented any
detectable
protein binding, suggesting specific DNA-protein interactions
(data not
shown). The associated factor(s) was not investigated
further. Thus,
the Oct-binding capacity of the WNF1b site is retained
in the
corresponding GSHV sequence, in spite of substitutions
in the consensus
octamer motif (
39). The Oct-binding capacities
of the
regions spanning the WHV NF1a site and the GSHV C/EBP site,
which
harbor noncanonical Oct-binding motifs (nc1; positions 1790
to 1810;
Fig.
1A) were next investigated. Strikingly, incubation
of the Wnc1 and
Gnc1 probes with mouse nuclear extracts yielded
similar binding
patterns (Fig.
5, lanes 5 and 7). Two complexes
were generated: a minor
one with mobility identical to that of
complex A and a prominent,
faster-migrating doublet designated
complex B. The Woct oligomer
competed effectively for complex
A formation and to a lesser extent for
complex B formation (Fig.
5, lanes 6 and 8), and a similar excess of
the unlabeled Wnc1
and Gnc1 oligonucleotides prevented formation of
both complexes
when incubated with the homologous labeled probes
(results not
shown). These data strongly suggest that the different
Oct-binding
sequences of the e2 central region exhibit overlapping
binding
specificities but might preferentially associate with distinct
members of the octamer family (
26). Furthermore, the binding
specificities of Wnc1 and Gnc1 sites are not markedly different,
in
spite of significant nucleotide changes in the Ge2 region corresponding
to the noncanonical Wnc1 Oct motif, predicted to interact suboptimally
with both POUs and POUhd units of the Oct-binding domain
(
32).
This may be attributed to the emergence of a distinct,
more POU-specific
Oct motif that is shifted by three nucleotides in the
Ge2 region
overlapping with the C/EBP binding site (Fig.
1A).
Collectively,
the results presented here underscore the conservation of
a peculiar
binding pattern with multiple, intricate motifs in the
central
e2 region, although Ge2 differs from We2 by the loss of one NF1
site and by its specific ability to bind C/EBP factors.

View larger version (74K):
[in this window]
[in a new window]
|
FIG. 5.
EMSA of Oct protein binding to the central region of Ge2
and We2. The different oligonucleotide probes named above each lane
were derived from GSHV and WHV sequences that overlap with NF1 or C/EBP
binding sites, as shown in Fig. 1A. A 100-fold molar excess of
unlabeled Woct competitor was included when indicated (+). The specific
DNA-protein interaction detected by the Woct probe is indicated as
complex A. Faster-migrating complexes formed with the Goct probe are
designated by a star, and those formed with Wnc1 and Gnc1 are indicated
as complex B.
|
|
HNF-1 and HNF-4 sites are essential for Ge2 activity.
The
functional relevance of each of the characterized DNA-protein
interactions in the Ge2 element was then assessed by introducing mutations in the GSHV core promoter/luciferase construct and by analyzing luciferase expression in transiently transfected HepG2 cells.
The enzymatic inverse PCR method (31) for site-directed mutagenesis was used to introduce mutations in selected motifs. Remarkably, mutation of the GHNF1 site, which eliminated factor binding, resulted in a 100-fold reduction of Ge2 activity (Fig. 6, lines 1 and 2). Moreover, Ge2 activity
was reduced by 10-fold when mutations were introduced into either of
the GHNF4 sites and by 100-fold when both GHNF4 sites were mutated
(lines 2 to 5), and mutations in all three HNF-1 and HNF-4 sites
further decreased luciferase activity to barely detectable levels (line
6). Thus, as previously shown for We2, cooperative interactions between liver-enriched transcription factors HNF-1 and HNF-4 bound at three
sites in Ge2 sequences are crucial for transcriptional activation mediated by the GSHV element. We found a major difference in the relative impact of mutations introduced into the HNF-4 binding sites
between the related WHV and GSHV core promoters. Whereas the data
presented here demonstrate synergistic interactions between the two Ge2
HNF-4 sites, partial redundancy of the We2 HNF-4 sites was inferred
from a mutational analysis showing, for each site, a moderate decrease
of the WHV core promoter activity (30 to 50% of wild type) when
activity was assayed either in the context of the full-length genome
(11) or in luciferase constructs (9a). This
suggests different interplays between activators bound to cis regulatory elements and the basal machinery at the core
promoters of GSHV and WHV.

View larger version (32K):
[in this window]
[in a new window]
|
FIG. 6.
Impact of mutations in different protein-binding sites
on the capacity of Ge2 to activate the core promoter. At the left is a
schematic representation of the GSHV core promoter region and an
alignment of the viral sequences inserted in constructs. Transcription
initiation sites are indicated by arrows. Sequences of the basal core
promoter include a TATA box/initiator element (box with gradient
shading) surrounded by two stretches of 20 to 25 bp conserved with HBV
(grey ovals) and a second putative initiator element (white box).
Transcription factor binding sites shown in Fig. 1A are represented as
shown in the top line and mutated sites are indicated in black.
Mutations that abolished DNA-protein interactions were as follows:
HNF-1, ATCCAGTATTCGA;
HNF-4a, GGACGTTTCGACT; HNF-4b,
TGAAGTTTCTACC; C/EBP-Oct a,
TGGGCTAGATGGTTA; NF1-Oct b,
CAAGGCATGCTTTG (mutated positions
are underlined). At the upper right is a schematic representation of
the constructs used in transient transfections of HepG2 cells (see Fig.
1B for more details). At the lower right, the bar diagram depicts the
mean (± standard error of the mean) luciferase activities of Ge2
mutants relative to that of the wild type, obtained from more than
three independent transfection experiments. The activity of the
wild-type core promoter construct was arbitrarily set at 100.
|
|
In contrast, mutations at the NF1b-Oct site or at the C/EBP-Oct site
(Fig.
6, lines 7 and 8) did not significantly modify
Ge2 activity
compared to that of the wild type, and slightly enhanced
luciferase
expression. Combining mutations at NF1b-Oct and C/EBP-Oct
sites yielded
a similar result (Fig.
6, line 9). Therefore, neither
the NF1-Oct nor
the C/EBP-Oct motifs in the central region of
Ge2 were found to have
any significant influence on the level
of transcription from the
nucleocapsid promoter in transient assays.
Noticeably, similar data
were obtained in mutational analysis
of the corresponding We2 NF1-Oct
sites (
11).
In this study, we show that liver-specific transcriptional activity of
the GSHV core promoter is mediated by cooperative interactions
of HNF-1
and HNF-4 proteins with one and two
cis-acting sites
within
the Ge2 element. Thus, the general organization and functional
importance of the major nuclear factor recognition sites in Ge2
are
shown to be roughly conserved between GSHV and WHV (
11).
Accordingly, the core promoter could be swapped between GSHV and
WHV
genomes without major impact on viral transcriptional activity
in
transient transfection assays (
9a). The strong HNF-1-binding
site at nucleotides

78 to

66 of the precore mRNA start site
plays a
predominant role in the activity of GSHV and WHV core
promoters, as
also found for duck hepatitis B virus (
21). Transcription
factors of the HNF-1 homeoprotein family are pleiotropic activators
of
liver-specific genes (
36). Interestingly, mutations in the
HBV core promoter that create an HNF-1 binding site are associated
with
enhanced replication in patients with severe liver disease
(
15). The presence of two binding motifs for the HNF-4
orphan
receptor (
29), which might also be recognized by
other members
of the nuclear hormone receptor superfamily, is also
crucial for
Ge2 and We2 activities. However, marked differences in
HNF-4-binding
affinities between the GSHV and WHV sites, as well as in
the synergistic
interplay between the two HNF-4 sites, might account
for the lower
level of activity of Ge2 in transfected hepatoma cells.
Moreover, distinct changes in the pattern of protein binding to a
centrally positioned region which exhibits significant nucleotide
divergence could be conclusively demonstrated. Whereas this region
of WHV EnII was previously shown to constitute a composite binding
area
for NF1 and Oct proteins (
11), our present data indicate
that a single NF1-binding site was retained in the corresponding
GSHV
region, which evolved binding specificity for members of
the C/EBP
family of transcription factors (
20), as well as reduced
binding affinity for Oct proteins. Although these changes are
expected
to affect the interactions of the core promoter upstream
sequences with
the basal transcription machinery, a clear definition
of the
contribution of this region to Ge2 and We2 activity appeared
to be
refractory to standard analysis by transient transfection
assays. This
may arise as a consequence of atypical chromatin
packaging of
transfected DNA (
19) or of a defect in the ability
of
established human hepatoma cell lines to express some factors
required
for WHV transcription (
7). However, in recent studies
in
vivo, mutation of the canonical Oct site of WHV enhancer II
had no
effect on the virus ability to infect and replicate in
woodchucks,
whereas virus with mutations in the HNF-1 site was
apparently unable to
grow (
41a). Interestingly, the C/EBP-binding
site of Ge2 did
not confer significant responsiveness to expression
of C/EBP

, -

,
or -

or sensitivity to the expression of the CHOP
protein, a natural
inhibitor of C/EBPs (
9a). Features differentiating
We2 and
Ge2 elements might be indirectly linked to transcription,
residing
instead in architectural aspects (
34). Indeed, differences
in the patterns of DNase I-hypersensitive sites between We2 and
Ge2 in
the central region might reflect in differential accessibility
and
distortion of the DNA molecule assembled in nucleoprotein
complexes.
Oct binding to DNA through the POU domain can induce
marked bending
associated with DNase I-hypersensitive sites (
24,
40). Thus,
the loss of a composite NF1-Oct binding site as well
as differential
binding affinities of the Oct sites in Ge2 compared
to We2 may
plausibly result in differential DNA bending and altered
interactions
with the basal transcription machinery.
The high oncogenicity of WHV correlates with insertional mutagenesis of
myc oncogenes (
10,
13), and recent studies have
designated the e2 element as the major
cis-acting viral
element
candidate for
myc gene activation (
11,
37). By contrast, the
related GSHV is less oncogenic and appears
to be inefficient at
carrying out selected integration events, a
difference attributed
to viral determinants rather than host factors
(
17,
35). Whether
WHV and GSHV genomes differ in their
abilities to integrate into
appropriate loci or to
cis
activate the
myc promoters is presently
unknown. In either
case, it is tempting to speculate that the
differences between the
major enhancer elements of WHV and GSHV
noted in this study might be
relevant. Compelling support for
this hypothesis stems from earlier
studies of slow-transforming
retroviruses, demonstrating that subtle
alterations in the protein-binding
capacity of the enhancer may result
in dramatic differences in
the latent period of tumor onset
(
30). In particular, mutations
in one of the two NF1 sites
of the Moloney murine leukemia virus
markedly decreased the oncogenic
potential of this virus. It has
been shown that NF1 interacts with
histone H3 (
1), and it might
counteract repressive chromatin
structures as reported for a simian
virus 40 replication origin
(
4). Thus, the loss of one NF1
site in Ge2 might be of
little consequence for transcription of
the episomal genome but might
have a critical impact on the enhancer
activity in the context of
integrated viral sequences during hepatocarcinogenesis.
Differential
binding affinities for HNF-4 and/or other nuclear
receptors and for
octamer proteins might have similar effects.
Studies of chimeric
viruses in which the core promoter/e2 element
has been swapped between
GSHV and WHV are in progress to delineate
the contribution of this
viral determinant in the process of
myc gene activation in
whole-animal hosts.
 |
ACKNOWLEDGMENTS |
We thank P. Johnson for providing C/EBP expression vectors and
purified proteins, and D. Ron for the CHOP expression vector. M. Yaniv
is gratefully acknowledged for stimulating discussions. We wish to
thank the Cours de Virologie Générale at the Pasteur Institute for active contribution in mutagenesis and DNA-protein interaction experiments and F. Bergametti and A. Marchio for technical assistance.
This work was supported in part by a grant from the Association pour la
Recherche sur le Cancer (contract 6550). F.R. was the recipient of
fellowships from the Fondation pour la Recherche Médicale and the
Ligue Nationale contre le Cancer. M.F. was supported by the
Ministère de la Recherche et de l'Enseignement Supérieur.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Unité de
Recombinaison et Expression Génétique, Département
des Rétrovirus, Institut Pasteur, 28 rue du Dr. Roux, 75724 Paris
Cedex 15, France. Phone: 33/1 45 68 88 66. Fax: 33/1 45 68 89 43. E-mail: mbuendia{at}pasteur.fr.
Present address: Ecole Normale Supérieure de Lyon, CNRS
UMR49, Lyon, France.
 |
REFERENCES |
| 1.
|
Alevizopoulos, A.,
Y. Dusserre,
M. Tsai-Pflugfelder,
T. von der Weid,
W. Wahli, and N. Mermod.
1995.
A proline-rich TGF- responsive transcriptional activator interacts with histone H3.
Genes Dev.
9:3051-3066[Abstract/Free Full Text].
|
| 2.
|
Buendia, M. A.
1992.
Hepatitis B viruses and hepatocellular carcinoma.
Adv. Cancer Res.
59:167-226[Medline].
|
| 3.
|
Chen, I.-H.,
C.-J. Huang, and L.-P. Ting.
1995.
Overlapping initiator and TATA box functions in the basal core promoter of hepatitis B virus.
J. Virol.
69:3647-3657[Abstract/Free Full Text].
|
| 4.
|
Cheng, L., and T. J. Kelly.
1989.
Transcriptional activator nuclear factor I stimulates the replication of SV40 minichromosomes in vivo and in vitro.
Cell
59:541-551[Medline].
|
| 5.
|
Cleary, M. A.,
S. Stern,
M. Tanaka, and W. Herr.
1993.
Differential positive control by Oct-1 and Oct-2: activation of a transcriptionally silent motif through Oct-1 and VP16 corecruitment.
Genes Dev.
7:72-83[Abstract/Free Full Text].
|
| 6.
|
Crescenzo-Chaigne, B.,
J. Pillot,
A. Lilienbaum,
M. Levrero, and E. Elfassi.
1991.
Identification of a strong enhancer element upstream from the pregenomic RNA start site of the duck hepatitis B virus genome.
J. Virol.
65:3882-3886[Abstract/Free Full Text].
|
| 7.
|
Di, Q.,
J. Summers,
J. B. Burch, and W. S. Mason.
1997.
Major differences between WHV and HBV in the regulation of transcription.
Virology
229:25-35[Medline].
|
| 8.
|
Enders, G. H.,
D. Ganem, and H. Varmus.
1985.
Mapping the major transcripts of ground squirrel hepatitis virus: the presumptive template for reverse transcriptase is terminally redundant.
Cell
42:297-308[Medline].
|
| 9.
|
Flajolet, M.,
G. Fourel,
Y. Wei,
C. Transy,
C. A. Renard,
P. Tiollais, and M. A. Buendia.
1997.
Hepatocellular carcinoma in the woodchuck, p. 509-514. In
R. H. Purcell, J. L. Gerín, M. Rizzetto, and G. Verme (ed.), Viral hepatitis and liver diseases.
Edizioni Minerva Autica, Torino, Italy.
|
| 9a.
| Fourel, G. Unpublished data.
|
| 10.
|
Fourel, G.,
J. Couturier,
Y. Wei,
F. Apiou,
P. Tiollais, and M. A. Buendia.
1994.
Evidence for long-range oncogene activation by hepadnavirus insertion.
EMBO J.
13:2526-2534[Medline].
|
| 11.
|
Fourel, G.,
F. Ringeisen,
M. Flajolet,
F. Tronche,
M. Pontoglio,
P. Tiollais, and M.-A. Buendia.
1996.
The HNF1/HNF4-dependent We2 element of woodchuck hepatitis virus controls viral replication and can activate the N-myc2 promoter.
J. Virol.
70:8571-8583[Abstract/Free Full Text].
|
| 12.
|
Fourel, G., and P. Tiollais.
1994.
Molecular biology of the hepatitis B virus, p. 89-123. In
C. Bréchot (ed.), Human primary liver cancer: etiological and progression factors.
CRC Press Inc., Boca Raton, Fla.
|
| 13.
|
Fourel, G.,
C. Trépo,
L. Bougueleret,
B. Henglein,
A. Ponzetto,
P. Tiollais, and M. A. Buendia.
1990.
Frequent activation of N-myc genes by hepadnavirus insertion in woodchuck liver tumours.
Nature
347:294-298[Medline].
|
| 14.
|
Girones, R.,
P. J. Cote,
W. E. Hornbuckle,
B. C. Tennant,
J. L. Gerin,
R. H. Purcell, and R. H. Miller.
1989.
Complete nucleotide sequence of a molecular clone of woodchuck hepatitis virus that is infectious in the natural host.
Proc. Natl. Acad. Sci. USA
86:1846-1849[Abstract/Free Full Text].
|
| 15.
|
Günther, S.,
N. Piwon,
A. Iwanska,
R. Schilling,
H. Miesel, and H. Will.
1996.
Type, prevalence, and significance of core promoter/enhancer II mutations in hepatitis B virus from immunosuppressed patients with severe liver disease.
J. Virol.
70:8318-8331[Abstract/Free Full Text].
|
| 16.
|
Guo, W.,
M. Chen,
T. S. B. Yen, and J. H. Ou.
1993.
Hepatocyte-specific expression of the hepatitis B virus core promoter depends on both positive and negative regulation.
Mol. Cell. Biol.
13:443-448[Abstract/Free Full Text].
|
| 17.
|
Hansen, L. J.,
B. C. Tennant,
C. Seeger, and D. Ganem.
1993.
Differential activation of myc gene family members in hepatic carcinogenesis by closely related hepatitis B viruses.
Mol. Cell. Biol.
13:659-667[Abstract/Free Full Text].
|
| 18.
|
Herr, W., and M. A. Cleary.
1995.
The POU domain: versatility in transcriptional regulation by a flexible two-in-one DNA-binding domain.
Genes Dev.
9:1679-1693[Free Full Text].
|
| 19.
|
Jeong, S. W., and A. Stein.
1994.
Micrococcal nuclease digestion of nuclei reveals extended nucleosome ladders having anomalous DNA lengths for chromatin assembled on non-replicating plasmids in transfected cells.
Nucleic Acids Res.
22:370-375[Abstract/Free Full Text].
|
| 20.
|
Johnson, P. F., and S. C. Williams.
1994.
CCAAT/enhancer binding (C/EBP) proteins, p. 231-258. In
F. Tronche, and M. Yaniv (ed.), Liver gene transcription. R. G.
Landes Company, Austin, Tex.
|
| 21.
|
Lilienbaum, A.,
B. Crescenzo-Chaigne,
A. A. Sall,
J. Pillot, and E. Elfassi.
1993.
Binding of nuclear factors to functional domains of the duck hepatitis B virus enhancer.
J. Virol.
67:6192-6200[Abstract/Free Full Text].
|
| 22.
|
Liu, C.,
L. D. Condreay,
J. B. Burch, and W. Mason.
1991.
Characterization of the core promoter and enhancer of duck hepatitis virus.
Virology
184:242-252[Medline].
|
| 23.
|
Möröy, T.,
J. Etiemble,
C. Trépo,
P. Tiollais, and M. A. Buendia.
1985.
Transcription of woodchuck hepatitis virus in the chronically infected liver.
EMBO J.
4:1507-1514[Medline].
|
| 24.
|
Pierani, A.,
A. Heguy,
H. Fujii, and R. G. Roeder.
1990.
Activation of octamer-containing promoters by either octamer-binding transcription factor 1 (OTF-1) or OTF-2 and requirement of an additional B-cell-specific component for optimal transcription of immunoglobulin promoters.
Mol. Cell. Biol.
10:6204-6215[Abstract/Free Full Text].
|
| 25.
|
Raney, A. K.,
J. L. Johnson,
C. Palmer, and A. McLachlan.
1997.
members of the nuclear receptor superfamily regulate transcription from the hepatitis B virus nucleocapsid promoter.
J. Virol.
71:1058-1071[Abstract/Free Full Text].
|
| 26.
|
Scholer, H. R.
1991.
Octamania: the POU factors in murine development.
Trends Genet.
7:323-329[Medline].
|
| 27.
|
Seeger, C.,
D. Ganem, and H. E. Varmus.
1984.
Nucleotide sequence of an infectious molecularly cloned genome of ground squirrel hepatitis virus.
J. Virol.
51:367-375[Abstract/Free Full Text].
|
| 28.
|
Shaul, Y.,
W. J. Rutter, and O. Laub.
1985.
A human hepatitis B viral enhancer element.
EMBO J.
4:427-430[Medline].
|
| 29.
|
Sladek, F. M.
1994.
Hepatocyte nuclear factor 4 (HNF4), p. 207-230. In
F. Tronche, and M. Yaniv (ed.), Liver gene expression. R. G.
Landes Company, Austin, Tex.
|
| 30.
|
Speck, N. A.,
B. Renjifo,
E. Golemis,
T. N. Fredrickson,
J. W. Hartley, and N. Hopkins.
1990.
Mutations of the core or adjacent LVb elements of the Moloney murine leukemia virus enhancer alters disease specificity.
Genes Dev.
4:233-242[Abstract/Free Full Text].
|
| 31.
|
Stemmer, W. P. C., and S. K. Morris.
1992.
Enzymatic inverse PCR: a restriction site independent, single-fragment method for high-efficiency, site-directed mutagenesis.
Biotechniques
13:215-220.
|
| 32.
|
Stepchenko, A. G.
1994.
Noncanonical Oct-sequences are targets for mouse Oct-2B transcription factor.
FEBS Lett.
337:175-178[Medline].
|
| 33.
|
Su, H., and J. K. Yee.
1992.
Regulation of hepatitis B virus gene expression by its two enhancers.
Proc. Natl. Acad. Sci. USA
89:2708-2712[Abstract/Free Full Text].
|
| 34.
|
Tjian, R., and T. Maniatis.
1994.
Transcriptional activation: a complex puzzle with few easy pieces.
Cell
77:5-8[Medline].
|
| 35.
|
Transy, C.,
G. Fourel,
W. S. Robinson,
P. Tiollais,
P. L. Marion, and M. A. Buendia.
1992.
Frequent amplification of c-myc in ground squirrel liver tumors associated with past or ongoing infection with a hepadnavirus.
Proc. Natl. Acad. Sci. USA
89:3874-3878[Abstract/Free Full Text].
|
| 36.
|
Tronche, F.,
I. Bach,
T. Chouard,
B. David-Wattine,
M. Pontoglio,
F. Ringeisen,
D. Sourdive,
D. Thépot, and M. Yaniv.
1994.
Hepatocyte nuclear factor 1 (HNF1) and liver gene expression, p. 155-181. In
F. Tronche, and M. Yaniv (ed.), Liver gene expression. R. G.
Landes Company, Austin, Tex.
|
| 37.
|
Ueda, K.,
Y. Wei, and D. Ganem.
1996.
Activation of N-myc2 gene expression by cis-acting elements of oncogenic hepadnaviral genomes: key role of enhancer II.
Virology
217:413-417[Medline].
|
| 38.
|
Ueda, K.,
Y. Wei, and D. Ganem.
1996.
Cellular factors controlling the activity of woodchuck hepatitis virus enhancer II.
J. Virol.
70:4714-4723[Abstract/Free Full Text].
|
| 39.
|
Verrijzer, C. P.,
M. J. Alkema,
W. W. Van Weperen,
H. C. Van Leeuwen,
M. J. Strating, and P. C. Van Der Vliet.
1992.
The DNA binding specificity of the bipartite POU domain and its subdomains.
EMBO J.
11:4993-5003[Medline].
|
| 40.
|
Verrijzer, C. P.,
J. A. Van Ooterhout,
W. W. Van Weperen, and P. C. Van Der Vliet.
1991.
POU proteins bend DNA via the POU-specific domain.
EMBO J.
10:3007-3014[Medline].
|
| 41.
|
Wei, Y.,
G. Fourel,
A. Ponzetto,
M. Silvestro,
P. Tiollais, and M.-A. Buendia.
1992.
Hepadnavirus integration: mechanisms of activation of the N-myc2 retrotransposon in woodchuck liver tumors.
J. Virol.
66:5265-5276[Abstract/Free Full Text].
|
| 41a.
| Wei, Y., and D. Ganem. Personal communication.
|
| 42.
|
Williams, S. C.,
C. A. Cantwell, and P. F. Johnson.
1991.
A family of C/EBP-related proteins capable of forming covavently linked leucine zipper dimers in vitro.
Genes Dev.
5:1553-1567[Abstract/Free Full Text].
|
| 43.
|
Yee, J. K.
1989.
A liver-specific enhancer in the core promoter region of human hepatitis B virus.
Science
246:658-661[Abstract/Free Full Text].
|
| 44.
|
Yu, X., and J. E. Mertz.
1996.
Promoters for synthesis of the pre-C and pregenomic mRNAs of human hepatitis B virus are genetically distinct and differentially regulated.
J. Virol.
70:8719-8726[Abstract/Free Full Text].
|
| 45.
|
Yuh, C.-H., and L.-P. Ting.
1991.
C/EBP-like proteins binding to the functional box- and box- of the second enhancer of hepatitis B virus.
Mol. Cell. Biol.
11:5044-5052[Abstract/Free Full Text].
|
J Virol, February 1998, p. 1616-1622, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.