Previous Article | Next Article 
J Virol, February 1998, p. 1418-1423, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
Molecular Genetic Study of the Interaction of
Sindbis Virus E2 with Ross River Virus E1 for Virus Budding
Jiansheng
Yao,
Ellen G.
Strauss, and
James H.
Strauss*
Division of Biology, California Institute of
Technology, Pasadena, California 91125
Received 11 August 1997/Accepted 4 November 1997
 |
ABSTRACT |
Glycoprotein PE2 of Sindbis virus will form a heterodimer with
glycoprotein E1 of Ross River virus that is cleaved to an E2/E1 heterodimer and transported to the cell plasma membrane, but this chimeric heterodimer fails to interact with Sindbis virus
nucleocapsids, and very little budding to produce mature virus occurs
upon infection with chimeric viruses. We have isolated in both Sindbis
virus E2 and in Ross River virus E1 a series of suppressing mutations that adapt these two proteins to one another and allow increased levels
of chimeric virus production. Two adaptive E1 changes in an ectodomain
immediately adjacent to the membrane anchor and five adaptive E2
changes in a 12-residue ectodomain centered on Asp-242 have been
identified. One change in Ross River virus E1 (Gln-411
Leu) and one
change in Sindbis virus E2 (Asp-248
Tyr) were investigated in detail.
Each change individually leads to about a 10-fold increase in virus
production, and combined the two changes lead to a 100-fold increase in
virus. During passage of a chimeric virus containing Ross River virus
E1 and Sindbis virus E2, the E2 change was first selected, followed by
the E1 change. Heterodimers containing these two adaptive mutations
have a demonstrably increased degree of interaction with Sindbis virus nucleocapsids. In the parental chimera, no interaction between heterodimers and capsids was visible at the plasma membrane in electron
microscopic studies, whereas alignment of nucleocapsids along the
plasma membrane, indicating interaction of heterodimers with
nucleocapsids, was readily seen in the adapted chimera. The significance of these findings in light of our current understanding of
alphavirus budding is discussed.
 |
INTRODUCTION |
Alphaviruses comprise a group of 26 animal viruses that mature by budding of a preformed nucleocapsid
through the cell plasma membrane, such that the mature virus particle
contains a lipid envelope with two virus-encoded glycoproteins, called
E2 and E1, anchored in it. The alphavirus virion is a regular
icosahedral structure with T=4 symmetry, in contrast to the less well
defined structures possessed by many enveloped viruses. This symmetry arises in part because the regular geometry of the nucleocapsid, formed
when 240 copies of the capsid protein encapsidate the 11.7-kb viral RNA
genome, is imposed upon the glycoproteins during budding through a
one-to-one interaction between individual nucleocapsid subunits and the
cytoplasmic domains of glycoprotein E2; these E2 tail-capsid
interactions provide much of the free energy of budding (14,
15).
The viral glycoproteins E1 and PE2, a precursor to E2, associate to
form a heterodimer within minutes following their synthesis and
insertion into the endoplasmic reticulum (1). As the PE2/E1 heterodimers are transported to the cell surface, PE2 is cleaved to E2
by furin or a furin-like enzyme, resulting in an E2/E1 heterodimer (reviewed in reference 14). Sometime before budding
or during budding, three E2/E1 heterodimers associate to form a
trimeric spike, and the 240 heterodimers on the surface of the virion
thus form 80 spikes whose structure has been resolved to about 25Å (2, 11, 16). The interactions to form trimers, as well as
longer-range interactions between the glycoproteins in the virus, also
contribute to the free energy of budding (3, 17).
We previously found that a chimeric alphavirus that had PE2 from
Sindbis virus (SIN) but E1 from Ross River virus (RR), referred to as
SIN(RRE1), was almost nonviable because of a failure to bud
(19). The PE2 glycoproteins of SIN and RR share only 43% amino acid sequence identity, and the E1 glycoproteins share 51% identity. Despite this extensive sequence divergence, the SIN PE2 and
RR E1 encoded in the genome of SIN(RRE1) formed heterodimers that were
cleaved to E2/E1 heterodimers and transported to the cell plasma
membrane. However, these heterodimers differed in conformation from SIN
E2/SIN E1 heterodimers (as well as from RR E2/RR E1 heterodimers), as
shown by the facts that (i) the glycoproteins in the chimeric
heterodimers differed from those in the parental heterodimers in their
availability for biotinylation at the cell surface and (ii) the
chimeric heterodimers were unable to interact with SIN nucleocapsids to
drive budding. Although copious quantities of nucleocapsids were
present in the cytoplasm of cells transfected with SIN(RRE1) RNA
and chimeric E2/E1 heterodimers were clearly present in the plasma
membrane, no evidence for interaction of nucleocapsids with the
glycoproteins in the plasma membrane could be seen at the level of
electron microscopy. In the present study, we have isolated variants of
this chimeric virus in which the SIN E2 and RR E1 have become better
adapted to each other such that the interaction between the
heterodimers and the nucleocapsid is now readily observable in the
electron microscope and virus budding is 100-fold more efficient.
 |
MATERIALS AND METHODS |
Virus and cells.
Construction and characterization of the
full-length chimeric cDNA clone pSIN(RRE1) and transfection of cells
with RNA transcribed in vitro from this clone have been described, as
have the methods used for characterization of infected cells by
electron microscopy and for assay of intracellular nucleocapsids or
released virus by sucrose gradient sedimentation (19).
Passage of chimeric virus to produce adapted variants.
RNA
was transcribed from the chimeric cDNA clone pSIN(RRE1) and transfected
into BHK-21 cells, using Lipofectin, as previously described
(19). The culture fluid was harvested after 3 days, and
released virus was quantitated by plaque assay on BHK cells. Five
well-separated plaques were picked and used to initiate five independent passage series by infection of confluent monolayers of BHK
cells. After incubation for 3 days at 37°C, the culture fluid in each
series was diluted fivefold and used to infect a new plate of BHK
cells. Subsequent passages used the same procedure but with harvest
after 2 days rather than 3 days, and a total of 10 passages were
carried out for each of the five series. The culture fluid from the
10th passage (P10) was used to infect cells for preparation of RNA or
virus.
An additional six passage series were initiated by transfecting BHK
cells with RNA as described above and harvesting the culture fluid
after only 2 days. The culture fluid was divided into six parts, and
each was used to initiate an independent passage series. Subsequent
passages in each series were carried out as before. The culture fluid
from P10 was analyzed by plaque assay, and a single plaque was picked
and used to prepare a stock of virus.
Sequencing of variants.
For P10 of passage series 1, the
culture fluid was diluted and used to infect a 150-mm-diameter petri
plate of confluent BHK cells. After incubation for 36 h at 37°C,
the cells were harvested and total cytoplasmic RNA was isolated by
using RNAzol B as described by the manufacturer (TelTest Inc.),
followed by isolation of poly(A)-containing RNA by using an Oligotex
kit. First-strand cDNA was made by using a dT14 primer and
avian myeloblastosis virus reverse transcriptase at 42°C for 1 h. Second-strand cDNA was synthesized by using RNase H and DNA
polymerase I as described by Gubler and Hoffmann (4). The
double-stranded cDNA was blunt ended, fractionated on
low-melting-temperature agarose, ligated to phosphorylated
EcoRI linkers, and cloned into the EcoRI site of
pGEM3Z as previously described (13). Clones containing the
E1 and E2 regions were identified by colony lift hybridization. The
sequence of the entire structural region was obtained with Sequenase,
using appropriately chosen synthetic primers.
For sequencing of P5 of series 1 as well as of P10 of series 2 to 11, 150-mm-diameter petri plates of BHK cells were infected, released virus
was harvested after 48 h, precipitated with polyethylene glycol
(12), and resuspended in Tris-EDTA buffer, and RNA was extracted with phenol-chloroform. Reverse transcription-PCR was used to
amplify regions of the viral glycoprotein, followed by cloning of the
cDNA into the SmaI site of pGEM3Z. In the case of P5 of
series 1, the entire E2-E1 region was sequenced, whereas in the case of
passage series 2 to 11, only selected regions were sequenced, as
described in the text. In either case, first-strand cDNA was primed
with 5' ATTCCCCTCGAGGAATTCCCT15 3', and PCR
amplification used one of two sets of primers. Primer set 1, for
cloning of E2 sequences, consisted of sense primer 5'
CCTGGAATAGTAAAGGGA 3' and antisense primer 5'
GCTCGTAAGCTTTTGCGG 3'; primer set 2, for cloning of E1 sequences,
consisted of sense primer 5' CGGAACCAACCAGTGAAT 3' and
antisense primer 5' ATTCCCCTCGAGGAATTCCCT 3'. The PCR
product was purified on low-melting-temperature agarose gels, blunt
ended, phosphorylated, and cloned into SmaI-cut,
dephosphorylated pGEM3Z; in some cases the PCR DNA itself was sequenced
so as to obtain a consensus sequence that is not affected by PCR errors
or clonal variation; in other cases the cloned cDNA was sequenced, in
which case more than one clone was normally sequenced so as to obtain a
consensus sequence.
cDNA clones of adapted variants.
Mutations identified in
variant clones were moved into the full-length pSIN(RRE1) through
intermediate shuttle vectors. The 319-nucleotide (nt) E2 fragment
SnaBI-PflMI (SIN positions 9221 to 9550)
containing the E2 change at position 248 was cloned into an
intermediate vector consisting of the SspI-SspI
fragment from pSIN(RR6K) inserted into the EcoRI site of
pGEM3Z. The MluI-BssHII fragment from this
shuttle vector was then inserted into SIN(RRE1) by two-piece ligation.
For the E1 mutation, the 1,044-nt SmaI-NheI fragment (RR coordinates 10689 to 11733) was cloned into an
intermediate clone consisting of the full-length RR clone pRR40 from
which nt 2745 to 6468 had been deleted. The
EcoR47III-NheI fragment from this shuttle clone
was then cloned into pSIN(RRE1). To combine the two mutations, the
BssHII-XhoI fragment from the full-length clone
containing the E1 mutation was used to replace the corresponding fragment in the full-length clone containing the E2 mutation.
 |
RESULTS |
Adaptation of RR E1 to SIN E2.
SIN(RRE1) is a chimeric virus
whose genome is entirely derived from SIN except for the 6K gene, the
E1 gene, and the 3' nontranslated region, which have been replaced with
the corresponding regions of RR. Infection of cells with this chimera
leads to production of virus at a rate only about 10
7
that of SIN, due to the failure of the SIN E2/RR E1 heterodimers to
interact with nucleocapsids (19). When this chimeric virus was passaged 10 times in BHK cells, variants arose that formed larger
plaques and that produced about 100-fold more virus than did the
parental chimera during growth in BHK cells. Variants present in one
passage series were characterized in detail, and an overview of this
passage series is shown in Table 1. After five passages, variants that resulted in the production of 30-fold more
virus than did the parental chimera were present, whereas after 10 passages, variants that produced 200-fold more virus were present.
The structural regions from the P5 and P10 viruses were cloned and
sequenced. More than one clone was sequenced, and only changes present
in all clones are reported in order to eliminate changes that may have
been introduced during PCR. Only one change, Asp-248
Tyr in SIN E2,
was found in the P5 virus, whereas two changes, Asp-248
Tyr in SIN E2
and Gln-411
Leu in RR E1, were found in the P10 virus (Table 1). Thus
our preliminary conclusion was that the change in SIN E2 arose first
and allowed the virus to grow 30-fold better and was followed by a
second change in RR E1 that led to a further sevenfold increase in
virus production.
To further define the individual contributions of these two changes to
the phenotype of better growth and to rule out the possibility that
other changes in the chimeric virus genome were responsible for the
ability of the viruses to grow to higher titers, the changes in E2 and
E1 were placed individually or together into the parental chimeric cDNA
clone. The growth rates of viruses rescued from the reconstructed
clones are shown in Fig. 1; in this
growth curve, transfection of RNA was used to initiate infection so as
to reduce the possibility that further changes might occur in the
variants during the experiment. Each mutation separately allowed the
virus to grow better than the parental chimera; after 48 h, the E2
mutant had produced 15-fold more virus than the parent and the E1
mutant had produced 11-fold more virus. Combined, the two mutations had
a multiplicative effect on virus growth; after 48 h, the double
mutant had produced 200-fold more virus than the parental chimera. The
growth rate of the double mutant is still considerably less than that
of SIN, but it is clear that each of the changes adapts SIN E2 and RR
E1 to one another so as to allow an increase in the efficiency of
budding, leading to the production of much more virus than from the
parental chimera.

View larger version (17K):
[in this window]
[in a new window]
|
FIG. 1.
Growth curves of cloned variants of the chimeric
SIN(RRE1). The E2 change Asp-248 Tyr and the E1 change Gln-411 Leu
were inserted individually or together into the full-length chimeric
clone pSIN(RRE1). RNA was transcribed from the resulting clones and
used to transfect BHK cells, using Lipofectin, as previously described
(19). At the indicated times, 0.5 ml of culture fluid (of 3 ml in total) was removed and replaced with fresh medium, and the plaque
titer of released virus in the sample portion was determined. ,
parental chimera SIN(RRE1); , chimera containing the RR E1 mutation
Gln-411 Leu; , chimera containing the SIN E2 mutation
Asp-248 Tyr; , chimera containing both the E1 and the E2
mutations.
|
|
Electron microscopy.
BHK cells were infected with virus or
transfected with RNA from the different virus strains studied here, and
the cells were examined by thin-section electron microscopy at 12 or
24 h after infection. In Fig. 2 are
shown micrographs of cells 12 h after transfection with RNA from
pToto54 (as a wild-type SIN control) or RNA from
pSIN(RRE1)(E2:D248Y/E1:Q411L) (the reconstructed chimeric clone
containing the E1 and E2 mutations), of cells 12 h after infection
by uncloned virus from P10 of series 1 (for comparison with the
reconstructed clone), and of cells 24 h after transfection with
RNA from the parental chimera pSIN(RRE1). Abundant virus budding
from the plasma membrane is seen in cells transfected with SIN RNA
(Fig. 2A). In contrast, no budding is seen in cells transfected with
SIN(RRE1) RNA, nor are there nucleocapsids observed aligned along the
plasma membrane (Fig. 2B). In cells infected for 24 h as in Fig.
2B, nucleocapsids are frequently seen aligned along internal membranes
for both wild-type infection and infection by the chimera, whereas
12 h after transfection these internal membranous structures are
uncommon and nucleocapsids are found scattered throughout the cytoplasm
(19). The binding of nucleocapsids to these internal
membranes may indicate that the interaction of the nucleocapsid with
the chimeric heterodimers is not totally defective, although
interaction with chimeric heterodimers in the plasma membrane appears
to be nonexistent.

View larger version (146K):
[in this window]
[in a new window]
|
FIG. 2.
Electron microscopy of infected or transfected cells.
BHK cells were transfected with RNA (A, B, and D) or infected with
virus (C), and the cells were prepared for electron microscopy after
12 h (A, C, and D) or 24 h (B). (A) Transfection with RNA
from pToto54 as a wild-type SIN control; (B) transfection with RNA from
the parental chimera pSIN(RRE1); (C) infection with P10 virus from
passage series 1; (D) transfection with RNA from the reconstructed
adapted chimera pSIN(RRE1)(E2:D248Y/E1:Q411L). Note the abundance of
budding virus in panel A and the alignment of nucleocapsids along the
plasma membrane in panels C and D, which are not present in panel B.
|
|
Cells transfected with RNA from the doubly variant clone
pSIN(RRE1)(E2:D248Y/E1:Q411L) or infected with the uncloned P10 virus exhibit few budding figures, but there is now clear association of
nucleocapsids with the plasma membrane (Fig. 2C and D). The lack of
budding figures is consistent with the observation that the yield of
virus from the variant chimeras is <10
4 that of
wild-type virus. The alignment of nucleocapsids along the plasma
membrane, however, makes it clear that the mutations in E2 and E1 in
the variant chimera result in an increase in interactions between
nucleocapsids and heterodimers in the plasma membrane, allowing an
increase in virus budding and the observed production of 200-fold more
virus than for the parental chimera.
Effect of E2 Tyr-248 on SIN and E1 Leu-411 on RR.
These
results show that the change Asp-248
Tyr in SIN E2 adapts SIN E2 to
RR E1 and the change Gln-411
Leu in RR E1 adapts RR E1 to SIN E2. We
wished to examine whether these changes would interfere with the
interaction of E2 and E1 in the parental viruses. For this, the
Asp-248
Tyr mutation was placed into SIN clone pToto54 and the
Gln-411
Leu mutation was placed into RR clone pRR64, and the growth
of the resulting viruses was compared with that of SIN derived from
pToto54 and with that of RR derived from pRR64. Figure
3 shows growth curves in which infection
was initiated by transfection of BHK cells with RNA transcribed from
the different clones (to minimize the possibility that the results
could be affected by changes selected during the experiment). The E2
mutation had only a modest effect on growth of SIN virus in this
experiment, and yields of the mutant were within about a factor of 2 of
the parental virus over the entire time span of the experiment. The E1
mutation had a somewhat greater effect on the growth of RR, with yields
depressed by about a factor of 5.

View larger version (18K):
[in this window]
[in a new window]
|
FIG. 3.
Growth of SIN or RR containing the suppressing
mutations. The E2 change Asp-248 Tyr was inserted into the
full-length SIN clone pToto54, and the E1 change Gln-411 Leu was
inserted into the full-length RR clone pRR40. RNA transcribed in vitro
from pSIN Toto54 (as a wild-type control) or from pSIN Toto54(E2:D248Y)
containing the E2 mutation, or RNA transcribed from pRR40 (as a
wild-type control) or from pRR40(E1:Q411L), was used to transfect BHK
cells, using Lipofectin. After 1 h at 37°C, the transfecting mix
was removed and the cells were overlaid with 3 ml of medium. At the
times indicated, 0.5 ml of cell culture fluid was removed and replaced
with new medium, and the released virus was titrated by plaque assay.
, SIN Toto54; , SIN (E2:D248Y); , RR64; , RR(E1:Q411L).
|
|
In a second experiment, BHK cells were transfected with RNA transcribed
from different cDNA clones and the transfected cells were labeled with
[3H]uridine from 8 to 24 h after transfection in the
presence of dactinomycin. Nucleocapsids were harvested from transfected
cells at 24 h and sedimented on sucrose gradients, and virus
released into the medium over the transfected cells was examined on a
second set of sucrose gradients. The amount of label in virions and
nucleocapsids was quantitated, and the results are shown in Table
2 as a ratio relative to that produced
during SIN Toto54 transfection. The amount of radiolabeled virus
released from cells transfected with SIN(E2:D248Y) RNA was 60 to 100%
of that released from cells transfected with SIN RNA in two different
experiments, consistent with the results in Fig. 3. The amount of
radiolabel in nucleocapsids within the infected cell was 20 to 30%
greater in the case of SIN(E2:D248Y) than SIN; it is unclear whether
this difference is significant, but it might result from a slight
accumulation of nucleocapsids in the case of the mutant. In the same
experiment, the parental chimera and the doubly variant chimera
produced too little virus to be visible on sucrose gradients. The
amount of label in nucleocapsids in the cells transfected with the
parental chimera was slightly less than that in SIN-transfected cells,
as was found previously (19), whereas the doubly variant
chimera produced about the same amount of labeled nucleocapsids as did
SIN. The low level of radioactivity in nucleocapsids and virus in
RR-infected BHK cells relative to SIN-infected cells (Table 2) is
consistent with other results. As is clear from Fig. 3, RR infection of
BHK cells leads to the production of much less virus than does SIN infection, at least under the conditions used here. Furthermore, previous studies have shown that much more virus RNA is made following infection of Vero cells by SIN than by RR (5, 6), which would be expected to lead to the production of lesser amounts of
nucleocapsids. RR-infected BHK cells produce much more virus than do
the chimeras, however.
From the data in Table 2 and in Fig. 1 to 3, we conclude that the E2
mutation has at most modest effects on the growth and assembly of the
parental SIN while enabling the chimeric virus to assemble more virus
than does the parental chimera. The E1 mutation also enables the
chimera to assemble virus more efficiently but has a more pronounced
depressing effect on the growth of the parental RR.
Other adaptive mutations in E2 and E1.
To determine if other
changes in SIN E2 or in RR E1 would adapt the disparate glycoproteins
to one another, SIN(RRE1) was blindly passed in several independent
passage series. In every case, the P10 virus produced about 100-fold
more virus than did the original chimera (results for series 6 to 11 are shown in Table 3). The E2 and E1
genes from the P10 virus were sequenced in the region of the changes
found in passage series 1 (amino acids 225 to 270 in E2 and 375 to 416 in E1), and the results are shown in Table
4. In SIN E2, one other change at Asp-248 (Asp-248
Ala) and three changes at other amino acids (Val-237
Phe, Asp-242
Gly, and Leu-243
Ser) were found that presumably adapt SIN
E2 to RR E1. In RR E1, the Gln-411
Leu change was found in a second
passage series (note that in passage series 1 this change occurred at
some time after P5, and this change in passage series 4 is certainly an
independent event), and one change at a different amino acid
(Phe-399
Ser) was also observed. Thus, five different changes in SIN
E2 within the region from residues 237 to 248 and two different changes
in RR E1 in the region 399 to 411 appear to have been selected because
they lead to increased virus production. Because no changes were found
within these regions in 4 of the 11 series, it is clear that there must
be other adaptive mutations, presumably within E2 or E1, that have led
to increased virus production in these four series. Furthermore,
because only a single change was found in these regions in five series
although two changes were required to give the full 100-fold effect on
virus production in series 1, where the entire sequence was obtained,
it seems probable that there are additional adaptive changes within E2 or E1 of these five passage series as well.
The sequences of SIN and RR in the two relevant regions, together with
the sequences for four other alphaviruses for comparison, are shown in
Fig. 4. It is of interest that none of
the changes observed results in the conversion of the SIN amino acid to
the corresponding RR amino acid, or vice versa, and that in general the
affected residues show little conservation among alphaviruses.

View larger version (54K):
[in this window]
[in a new window]
|
FIG. 4.
Comparison of amino acids sequences of six alphaviruses
around the suppressing mutations. Aligned amino acid sequences of six
alphaviruses are shown for a short region of E2 and a short region of
E1. The changes identified in SIN E2 or RR E1 that allow more efficient
interaction in chimeric heterodimers are shown. Residues conserved in
all six alphaviruses are in boldface. Residue numbering is for SIN E2
and for RR E1. These six viruses represent three distinct lineages of
the alphavirus evolutionary tree (18). SIN and Aura viruses
belong to a common lineage and share 59% sequence identity in their
glycoproteins. RR and Semliki Forest (SF) viruses represent a second
lineage and share 74% sequence identity in their glycoproteins.
Eastern equine encephalitis (EEE) and Venezuelan equine
encephalitis (VEE) viruses represent a third lineage and share 51%
sequence identity in the glycoproteins. SIN and RR share 46% sequence
identity in the glycoproteins, and SIN and EEE share 47% identity.
|
|
 |
DISCUSSION |
Shortly after their synthesis, PE2 and E1 form a heterodimer
(1) that is cleaved to an E2/E1 heterodimer during transport to the plasma membrane (reviewed in reference 15).
The PE2/E1 heterodimer is more stable to treatment with low pH than is
the E2/E1 heterodimer, and it is thought that synthesis as a precursor allows the heterodimer to remain intact during transit to the plasma
membrane. The effect of the subsequent cleavage to an E2/E1 heterodimer
is to potentiate the disassembly of the heterodimer upon exposure of
the virion to the low pH of the endosomal compartment during infection
of a new cell, allowing exposure of the fusion domain in E1
(9). A second function of PE2 in the heterodimer is thought
to be as a chaperone to promote the proper folding of E1 in the
heterodimer; E1 undergoes a number of folding steps that involve the
breakage and formation of disulfide bonds (10), and
association with PE2 is required for this folding. At some point the
PE2/E1 or E2/E1 heterodimer trimerizes, but it is not clear whether
trimerization occurs early and it is the trimer that is incorporated
into the virion or whether trimerization occurs during budding. It is
known that the energy of trimerization is an important component of the
driving force for virus budding (3), as is the energy
provided by the one-to-one interactions between the cytoplasmic tails
of E2 and nucleocapsid subunits (reviewed in reference
15).
We previously found that SIN PE2 will form a heterodimer with RR E1
even though these proteins share only about 50% sequence identity with
their cognates (19), and thus the structures of these
proteins and their interaction domains must have been highly conserved
during the evolution of the alphaviruses. However, although the
chimeric heterodimer is cleaved and transported to the plasma membrane,
it is not functional for budding. The block to budding cannot lie in
the interaction of the glycoprotein tails and the nucleocapsid per se,
because only E2 has a significant cytoplasmic tail required for
budding, and in the chimera SIN E2 should be free to interact with SIN
nucleocapsids. Thus, incompatibilities between the two glycoproteins
must have arisen during speciation that lead to a block in virus
assembly. We report here that a single change in SIN E2 and a single
change in RR E1 allows these two glycoproteins to interact with one
another more efficiently in a chimeric heterodimer, such that
demonstrable interaction between the chimeric heterodimer and SIN
nucleocapsids now occurs at the plasma membrane and assembly of progeny
virus is increased about 100-fold. It is unclear whether these two
amino acids are present in contact domains for the E1-E2 interaction
and directly influence the interaction or whether they alter the
conformation of the glycoproteins and indirectly affect virus assembly.
Our finding that changes in four closely spaced amino acids within a
small domain of E2 and two amino acids within a small domain of E1 all
appear to increase the efficiency of virus budding suggests that these
regions may in fact interact directly. The E1 domain affected lies just
outside the lipid bilayer, adjacent to the membrane anchor which is
predicted to begin at Leu-413 (Fig. 4). Cheng et al. (2)
have interpreted their cryoelectron microscopic reconstructions of RR
as showing that the three E1/E2 heterodimers that form a spike are
entwined around one another in a stalk region immediately adjacent to
the lipid bilayer (reviewed in reference 15). Our
finding that this region of E1 is important for the interactions of the
glycoproteins is consistent with this interpretation. The E2 domain
affected by the suppressor mutations identified to date lies in the
middle of the linear sequence forming the ectodomain, and no structural
information exists to predict how this region might interact with E1.
It is unknown whether the changes selected during passage of the
chimera allow folding of E1 to proceed more efficiently so as to
produce a properly folded heterodimer or whether a closer interaction
between PE2(E2) and E1 allows more efficient packaging into virions,
perhaps because trimerization can now proceed. In any event, the
results suggest that changes in conformation allow the proper
positioning of the E2 tail in the heterodimer for interaction with the
nucleocapsid, whereas no interaction of capsids with heterodimers in
the plasma membrane are demonstrable with the parental chimera. It is
of interest that the effects of the two suppressing changes studied in
detail are not entirely reciprocal. The E2 change in SIN E2 allows SIN
PE2(E2) to interact more efficiently with RR E1 to produce adapted
chimeric virus but has at most a modest effect upon virus assembly
during SIN infection. The E1 change in RR has a more reciprocal effect;
it enables RR E1 to interact more efficiently with SIN PE2(E2) but
results in less efficient interaction with RR PE2(E2), at least as
assayed by the production of infectious virus.
There are at least two models that could explain our results with the
suppressor mutations. In one model, E2 and E1 must interact with one
another in a favorable way in order that the tail of E2 be properly
positioned for interaction with the nucleocapsid, and in the chimera
the interactions are not favorable. For example, it is believed that
the tail of PE2(E2) spans the bilayer when first synthesized but is
later retracted into the cytoplasm during transport, accompanied by
phosphorylation, dephosphorylation, and fatty acid acylation (7,
8). We do not know if the tail of E2 in the parental chimera has
been retracted, and it is possible that proper folding of E1 or close
interaction between E2 and E1 must occur before the events that lead to
retraction of the E2 tail can occur. Furthermore, even if the tail is
retracted, it is possible that faulty E1-E2 interactions result in
improper positioning of the tail in the cytoplasm for interaction with nucleocapsids. In a second model, the trimerization of the heterodimers is blocked by suboptimal interactions in the chimeric heterodimers. In
this model, in order to explain the electron microscopy results, we
suppose that the interaction of a single E2 tail with a nucleocapsid is
not sufficient to hold the nucleocapsid at the cell surface and that
trimerization, whether before or during budding, is required before a
stable interaction can occur. Similarly, it is also possible that if
trimerization occurs during transport of the proteins to the plasma
membrane, it might be required for retraction of the E2 tail. These
various models are not mutually exclusive, and a closer understanding
of the details of virus budding will be required to distinguish between
them.
 |
ACKNOWLEDGMENTS |
We are grateful to E. Lenches for expert technical assistance.
This work was supported by NIH grants AI 20612 and AI 10793.
 |
FOOTNOTES |
*
Corresponding author. Mailing address: Division of
Biology 156-29, California Institute of Technology, Pasadena, CA 91125. Phone: (626) 395-4903. Fax: (626) 449-0756. E-mail:
straussj{at}cco.caltech.edu.
Present address: B.C. Research Institute for Child and Family
Health, Vancouver, B.C. V5Z 4H4, Canada.
 |
REFERENCES |
| 1.
|
Barth, B.-U.,
J. M. Wahlberg, and H. Garoff.
1995.
The oligomerization reaction of the Semliki Forest virus membrane protein subunits.
J. Cell Biol.
128:283-291[Abstract/Free Full Text].
|
| 2.
|
Cheng, R. H.,
R. J. Kuhn,
N. H. Olson,
M. G. Rossmann,
H.-K. Choi,
T. J. Smith, and T. S. Baker.
1995.
Nucleocapsid and glycoprotein organization in an enveloped virus.
Cell
80:621-630[Medline].
|
| 3.
|
Ekström, M.,
P. Liljeström, and H. Garoff.
1994.
Membrane protein lateral interactions control Semliki Forest virus budding.
EMBO J.
13:1058-1064[Medline].
|
| 4.
|
Gubler, U., and B. J. Hoffman.
1983.
A simple and very efficient method for generating cDNA libraries.
Gene
25:263-269[Medline].
|
| 5.
|
Kuhn, R. J.,
D. E. Griffin,
K. E. Owen,
H. G. M. Niesters, and J. H. Strauss.
1996.
Chimeric Sindbis-Ross River viruses to study interactions between alphavirus nonstructural and structural regions.
J. Virol.
70:7900-7909[Abstract].
|
| 6.
|
Kuhn, R. J.,
H. G. M. Niesters,
H. Zhang, and J. H. Strauss.
1991.
Infectious RNA transcripts from Ross River virus cDNA clones and the construction and characterization of defined chimeras with Sindbis virus.
Virology
182:430-441[Medline].
|
| 7.
|
Liu, N., and D. T. Brown.
1993.
Phosphorylation and dephosphorylation events play critical roles in Sindbis virus maturation.
Virology
196:703-711[Medline].
|
| 8.
|
Liu, N., and D. T. Brown.
1993.
Transient translocation of the cytoplasmic (endo) domain of a type I membrane glycoprotein into cellular membranes.
J. Cell Biol.
120:877-883[Abstract/Free Full Text].
|
| 9.
|
Lobigs, M., and H. Garoff.
1990.
Fusion function of the Semliki Forest virus spike is activated by proteolytic cleavage of the envelope glycoprotein precursor p62.
J. Virol.
64:1233-1240[Abstract/Free Full Text].
|
| 10.
|
Mulvey, M., and D. T. Brown.
1994.
Formation and rearrangement of disulfide bonds during maturation of the Sindbis virus E1 glycoprotein.
J. Virol.
68:805-812[Abstract/Free Full Text].
|
| 11.
|
Paredes, A. M.,
D. T. Brown,
R. B. Rothnagel,
W. Chiu,
R. J. Schoepp,
R. E. Johnston, and B. V. V. Prasad.
1993.
Three-dimensional structure of a membrane-containing virus.
Proc. Natl. Acad. Sci. USA
90:9095-9099[Abstract/Free Full Text].
|
| 12.
|
Pierce, J. S.,
E. G. Strauss, and J. H. Strauss.
1974.
Effect of ionic strength on the binding of Sindbis virus to chick cells.
J. Virol.
13:1030-1036[Abstract/Free Full Text].
|
| 13.
|
Rice, C. M.,
L. Dalgarno,
R. Galler,
Y. S. Hahn,
E. G. Strauss, and J. H. Strauss.
1988.
Molecular cloning of flavivirus genomes for comparative analysis and expression, p. 83-97. In
H. Bauer, H.-D. Klenk, and C. Scholtissek (ed.), Modern trends in virology. Proceedings of the International Symposium, Giessen, June 1986.
Springer-Verlag, Berlin, Germany.
|
| 14.
|
Strauss, J. H., and E. G. Strauss.
1994.
The alphaviruses: gene expression, replication, and evolution.
Microbiol. Rev.
58:491-562[Abstract/Free Full Text].
|
| 15.
|
Strauss, J. H.,
E. G. Strauss, and R. J. Kuhn.
1995.
Budding of alphaviruses.
Trends Microbiol.
3:346-350[Medline].
|
| 16.
|
Vénien-Bryan, C., and S. D. Fuller.
1994.
The organization of the spike complex of Semliki Forest virus.
J. Mol. Biol.
236:572-583[Medline].
|
| 17.
|
von Bonsdorff, C.-H., and S. C. Harrison.
1978.
Hexagonal glycoprotein arrays from Sindbis virus membranes.
J. Virol.
28:578-583[Abstract/Free Full Text].
|
| 18.
|
Weaver, S. C.,
W. Kang,
Y. Shirako,
T. Rümenapf,
E. G. Strauss, and J. H. Strauss.
1997.
Recombinational history and molecular evolution of Western equine encephalomyelitis complex alphaviruses.
J. Virol.
71:613-623[Abstract].
|
| 19.
|
Yao, J. S.,
E. G. Strauss, and J. H. Strauss.
1996.
Interactions between PE2, E1, and 6K required for assembly of alphaviruses studied with chimeric viruses.
J. Virol.
70:7910-7920[Abstract].
|
J Virol, February 1998, p. 1418-1423, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Liao, M., Kielian, M.
(2006). Site-Directed Antibodies against the Stem Region Reveal Low pH-Induced Conformational Changes of the Semliki Forest Virus Fusion Protein. J. Virol.
80: 9599-9607
[Abstract]
[Full Text]
-
Sjoberg, M., Garoff, H.
(2003). Interactions between the Transmembrane Segments of the Alphavirus E1 and E2 Proteins Play a Role in Virus Budding and Fusion. J. Virol.
77: 3441-3450
[Abstract]
[Full Text]
-
Strauss, E. G., Lenches, E. M., Strauss, J. H.
(2002). Molecular Genetic Evidence that the Hydrophobic Anchors of Glycoproteins E2 and E1 Interact during Assembly of Alphaviruses. J. Virol.
76: 10188-10194
[Abstract]
[Full Text]
-
Kang, Y., Stein, C. S., Heth, J. A., Sinn, P. L., Penisten, A. K., Staber, P. D., Ratliff, K. L., Shen, H., Barker, C. K., Martins, I., Sharkey, C. M., Sanders, D. A., McCray, P. B. Jr., Davidson, B. L.
(2002). In Vivo Gene Transfer Using a Nonprimate Lentiviral Vector Pseudotyped with Ross River Virus Glycoproteins. J. Virol.
76: 9378-9388
[Abstract]
[Full Text]
-
Lu, Y. E., Eng, C. H., Shome, S. G., Kielian, M.
(2001). In Vivo Generation and Characterization of a Soluble Form of the Semliki Forest Virus Fusion Protein. J. Virol.
75: 8329-8339
[Abstract]
[Full Text]
-
Kim, K. H., Strauss, E. G., Strauss, J. H.
(2000). Adaptive Mutations in Sindbis Virus E2 and Ross River Virus E1 That Allow Efficient Budding of Chimeric Viruses. J. Virol.
74: 2663-2670
[Abstract]
[Full Text]
-
Tellinghuisen, T. L., Hamburger, A. E., Fisher, B. R., Ostendorp, R., Kuhn, R. J.
(1999). In Vitro Assembly of Alphavirus Cores by Using Nucleocapsid Protein Expressed in Escherichia coli. J. Virol.
73: 5309-5319
[Abstract]
[Full Text]
-
Yao, J., Gillam, S.
(1999). Mutational Analysis, Using a Full-Length Rubella Virus cDNA Clone, of Rubella Virus E1 Transmembrane and Cytoplasmic Domains Required for Virus Release. J. Virol.
73: 4622-4630
[Abstract]
[Full Text]
-
Garoff, H., Hewson, R., Opstelten, D.-J. E.
(1998). Virus Maturation by Budding. Microbiol. Mol. Biol. Rev.
62: 1171-1190
[Abstract]
[Full Text]