This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fear, W. R.
Right arrow Articles by Cunningham, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fear, W. R.
Right arrow Articles by Cunningham, A. L.

 Previous Article  |  Next Article 

J Virol, February 1998, p. 1334-1344, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.

Differential Tropism and Chemokine Receptor Expression of Human Immunodeficiency Virus Type 1 in Neonatal Monocytes, Monocyte-Derived Macrophages, and Placental Macrophages

Warwick R. Fear,1 Alison M. Kesson,2 Hassan Naif,1 Garry W. Lynch,1 and Anthony L. Cunningham1,*

Centre for Virus Research, Westmead Institutes of Health Research and Australian National Centre for HIV Virology Research, Westmead Hospital, The University of Sydney, Sydney,1 and Discipline of Pathology, Faculty of Medicine and Health Sciences and Department of Microbiology and Infectious Diseases, Hunter Area Pathology Service, John Hunter Hospital, Newcastle,2 Australia

Received 30 June 1997/Accepted 29 September 1997

    ABSTRACT
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Laboratory-adapted (LA) macrophage-tropic (M-tropic) human immunodeficiency virus type 1 (HIV-1) isolates (e.g., HIV-1Ba-L) and low-passage primary (PR) isolates differed markedly in tropism for syngeneic neonatal monocytes, monocyte-derived macrophages (MDMs), and placental macrophages (PMs). Newly adherent neonatal monocytes and cultured PMs were highly refractory to infection with PR HIV-1 isolates yet were permissive for LA M-tropic isolates. Day 4 MDMs were also permissive for LA M-tropic isolates and additionally, were permissive for over half the PR isolates tested. Qualitative differences in PR HIV-1 infection of monocytes/MDMs could not be correlated with CD4 levels alone, and in all three cell types the block to PR HIV-1 strain replication preceded reverse transcription. Neonatal monocyte susceptibility to PR HIV-1 strains correlated with increasing CCR-5 expression during maturation. CCR-5 could not be detected on newly adherent (day 1) neonatal monocytes, in contrast to adult monocytes (H. Naif et al., J. Virol. 72:830-836, 1998), but was readily detectable after 4 to 7 days of culture. However, moderate CCR-5 mRNA levels were present in day 1 neonatal monocytes and remained constant during monocyte maturation. CCR-5 was not detectable on the surface of PMs, yet the receptor was present within permeabilized cells. Notably, two brain-derived PR HIV-1 isolates from a single patient, differing in their V3 loops, were discordant in their abilities to infect neonatal monocytes/MDMs and PMs, yet both isolates could infect newly adherent adult monocytes. Together these data strongly suggest that LA HIV-1 isolates are able to infect neonatal monocytes at earlier stages of maturation and lower-level expression of CCR-5 than PR isolates. The differences between neonatal and adult monocytes in susceptibility to PR isolates may also be related to the level of CCR-5 expression.

    INTRODUCTION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Mononuclear phagocytes play a major role during human immunodeficiency virus (HIV) transmission and throughout all stages of HIV infection and disease in most tissues. Cells of monocytic lineage are thought to be the first infected by the virus following sexual and vertical transmission (67, 79), and dendritic cells have been implicated as the first cellular targets for simian immunodeficiency virus in a simian model of mucosal transmission (70). Human monocyte-derived macrophages (MDMs) are susceptible to HIV type 1 (HIV-1) infection in vitro (27, 54, 58, 64). However, some groups have reported that viral inoculation must occur within a temporal window of the monocyte differentiation process for a productive infection to be established. For example, Schuitemaker et al. (64) and Potts et al. (54) suggest that terminally differentiated in vitro MDMs are completely resistant to HIV-1 infection, inferring similar resistance by tissue macrophages in vivo. Differentiated cells of monocytic lineage have been shown to harbor and produce virus in the brains (39), lungs (6), and lymphoid systems (18) of HIV-1-infected individuals. Strong evidence now exists for the infection of circulating blood monocytes with HIV-1 (34, 46, 49, 63, 77), with most studies reporting that the infected cells are a minor subpopulation of the total monocyte pool.

The chemokine receptors CXCR-4 and CCR-5 have been found to act predominantly as fusion cofactors for T-cell-line-tropic and macrophage/dual tropic (M-tropic) HIV-1 infection of CD4-positive cells, respectively (1, 15, 17, 23). However, the roles of these receptors, particularly CCR-5, in mediating HIV-1 infection of cultured monocytes, MDMs, and tissue macrophages are ill-defined. Published data comparing relative infectibilities of monocytes, MDMs, and tissue macrophages from the same person have been compiled by using laboratory-adapted (LA) HIV-1 isolates (44, 58), but to date no studies using clinically relevant primary (PR) HIV-1 strains have been reported. Such data need to be correlated with chemokine receptor expression.

Differences between adult and neonatal monocytes/macrophages in HIV-1 infectability and chemokine receptor expression require further study. Such differences in susceptibility to HIV-1 infection between neonatal and adult cells may contribute to the different symptoms, severity of neuropathology, and rate of disease progression observed in pediatric AIDS cases (65, 73). To date, relevant reports have shown only that cord blood monocytes are more susceptible to infection with LA M-tropic HIV-1 isolates in vitro than their adult counterparts (30, 68). Therefore, we have analyzed in vitro infection of neonatal cord blood-derived monocytes, MDMs, and placental macrophages (PMs) with a panel of LA and PR isolates of HIV-1. To avoid discrepancies associated with host cell genetic variation in HIV-1 infection studies (5, 69), all three cell types were syngeneic. These infection data were then correlated with CD4, CXCR-4, and CCR-5 expression by neonatal cells and compared with HIV-1 susceptibility in adult monocytes/MDMs. Our results suggest correlations between CCR-5 expression and susceptibility to infection by PR but not LA M-tropic strains of HIV-1 in neonatal cells and differences in susceptibility to PR HIV-1 isolates between neonatal and adult cells. They also provide an explanation for the relative refractoriness of PMs to infection with PR HIV-1 isolates.

    MATERIALS AND METHODS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Isolation and culture of PMs. Villous macrophages were isolated from human term placentae via a modification of the method reported by Wilson et al. (74). About 50 g of chorionic villous tissue was removed and finely minced with sterile scissors. The tissue was washed five or six times in calcium- and magnesium-free Dulbecco's phosphate-buffered saline (PBS) (pH 7.4) to remove contaminating blood. Digestion of the tissue was performed in 200 ml of RPMI 1640 medium (GIBCO Laboratories, Grand Island, N.Y.) containing 2 U of Dispase II (Boehringer Mannheim GmbH, Mannheim, Germany) per ml and 30 U of DNase (Sigma-Aldrich, Sydney, Australia) per ml. The mixture was gently stirred at 37°C for 2 to 3 h, and the released cells were filtered through a coarse (1-mm) stainless steel gauze and a fine (80-µm) nylon mesh. After being washed twice with PBS, the cells were layered over a 1.045- and 1.065-g/mL discontinuous Percoll gradient (Pharmacia, Uppsala, Sweden) and centrifuged at 500 × g for 15 min. Cells at the 1.045/1.065-g/mL interface were collected, washed twice in PBS, and resuspended at 106 cells/ml in X-VIVO 15 (BioWhittaker Inc., Walkersville, Md.) for culture in 24-well plates (Costar, Cambridge, Mass.). The macrophages were cultured at 37°C with 5% CO2 in air, and the medium was changed twice weekly to remove nonadherent cells.

Isolation and culture of cord blood monocytes. Cord blood was typically collected from placentae yielding villous macrophages. Blood (25 to 35 ml) was drawn into a heparinized syringe, diluted 1:3 with PBS, and then layered over Ficoll-Paque (Pharmacia). After centrifugation at 500 × g for 20 min, the mononuclear cells were aspirated and washed, and T cells were lysed by using an anti-CD3 monoclonal antibody (MAb) (OKT3) (Ortho Diagnostics, Raritan, N.J.) and baby rabbit complement (Cedar Lane Laboratories, Hornby, Ontario, Canada). The remaining cells were washed twice in PBS and resuspended in RPMI 1640 plus 20% pooled human AB serum (RH20). The cells were seeded into 48-well tissue culture plates (Costar) and incubated at 37°C with 5% CO2 to allow adherence of the monocytes. After 2 h, the cells were gently washed three times with warm PBS, 1 ml of fresh RH20 medium per well was added, and the plates were returned to the incubator. Cultures were periodically checked for endotoxin contamination by using the Limulus amoebocyte lysate assay from BioWhittaker Inc.

Virus isolates. HIV-1Ba-L, HIV-1JR-FL, and HIV-1Ada-M are M-tropic isolates that were obtained from the National Institutes of Health AIDS Research and Reference Reagent Program, Bethesda, Md. (contributed by S. Gartner, M. Popovic, and R. Gallo, I. Chen, and H. Gendelman, respectively). Clinical strains WM-1039, -1044, -1061, -1063, -1067, -1068, -1076, -628, and -631 were isolated from blood and tissues of Australian patients at various stages of HIV-1 disease. WM-628 and -631 were isolated postmortem from the left temporal and right occipital lobes, respectively, from the brain of one patient (Table 1). All isolates were expanded in 3- to 4-day-old phytohemagglutinin-stimulated peripheral blood mononuclear cells (PBMCs) from HIV-1-seronegative donors. Cell-free viral supernatants were filtered (0.45-µm-pore-size filter; Millipore, Bedford, Mass.) and stored at -80°C until required. The 50% tissue culture infectious dose was determined with PBMCs according to the ACTG protocol (32). The syncytium-inducing or non-syncytium-inducing (NSI) phenotypes of PR isolates were determined by inoculating 5 × 104 MT-2 cells with 50 µl of viral cell-free supernatant in a 96-well plate with subsequent culture for 14 days. The zidovudine (AZT)-resistant syncytium-inducing HIV-1 isolate A-018, contributed by Douglas Richman through the National Institutes of Health AIDS Research and Reference Reagent Program, was used as a positive control.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 1.   Primary isolates of HIV-1 used in this study

HIV-1 infection of cells. PMs were infected on day 7 of culture, while cord blood monocytes were infected immediately after isolation, usually within 5 to 6 h after collection of the blood (day 0), or after overnight incubation (day 1). Cord blood MDMs were infected at various stages of in vitro differentiation. Virus stocks were pretreated with 40 U of RNase-free DNase (Boehringer Mannheim) per ml for 30 min at room temperature. For infection, culture medium was removed from the cells and filtered, cell-free isolates were applied at a multiplicity of infection of 0.1. The virus was incubated with the cells for 2 or 16 h at 37°C, inocula were removed, and the cells were washed four times with PBS before fresh culture medium was added. Medium was harvested every 3 to 4 days after infection and assayed for p24 antigen by enzyme-linked immunosorbent assay (ELISA).

HIV-1 DNA PCR. Adherent monocytes and PMs in 24- or 48-well plates were washed three times with PBS and then lysed with 50 to 100 µl of DNA lysis buffer (10 mM Tris-HCl [pH 8.0], 50 mM NaCl, 2.5 mM MgCl2, 0.5% Nonidet-P-40, 0.5% Tween 20, and 200 µg of proteinase K [Boehringer Mannheim] per ml). The cell lysate was transferred to a Microfuge tube and heated for 2 h at 60°C. Samples were then heated at 100°C for 15 min to inactivate the proteinase K and stored at -20°C until used in PCR.

All PCR manipulations were performed with aerosol-resistant pipette tips and with protocols designed to minimize cross-contamination of samples (42). Early products of HIV-1 reverse transcription (RT) were amplified by using the R/U5 oligonucleotide primer pair M667-AA55 (78). Full-length or nearly full-length HIV-1 cDNA M667 was amplified via the M667-M661 primer pair (78) or, alternatively, with M667 and FG1 (gag region 5' CTTAATACTGACGCTCTCGC 3'; nucleotides 359 to 340 according to the numbering system of Ratner et al. [56]). As an internal control the beta -globin gene primers PCO3 and PCO4 (59) were included in every reaction. The V3 loop region of HIV-1 env was amplified by using previously described primers (51), with the net charge of the sequenced loop predicted with DNA Strider 1.1 software.

DNA amplification was performed in a reaction volume of 50 µl with 20 µl of lysate template, 240 µM each deoxynucleoside triphosphate, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2, 100 ng of each primer, and 1.5 U of Taq polymerase (Promega, Sydney, Australia). The reaction mixture was then overlaid with 60 µl of mineral oil. After an initial denaturation for 5 min at 94°C, amplification involved 30 cycles of 94°C for 1 min, 60°C for 2 min, and 72°C for 3 min, with a final cycle at 72°C for 7 min, with a Perkin-Elmer thermocycler. In some experiments primer M667 was 5' end labeled with [gamma -32P]ATP to increase the sensitivity of the assay (78). Thirty to 50 ng of labeled primer, supplemented with unlabeled M667 to 100 ng, was included in the reaction mixtures. beta -Globin gene products were amplified simultaneously via similarly labeled PCO3, and all other parameters of the PCR were as described above. DNA standards were prepared from 8E5 cells (24) in a background of uninfected PBMCs by lysis and digestion as described for sample DNA. Radiolabeled PCR products were run on 8% native polyacrylamide and visualized by autoradiography after drying of the gels.

RT-PCR for chemokine receptor mRNA. Total RNA was extracted from adherent cells in situ by using Trizol (GIBCO BRL, Sydney, Australia) according to the manufacturer's recommendations. Two micrograms of RNA was reverse transcribed with oligo(dT) priming (Boehringer Mannheim) and Superscript II (GIBCO BRL) reverse transcriptase in a 40-µl reaction volume at 42°C for 50 min. A mock reaction with a mixture containing RNA but no reverse transcriptase was run in parallel. Two microliters of the cDNA product or mock reaction product was then subjected to 30 cycles of PCR amplification consisting of 1 min at 95°C, 1 min at 57°C, and 2 min at 72°C with a 7-min final extension at 72°C. The 50-µl amplification reaction mixtures and the reactions were as described for DNA PCR. PCR products were purified (12) and sequenced in two directions on an Applied Biosystems model 373A automated sequencer by using Taq polymerase and dye terminator chemistry. The following oligonucleotide primers for CCR-1, CCR-3, CCR-5, CXCR-4, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were designed from published cDNA sequences (26, 28, 43, 53, 62): CCR-1, C1S (5' TGG AAA CTC CAA ACA CCA CAG 3') and C1A (5' CCC AGT CAT CCT TCA ACT TG 3'); CCR-3, C3S (5' TGA CAA CCT CAC TAG ATA CAG TTG 3') and C3A (5' CTC TTC AAA CAA CTC TTC AGT CTC 3'); CCR-5, C52S (5' AAT AAT TGC AGT AGC TCT AAC AGG 3') and C52A (5' TTG AGT CCG TGT CAC AAG CCC 3'); CXCR-4, F2S (5' TGA CTC CAT GAA GGA ACC CTG 3') and F2A (5' CTT GGC CTC TGA CTG TTG GTG 3'); and GAPDH, G2S (5' ATG GAG AAG GCT GGG GCT C 3') and G2A (5' AAG TTG TCA TGG ATG ACC TTG 3').

Southern hybridization and oligonucleotide probes. Nonradiolabeled M667-FG1 PCR products were resolved on 2% agarose gels, stained with ethidium bromide, and visualized under UV light. DNA was denatured (0.5 M NaOH, 1.5 M NaCl) for 30 min and neutralized (1 M Tris-HCl, 1.5 M NaCl) for 30 min before capillary transfer to a Hybond-N membrane (61). Membranes were prehybridized in a solution containing 5× SSC (1× SSC is 0.15 M NaCl plus 0.015 M sodium citrate), 5× Denhardt's solution, 100 µg of denatured herring sperm DNA per ml, 0.5% sodium dodecyl sulfate, and 10% dextran sulfate. The membranes were hybridized with the [gamma -32P]ATP-end-labeled probe PFI (nucleotides 128 to 153; 5' CTGGTAACTAGAGATCCCTCAGACCC 3'; 106 dpm/mg) overnight at 55°C. After hybridization, membranes were washed under stringent conditions, dried, and autoradiographed.

Flow cytometry for membrane CD4 and CCR expression. Cord blood monocytes or PMs were seeded into 25-cm2 tissue culture flasks or 24-well plates (Corning Inc., Corning, N.Y.) in RPMI 1640 plus 20% human AB serum or X-VIVO 15 serum-free medium, respectively. The cells were removed for analysis by using 5 mM EDTA in cold PBS and washed twice in PBS, and 106 cells were transferred to a 12- by 75-mm flow cytometry tube. For surface staining, cells were washed twice with ice-cold fluorescence-activated cell sorter buffer (1% fetal calf serum and 0.01% sodium azide in PBS), resuspended in 50 µl of human serum, and labeled directly or indirectly as previously described (37), typically with 1 µg of primary antibody per 106 cells. For cytoplasmic staining, the cells were first fixed in 0.25% cold paraformaldehyde for 1 h and then permeabilized with 0.2% Tween 20 in PBS for 15 min at 37°C. Following one wash with cold PBS, the cells were blocked and labeled as described above. All cells were analyzed with a Becton Dickinson FACScan flow cytometer as previously described (37). The MAbs used included anti-Leu-3a, anti-Leu-3a-fluorescein isothiocyanate (FITC) conjugate, anti-Leu-M3 (CD14)-phycoerythrin (PE) conjugate, gamma 1-FITC and gamma 2a-PE controls (Becton Dickinson, Sydney, Australia), pure gamma 1 and gamma 2a controls (Sigma), rabbit anti-mouse immunoglobulin F(ab')2-FITC (DAKO), and the anti-CXCR-4 MAb 12G5 (R & D Systems, Minneapolis, Minn.) (19). The anti-CCR5 MAbs 3A9 and 5C7 were obtained from LeukoSite Inc. (Cambridge, Mass.) as generous gifts from Charles Mackay.

    RESULTS
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

Syngeneic cord blood monocytes, MDMs, and PMs display differential susceptibilities to HIV-1 infection. In initial experiments the infection and replication of two LA M-tropic isolates of HIV were compared with those of seven PR isolates in fresh cord blood monocytes, cord blood MDMs, and terminally differentiated PMs. In any given experiment all three cell types were obtained from the one donor. Fresh (day 0) cord blood monocytes could be infected with LA M-tropic HIV-1 isolates in vitro, allowing slow replication of the virus. Figure 1A shows that HIV-1JR-FL and HIV-1Ada-M produced readily detectable concentrations of p24 antigen in culture supernatants after 2 weeks of infection but that productive infections were not established by any of the PR isolates tested. Another LA M-tropic isolate, HIV-1Ba-L, was found to infect neonatal monocytes in a subsequent series of experiments (see Fig. 4 and 5).


View larger version (43K):
[in this window]
[in a new window]
  		FIG. 1.   HIV-1 infection of fresh cord blood monocytes. (A) Kinetics of HIV-1 p24 antigen (Ag) production. Cord blood monocytes from three different donors were infected on the day of their isolation (day 0) with a panel of two LA (HIV-1JR-FL and HIV-1Ada-M) and seven PR (WM-1039, -1044, -1061, -1063, -1067, -1068, and -1076) HIV-1 isolates as described in Materials and Methods. Representative data from three identical experiments are presented. Supernatant samples were collected and assayed by ELISA for HIV-1 p24 antigen as indicated. For clarity, the curves for only two PR isolates are shown, as these produced kinetic patterns identical to those of all other PR isolates in the panel. (B) DNA PCR analysis of the long terminal repeat-gag region. On day 16 postinfection the cultures were terminated, DNA was extracted from the cells in situ, and DNA PCR was performed with primer pair M667-FG1 as described in Materials and Methods. The DNA was subsequently Southern blotted and hybridized with the oligonucleotide probe PFI. Positive results indicate complete or nearly complete viral RT. The negative control reaction tube (-ve) contained H2O in lieu of template DNA, while the positive control template (+ve) was DNA extracted from the HIV-1LAI-infected 8E5 cell line (24).

Plastic-adherent neonatal monocytes left to differentiate for 7 days prior to infection with HIV-1 became permissive for a wider range of isolates. HIV-1Ada-M and HIV-1JR-FL replicated efficiently in MDMs, as expected from their M-tropic phenotype (Fig. 2A). PR isolates WM-1039, -1044, -1068, and -1076 also established productive infections, albeit with widely varying replication kinetics and peak viral titers. In similar experiments using host cells from different donors, HIV-1Ada-M, HIV-1JR-FL, and the PR isolate WM-1068 always productively infected MDMs. However, infection with WM-1039, WM-1044, and WM-1076 was variable in different donors.


View larger version (44K):
[in this window]
[in a new window]
  		FIG. 2.   HIV infection of cord blood MDMs. (A) Kinetics of HIV-1 p24 antigen (Ag) production. Seven-day-old plastic-adherent MDMs were infected with HIV-1 isolates, and supernatants were sampled as indicated for ELISA determination of HIV-1 p24 antigen concentration. The MDMs were syngeneic with the monocytes described in the legend to Fig. 1, and all conditions of the experiment were the same as used for monocytes. The WM-1068 and WM-1076 data are representative of PR isolates WM-1039 and -1044 (productive infections; kinetic curves for the latter isolates were between those for WM-1076 and -1068). In contrast, kinetic curves for isolates WM-1063 and -1067 were very similar to the curve shown for WM-1061 (no infection). (B) PCR analysis of the long terminal repeat-gag region. Cell cultures were terminated on day 17 postinfection, and PCR was performed as described for Fig. 1.

PMs, syngeneic with the neonatal monocytes/MDMs tested, could be infected with LA M-tropic isolates of HIV-1. None of the seven PR isolates initially tested were capable of infection. Figure 3A demonstrates productive infection with HIV-1Ada-M, with viral output being significantly less than that of similarly infected monocytes or MDMs. HIV-1Ada-M did not induce a cytopathic effect in PMs, and no morphological changes were observed to coincide with infection (data not shown). A transient, early peak of output p24 antigen for most of the isolates tested was a common finding with PMs, despite thorough washing of the cells following infection. This phenomenon was interpreted as released inoculum, as HIV-1 DNA PCR analysis revealed that none of the seven clinical isolates had completed RT (Fig. 3B). Conversely, HIV-1 reverse transcripts were detected for HIV-1JR-FL, even though this isolate did not productively infect PMs. Otherwise, PCR results were concordant with extracellular p24 antigen levels in neonatal monocytes and MDMs, indicating that the block to infection with PR isolates was during or prior to RT (Fig. 1B and 2B).


View larger version (45K):
[in this window]
[in a new window]
  		FIG. 3.   HIV infection of PMs. (A) Kinetics of HIV-1 p24 antigen (Ag) production. Seven-day-old plastic-adherent PMs were infected with a panel of HIV-1 isolates, and supernatants were sampled for p24 antigen as described in the legend to Fig. 1. The PMs were syngeneic with the cord blood monocytes and MDMs described in the legends to Fig. 1 and 2. The kinetic curves for PR isolates WM-1039, -1063, -1067, -1068, and -1076 all fell between the curves shown for the representative PR isolates WM-1044 and -1061. (B) PCR analysis of the long terminal repeat-gag region. Cell cultures were terminated on day 17 postinfection, and PCR was performed as described for Fig. 1.

The block to infection of neonatal monocytes and PMs with PR HIV strains occurs prior to RT. To better assess the apparent block to productive infection in fresh monocytes and PMs by PR isolates of HIV, we utilized a highly sensitive, semiquantitative, radiolabeled PCR similar to that described by Zack et al. (78). Monocytes, MDMs, or PMs were inoculated with the LA isolate HIV-1Ba-L or one of two known adult-M-tropic PR isolates, WM-628 and WM-631. Infection of monocytes and MDMs was performed was performed for 2 h in the presence or absence of AZT, after which sequential DNA extractions were made. For infection of PMs, HIV strains were incubated overnight (16 h), as preliminary experiments had shown improved productivity of infection compared with 2 or 4 h of incubation. Production of HIV in vitro was monitored for 14 to 17 days postinfection by using a p24 antigen ELISA.

As shown in Fig. 4, HIV-1Ba-L and WM-631 were repeatedly able to productively infect day 4 MDMs (cultured for 4 days after plating prior to infection), while WM-628 could not. However, analysis of reverse transcripts revealed that cells infected with WM-628 gave a low positive result with the M667-AA55 primer pair even after pretreatment with AZT (Fig. 5B). This indicated either that RT was incomplete or that only intravirion DNA from the inoculum was being detected. However, the level of early transcripts was markedly lower than that for HIV-1Ba-L or WM-631, indicating that the principal reduction of infection was before RT, perhaps at entry or uncoating. The consistent disparities in infection and replication between WM-628 and WM-631 were unexpected, because these isolates were obtained from different lobes of the brain of one patient.


View larger version (32K):
[in this window]
[in a new window]
  		FIG. 4.   Comparison of HIV-1 replication in neonatal monocytes, MDMs, PMs, and adult monocytes. Cells (2 × 105 to 5 × 105) were infected with each HIV-1 isolate at a multiplicity of infection of 0.1. Monocytes/MDMs were incubated with HIV for 2 h, and PMs were incubated for 16 h. Results are representative of three experiments. Ag, antigen.


View larger version (67K):
[in this window]
[in a new window]
  		FIG. 5.   Comparison of PR and LA HIV-1 RT in neonatal monocytes, MDMs, and PMs. The PCR utilized one 32P-labeled primer per reaction as described in Materials and Methods, and standards represent HIV-1 DNA copy number equivalents amplified from 8E5 cell DNA. Primer pairs M667-AA55 and M667-M661 were described by Zack et al. (78) and amplified HIV-1 DNA, indicating RT initiation and completion (or near completion), respectively. Controls for de novo RT were treated for 2 h with 10 µM AZT prior to HIV infection, which was performed in the continued presence of the nucleoside analog. AZT-treated cells were harvested for DNA at day 17 postinfection. Input DNA was controlled by using beta -globin specific primers (59), and the results shown are representative of three experiments. (A) Day 1 neonatal monocytes; (B) day 4 neonatal MDMs; (C) day 7 PMs; (D) comparison of HIV-1Ba-L, WM-628, and WM-631 phenotypes and V3 loop amino acid sequences (amino acid substitutions are in boldface).

Under the same conditions, syngeneic day 1 neonatal monocytes could be productively infected only by the LA isolate (HIV-1Ba-L), in agreement with the day 0 data from our earlier experiments (Fig. 4). PCR analysis revealed initiation and completion of RT by HIV-1Ba-L, but neither WM-628 nor WM-631 showed evidence of early or complete RT (Fig. 5A). These results contrasted with those seen for the MDMs and suggested an inability of the PR isolates to enter the fresh monocytes.

PMs, like the neonatal MDMs, were permissive for HIV-1Ba-L and WM-631 after 16 h of infection (Fig. 4). WM-631 was the only PR isolate, of more than 20 tested in our laboratories, that could infect PMs and had replication kinetics similar to those of the M-tropic LA strains of HIV-1. No RT could be detected in cells infected with WM-628 (Fig. 5C), and production of extracellular virus was not evident in p24 antigen ELISAs. It is important to note that WM-628 replicated in human PBMCs similarly to WM-631 during expansion of the isolates (data not shown), that both strains were of the NSI phenotype as determined by MT-2 assay (Fig. 5D), and that both strains could infect fresh adult monocytes with replication kinetics similar to that of HIV-1Ba-L (Fig. 4). Comparisons of infection with WM-628 and WM-631 in the four cell types are summarized in Table 2.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 2.   Comparison of infection and replication of HIV-1 primary isolates WM-628 and WM-631 in adult and neonatal monocytes and PMs

Because of the importance of the HIV-1 gp120 V3 loop in determining cellular tropism (8, 33), this region of the env gene was sequenced and compared for WM-628 and WM-631 (Fig. 5D). Both WM-628 and WM-631 have a GPGK (rather than the consensus GPGR) motif at the tip of the V3 loop and were otherwise identical in this region, with the exception that WM-628 carries a serine residue at position 8 (relative to the first cysteine) while WM-631 carries the consensus threonine. The overall net charges of the WM-628 and WM-631 V3 loops were identical at +3.

Differential tropism is not related to surface CD4 expression. The failure of PR HIV-1 isolates to initiate RT in fresh monocytes indicated that permissiveness could be determined at the level of HIV binding or entry. We therefore determined if the block to infection occurred due to a lack of CD4 surface expression. Using flow cytometry, we found moderate levels of surface CD4 on freshly isolated neonatal monocytes (day 0, prior to adherence to plastic), which dropped to undetectable levels after overnight adherence to plastic (day 1) and then increasingly recovered through days 4 and 7 of culture (Fig. 6). We have previously reported very low CD4 expression on placental macrophages cultured for 7 days (37). Given that the LA HIV-1 isolates could infect day 0 or day 1 monocytes and day 4 or 7 MDMs and also PMs, it appeared that infection was independent of the CD4 level. Likewise, for the PR HIV-1 isolates the relative abundance of CD4 on day 0 monocytes conferred no infectious advantage over the day 1 cells, on which the receptor was down-regulated.


View larger version (17K):
[in this window]
[in a new window]
  		FIG. 6.   CD4 expression on neonatal monocytes and MDMs. Nonpermeabilized CD14-positive neonatal monocytes were prepared and analyzed on day 0 (prior to adherence) or day 1 (after overnight adherence) of culture, and MDMs were analyzed on day 4, by using the anti-Leu-3a-FITC (CD4) MAb as described in Materials and Methods. CD14-positive cells were gated by using the anti-Leu-M3-PE MAb, and results are representative of three experiments. Isotype control (open) and specific (shaded) histograms are shown.

Expression of chemokine receptors. We next investigated the neonatal monocyte, MDM, and PM expression of the chemokine receptors CXCR-4 and CCR-5 by using RT-PCR and flow cytometry. RT-PCR analysis of mRNA revealed messages for CXCR-4 and CCR-5 in all three cell types, with no obvious changes in expression between day 1 monocytes and day 4 MDMs (Fig. 7). Donor-to-donor variation was found to be minimal, with CCR-5 expressed at moderate levels and CXCR-4 expressed at high levels. CCR-1 mRNA was also detected at high levels, and CCR-3 mRNA was detected at very low levels. PCR products from CCR-1, CCR-3, CCR-5, and CXCR-4 were sequenced in two directions, and this confirmed the specificity of the amplifications for the target genes (data not shown).


View larger version (35K):
[in this window]
[in a new window]
  		FIG. 7.   RT-PCR analysis of chemokine receptor mRNA expression in neonatal monocytes, MDMs, and PMs. mRNA was prepared and analyzed as described in Materials and Methods. CCR-1, CCR-3, CCR-5, and CXCR-4 mRNA transcripts were amplified as 296-, 539-, 272-, and 381-bp products, respectively; the GAPDH product is shown at 191 bp. cDNA samples were amplified following RT reactions with or without reverse transcriptase. Representative results from three experiments are shown; 2% agarose was used.

Neither CXCR-4 nor CCR-5 could be detected on day 7 PMs by flow cytometry with the 12G5 and 3A9 MAbs, respectively (Fig. 8). Further attempts to demonstrate surface-expressed CCR-5 with another MAb, 5C7 (2), also gave negative results. However, if PMs were permeabilized prior to antibody staining, then both CXCR-4 and CCR-5 became detectable in the cytoplasm (Fig. 8), consistent with the expression of both CXCR-4 and CCR-5 mRNAs in these cells.


View larger version (43K):
[in this window]
[in a new window]
  		FIG. 8.   Chemokine receptor expression by PMs. Day 7 PMs were labeled with the 12G5 MAb to CXCR-4 or the 3A9 MAb to CCR5 and compared with isotype control antibodies (open histograms) by flow cytometry. Cells were either permeabilized prior to staining (cytoplasmic labeling) or left untreated (surface labeling), as described in Materials and Methods, and data representative of three experiments are presented.

Day 1 CD14-positive monocytes were found to express low levels of CXCR-4, whereas CCR-5 was not detectable (Fig. 9). CCR-5 was also undetectable on the CD14-positive monocyte population among fresh (day 0) neonatal PBMCs (data not shown). Additionally, CCR-5 could not be detected in the total day 0 neonatal PBMC populations or in the total adherent populations at day 1 (data not shown). In contrast, MDMs adherent for 4 to 7 days expressed detectable CCR-5 with a concomitant decline of CXCR-4 expression. The up-regulation of CCR-5 on maturing neonatal monocytes, increasing from 4 to 7 days, was a consistent finding; however, CXCR-4 expression varied between monocyte donors. All monocytes from some donors displayed decreased CXCR-4 expression, whereas in other donors discrete subpopulations of monocytes showed decreased CXCR-4 expression.


View larger version (35K):
[in this window]
[in a new window]
  		FIG. 9.   Chemokine receptor expression on differentiating neonatal monocytes. Nonpermeabilized neonatal monocytes were prepared for flow cytometry on day 1 or 7 of culture and labeled with anti-Leu-M3-PE (CD14), 12G5 (CXCR-4), or 3A9 (CCR-5). Representative data are presented. Fluorescence-activated cell sorter analyses for CXCR-4 and CCR-5 were gated on the CD14-positive fraction of the cell populations and compared with results for isotype control antibodies (open histograms).

The correlations between chemokine receptor expression and productive infection with HIV-1 in the various cell types studied are shown in Table 3.

                              
View this table:
[in this window]
[in a new window]
  		TABLE 3.   Correlation of HIV-1 replication and chemokine receptor expression in adult and neonatal monocytes and PMs

    DISCUSSION
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

It is well documented that in cells from adult donors, monocyte maturation in vitro increases permissiveness to HIV-1 infection (4, 54, 58, 64). In this study we have demonstrated differences in infection and replication between LA M-tropic isolates and PR isolates of HIV-1 in syngeneic neonatal monocytes, MDMs, and PMs. Infection of neonatal monocytes with PR isolates of HIV-1 was dependent on the state of maturation of the cells, whereas infection by LA M-tropic isolates was independent of maturation. The PR isolates used were chosen because they had previously been found to replicate in adult MDMs (as have approximately 90% of PR isolates in our laboratory [data not shown]) and represented a broad cross section of PR strains with respect to tissue source and clinical status of the host (Table 1). The inability of PR isolates to infect neonatal monocytes within 24 h of adherence to plastic was surprising, as we and others have shown infection of adult monocytes at a similar stage with PR isolates in vitro (5, 36, 66, 72). These initial results strongly suggested significant differences between neonatal and adult monocytes with respect to HIV-1 susceptibility and/or replication.

Neonatal monocytes, whether day 0 or day 1, were found to be refractory to PR HIV-1 isolates at a point prior to RT. The same cells were, however, fully permissive for LA M-tropic isolates of HIV-1. Among the nine PR isolates used, it was the comparison of WM-628 and WM-631 that served best in highlighting both the selective nature of neonatal compared with adult monocytes for certain strains of HIV-1 and the biological variability of HIV-1 sampled from adjacent tissue sections (60). WM-628 and -631 were isolated from different lobes of the brain of a patient with rapid clinical progression, who died 9 months after seroconversion with AIDS-related encephalopathy (31). WM-628 did not replicate in neonatal monocytes, neonatal MDMs, or PMs, yet both WM-628 and -631 replicated to high titers in day 1 adult monocytes. Partial reverse transcripts for WM-628 were detected by sensitive PCR in neonatal MDMs (but not monocytes), perhaps analogous to incomplete reverse transcripts previously observed in quiescent T lymphocytes from both adults (78) and neonates (41). However, the very low copy number of these transcripts indicated that the major stage of restriction of replication was prior to RT and therefore probably at entry. Very low levels of incompletely reverse-transcribed WM-628 HIV-1 DNA in these cells could indicate a persistent viral inoculum, yet such persistence in macrophages for 17 days seems unlikely. In contrast to WM-628, no restriction of entry, RT, or complete replication was observed with WM-631 in neonatal MDMs and PMs, like for HIV-1Ba-L. As with all PR isolates tested, however, WM-631 could not infect neonatal monocytes.

Moderate-level CD4 surface expression by adult monocytes declines within hours of adherence to plastic (13, 36), remains low for over 1 week, and then slowly increases once again (35, 50). The same pattern of adherence-induced CD4 down-regulation and subsequent recovery in neonatal monocytes was demonstrated in this study, with the zenith of expression occurring in cells directly after isolation from blood (day 0). Therefore, despite the availability of CD4 on fresh neonatal monocytes, PR HIV-1 isolates were restricted in their entry into these cells. In contrast, the LA HIV-1 strains were capable of efficient infection even with very low levels of CD4 (e.g., with day 1 monocytes and PMs). HIV-1 infection of neonatal monocytes/MDMs with LA HIV-1 isolates is nevertheless reported to be CD4 dependent (30), and our own unpublished observations confirm this.

It is now established that following binding to CD4, the cell surface-expressed molecules allowing M-tropic HIV fusion are beta -chemokine receptors (CCRs) (53, 62), predominantly CCR-5 (1, 15, 17) and in some cases CCR-3 (9, 29). It therefore seemed likely that variations in chemokine receptor expression by differentiating neonatal monocytes may explain the discrepancies between infection with PR and LA isolates.

CCR-5 was gradually up-regulated on the surface of neonatal monocytes, being undetectable at day 1 but readily detectable at day 4 to 7 of culture in coincidence with relatively high susceptibility to LA and PR M-tropic HIV-1 isolates. However, such up-regulation of CCR-5 (2) occurs more quickly in adult monocytes, as CCR-5 can be detected on these cells at day 1 of culture (50). Importantly, day 1 adult monocytes can be infected with PR HIV-1 isolates (5, 66), but day 1 neonatal monocytes, which lack detectable CCR-5, cannot be. These data do not necessarily establish CCR-5 as the sole coreceptor for M-tropic isolates on these cells. T-cell-line-tropic isolates can promiscuously utilize CCR-5 to infect CD4+/CCR-5+ HOS cells but not primary macrophages (7), suggesting that other, undetermined cellular factors may mediate infection of macrophages by some M-tropic strains. Additionally, RANTES, MIP-1alpha , and MIP-1beta cannot always block infection of macrophages (17). Nevertheless macrophages from CCR-5-Delta 32 homozygotes cannot usually be infected by LA M-tropic strains (55). Detection of CCR-3 mRNA but not surface antigen in the neonatal cells may indicate very low levels of this receptor, which could facilitate entry of some isolates (29). We are currently performing HIV-1-blocking studies in neonatal cells by using a panel of MAbs against various chemokine receptors, and/or the relevant chemokine ligands, to address such possibilities (22). The down-regulation of CXCR-4 noted on cultured neonatal monocytes is in agreement with other reports documenting changes in expression of this coreceptor by human PBMCs and adult monocytes (2, 48). The relevance of CXCR-4 on fresh neonatal monocytes to HIV-1 infection is not clear, however, as these cells are resistant to infection with LA T-cell-line-tropic isolates such as HIV-1LAI (57).

In this study, changes in CXCR-4 and CCR-5 expression could not be correlated with changes in mRNA expression, as the levels of message appeared to remain quite constant with differentiation. Thus, modulation of the coreceptors was occurring posttranslationally, and, as demonstrated with PMs, both CXCR-4 and CCR-5 could be readily detected in the cytoplasm. This suggested that changes in expression resulted from the movement of the coreceptors into or out of the cytoplasm, and preliminary data on permeabilized differentiating neonatal monocytes are in agreement with this (22).

Some groups have found that neonatal monocytes and MDMs are more susceptible to LA M-tropic laboratory isolates of HIV-1 and produce higher titers of virus than adult monocytes under the same conditions (30, 57, 68). While we have confirmed the replicative capacity of LA M-tropic isolates in neonatal monocytes, we found that neonatal monocytes and MDMs were less susceptible than the equivalent adult cells to PR M-tropic isolates, with the greatest disparity evident in newly adherent cells. These differences may reflect the low levels of CD4 combined with qualitative or quantitative differences in expression of the HIV-1 coreceptors. For example, PR T-cell-line-tropic isolates of HIV-1 have been found to require much higher densities of CD4 than LA T-cell-line-tropic variants to mediate similar levels of infection in cells coexpressing CXCR-4 (40). The same study showed that the serially passaged M-tropic isolates HIV-1JR-FL and HIV-1SF-162 could also utilize low densities of CD4 to infect cells coexpressing CCR-5. Our findings corroborate and extend these data by demonstrating that PR M-tropic isolates are incapable of infecting neonatal monocytes that express very low levels of CD4 and very low to undetectable levels of CCR-5. These results are supported by the inability of these strains to infect PM which express similar levels of CD4 and CCR5, with only 1 of more than 20 M-tropic PR HIV-1 isolates being capable of using the available receptors.

Perhaps LA M-tropic isolates such as HIV-1Ba-L, HIV-1JR-FL, and HIV-1Ada-M make efficient use not only of small quantities of CD4 but also of low levels of the CCR-5 coreceptor. Recently we have found that day 1 adult monocytes, infectable with PR HIV-1 isolates, expressed detectable CCR-5 on the surface (14), which rose with differentiation then fell continuously after day 10 to 14 of culture (50). One explanation for the differences between infection with PR M-tropic isolates (such as WM-628 and WM-631) for adult and neonatal monocytes may therefore lie in the level of CCR-5 expression. Similarly, the increased difficulty of infecting long-term adult MDM cultures (54, 64) and terminally differentiated PMs may also be due to low CCR-5 availability. The differences contributing to the varying CCR-5 affinities of PR isolates such as WM-628 and WM-631 could occur within the HIV-1 V3 loop, which is now thought to interact directly with chemokine receptors (9, 71, 76). The subtle threonineright-arrowserine substitution between WM-631 and WM-628 should be conservative, although the extra bulk of the methyl group of serine may alter rotational freedom at this point of the V3 loop. Other differences between WM-628 or WM-631 and consensus M-tropic isolates such as HIV-1Ba-L in the crown region of the loop may also be partly responsible for the differences in infection of neonatal cells. However, the V3 region alone may not determine cellular tropism, and current evidence suggests that V3 could house just one component of a discontinuous epitope capable of interacting with CCR-5 (71, 76).

The risk of an HIV-seropositive mother giving birth to a similarly infected child varies worldwide from about 15 to 60% (11, 20); however, mechanisms for HIV-1 vertical transmission are still unresolved. PMs have been infected in vitro (37, 44, 47), suggesting that these cells may potentially act as vectors for HIV-1 in the course of in utero transmission by a hematogenous route. We have tested more than 20 PR HIV-1 isolates in PMs (21, 37) but found that only WM-631, which is tissue derived, is capable of replication kinetics approaching those of LA M-tropic isolates such as HIV-1Ba-L. Consequently, we have yet to find a blood-derived PR isolate that is capable of similar infection and replication in PMs. Placental chorionic villi are bathed in maternal blood for the term of the pregnancy, but our findings that PMs form a relative barrier to PR HIV-1 isolates, coupled with the refractoriness of the syncytiotrophoblast to infection (38), would help to explain reports that HIV-1 is only rarely detected in chorionic villi from seropositive mothers (3, 52).

This study is relevant to both the intrauterine and intrapartum routes of vertical transmission and possibly to their sequelae. Like PMs, circulating neonatal monocytes display refractoriness to PR strains of HIV-1, but the relative permissivity of neonatal MDMs indicates a risk for intrapartum infection with PR strains. This may occur, for example, during neonatal mucosal exposure to infected maternal blood or secretions (75). Control of the maternal viral load with AZT immediately before and during parturition has significantly reduced vertical transmission in a number of cohort studies (10, 16, 25, 45), yet the virus-cell interactions that escape such intervention still need to be addressed. Ongoing studies targeting the interactions of PR HIV-1 strains with chemokine receptor cofactors on neonatal cells may thus yield valuable information for therapeutic agents designed to inhibit HIV-1 vertical transmission.

    ACKNOWLEDGMENTS

We thank N. Saksena for critical review and C. Wolczak for processing of the manuscript. Special thanks go to all the staff of the Delivery Suite, Westmead Hospital.

This work was supported by a Ph.D. scholarship to W.R.F., by a research grant to A.M.K. from the Commonwealth AIDS Research Grant Scheme, and by the Australian National Centre for HIV Virology Research.

    FOOTNOTES

* Corresponding author. Mailing address: Room 2145, Level 2, Centre for Virus Research, Westmead Institutes of Health Research, Westmead Hospital, The University of Sydney, Westmead NSW 2145, Australia. Phone: 61 2 9845 6344. Fax: 61 2 9845 8300. E-mail: tonyc{at}westmed.wh.su.edu.au.

    REFERENCES
Top
Abstract
Introduction
Materials & Methods
Results
Discussion
References

1. Alkhatib, G., C. Combadiere, C. C. Broder, Y. Feng, P. E. Kennedy, P. M. Murphy, and E. A. Berger. 1996. CC CKR5: a RANTES, MIP-1alpha , MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955-1958[Abstract].
2. Bleul, C. C., L. Wu, J. A. Hoxie, T. A. Springer, and C. R. Mackay. 1997. The HIV coreceptors CXCR4 and CCR5 are differentially expressed and regulated on human T lymphocytes. Proc. Natl. Acad. Sci. USA 94:1925-1930[Abstract/Free Full Text].
3. Chandwani, S., M. Greco, K. Mittal, C. Antoine, K. Kraninski, and W. Borkowsky. 1991. Pathology and human immunodeficiency virus expression in placentas of seropositive women. J. Infect. Dis. 163:1134-1138[Medline].
4. Chang, J., S. Li, H. Naif, and A. L. Cunningham. 1994. The magnitude of HIV replication in monocytes and macrophages is influenced by environmental conditions, viral strain, and host cells. J. Leukocyte Biol. 56:230-235[Abstract].
5. Chang, J., H. M. Naif, S. Li, J. S. Sullivan, C. M. Randle, and A. L. Cunningham. 1996. Twin studies demonstrate a host cell genetic effect on productive human immunodeficiency virus infection of human monocytes and macrophages in vitro. J. Virol. 70:7792-7803[Abstract].
6. Chayt, K. J., M. E. Harper, L. M. Marselle, E. B. Lewin, R. M. Rose, J. M. Oleske, L. G. Epstein, F. Wong-Staal, and R. C. Gallo. 1986. Detection of HTLV-III RNA in lungs of patients with AIDS and pulmonary involvement. JAMA 256:2356-2359[Abstract/Free Full Text].
7. Cheng-Mayer, C., R. Liu, N. R. Landau, and L. Stamatatos. 1997. Macrophage tropism of human immunodeficiency virus type 1 and utilization of the CC-CKR5 coreceptor. J. Virol. 71:1657-1661[Abstract].
8. Cheng-Mayer, C., M. Quiroga, J. W. Tung, D. Dina, and J. A. Levy. 1990. Viral determinants of human immunodeficiency virus type 1 T-cell or macrophage tropism, cytopathogenicity, and CD4 antigen modulation. J. Virol. 64:4390-4398[Abstract/Free Full Text].
9. Choe, H., M. Farzan, Y. Sun, N. Sullivan, B. Rollins, P. D. Ponath, L. Wu, C. R. Mackay, G. LaRosa, W. Newman, N. Gerard, C. Gerard, and J. Sodroski. 1996. The beta -chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell 85:1135-1148[Medline].
10. Connor, E. M., and L. M. Mofenson. 1995. Zidovudine for the reduction of perinatal human immunodeficiency virus transmission: pediatric AIDS Clinical Trials Group Protocol 076---results and treatment recommendations. Pediatr. Infect. Dis. J. 14:536-541[Medline].
11. Connor, E. M., R. S. Sperling, R. Gelber, P. Kiselev, G. Scott, M. J. O'Sullivan, R. VanDyke, M. Bey, W. Shearer, R. L. Jacobson, E. Jimenez, E. O'Neill, B. Basin, J.-F. Delfraissay, M. Culnane, R. Coombs, M. Elkins, J. Moye, P. Stratton, and J. Balsley. 1994. Reduction of maternal-infant transmission of human immunodeficiency virus type 1 with zidovudine treatment. Pediatric AIDS Clinical Trials Group Protocol 076 Study Group. N. Engl. J. Med. 331:1173-1180[Abstract/Free Full Text].
12. Craxton, M. 1991. Linear amplification sequencing, a powerful method for sequencing DNA. Methods Companion Methods Enzymol. 3:20-26.
13. Crowe, S., J. Mills, and M. S. McGrath. 1987. Quantitative immunocytofluorographic analysis of CD4 surface antigen expression and HIV infection of human peripheral blood monocytes/macrophages. AIDS Res. Hum. Retroviruses 3:135-145[Medline].
14. Cunningham, A. L., H. Naif, N. Saksena, G. Lynch, J. Chang, S. Li, R. Jozwiak, M. Alali, B. Wang, W. Fear, A. Sloane, L. Pemberton, and B. Brew. 1997. HIV infection of macrophages and the pathogenesis of the AIDS dementia complex: interaction of the host cell and viral phenotype. J. Leukocyte Biol. 62:117-125[Abstract].
15. Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. Di Marzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J. Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a major co-receptor for primary isolates of HIV-1. Nature 381:661-666[Medline].
16. Dickover, R. E., E. M. Garratty, S. A. Herman, M. S. Sim, S. Plaeger, P. J. Boyer, M. Keller, A. Deveikas, E. R. Stiehm, and Y. J. Bryson. 1996. Identification of levels of maternal HIV-1 RNA associated with risk of perinatal transmission. Effect of maternal zidovudine treatment on viral load. JAMA 275:599-605[Abstract/Free Full Text].
17. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Nagashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A. Paxton. 1996. HIV-1 entry into CD4+ cells is mediated by the chemokine receptor CC-CKR-5. Nature 381:667-673[Medline].
18. Embretson, J., M. Zupancic, J. L. Ribas, A. Burke, P. Racz, K. Tenner-Racz, and A. T. Haase. 1993. Massive covert infection of helper T lymphocytes and macrophages by HIV during the incubation period of AIDS. Nature 362:359-362[Medline].
19. Endres, M. J., P. R. Clapham, M. Marsh, M. Ahuja, J. D. Turner, A. McKnight, J. F. Thomas, B. Stoebenau-Haggarty, S. Choe, P. J. Vance, T. N. C. Wells, C. A. Power, S. S. Sutterwala, R. W. Doms, N. R. Landau, and J. A. Hoxie. 1996. CD4-independent infection by HIV-2 is mediated by fusin/CXCR4. Cell 87:745-756[Medline].
20. European Collaborative Study. 1992. Risk factors for mother-to-child transmission of HIV-1. Lancet 339:1007-1012[Medline].
21. Fear, W. R. 1996. Unpublished observations.
22. Fear, W. R., G. W. Lynch, H. Naif, and A. L. Cunningham. 1997. Unpublished data.
23. Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane G protein-coupled receptor. Science 272:872-876[Abstract].
24. Folks, T. M., D. Powell, M. Lightfoote, S. Koenig, A. S. Fauci, S. Benn, A. Rabson, D. Daugherty, H. E. Gendelman, M. D. Hoggan, V. Sundararajan, and M. E. Martin. 1986. Biological and biochemical characterization of a cloned Leu-3a- cell surviving infection with the acquired immune deficiency syndrome retrovirus. J. Exp. Med. 164:280-290[Abstract/Free Full Text].
25. Frenkel, L. M., L. E. Wagner II, L. M. Demeter, S. Dewhurst, R. W. Coombs, B. L. Murante, and R. C. Reichman. 1995. Effects of zidovudine use during pregnancy on resistance and vertical transmission of human immunodeficiency virus type 1. Clin. Infect. Dis. 20:1321-1326[Medline].
26. Gao, J.-L., D. B. Kuhns, H. L. Tiffany, D. McDermott, X. Li, U. Francke, and P. M. Murphy. 1993. Structure and functional expression of the human macrophage inflammatory protein 1alpha /RANTES receptor. J. Exp. Med. 177:1421-1427[Abstract/Free Full Text].
27. Gendelman, H. E., J. M. Orenstein, M. A. Martin, C. Ferrua, R. Mitra, T. Phipps, L. A. Wahl, H. C. Lane, A. S. Fauci, D. S. Burke, D. Skillman, and M. S. Meltzer. 1988. Efficient isolation and propagation of human immunodeficiency virus on recombinant colony-stimulating factor 1-treated monocytes. J. Exp. Med. 167:1428-1441[Abstract/Free Full Text].
28. Hanauer, A., and J. L. Mandel. 1984. The glyceraldehyde 3 phosphate dehydrogenase gene family: structure of a human cDNA and of an X chromosome linked pseudogene; amazing complexity of the gene family in mouse. EMBO J. 3:2627-2633[Medline].
29. He, J., Y. Chen, M. Farzan, H. Choe, A. Ohagen, S. Gartner, J. Busciglio, X. Yang, W. Hofmann, W. Newman, C. R. Mackay, J. Sodroski, and D. Gabuzda. 1997. CCR3 and CCR5 are co-receptors for HIV-1 infection of microglia. Nature 385:645-649[Medline].
30. Ho, W.-Z., J. Lioy, L. Song, J. R. Cutilli, R. A. Polin, and S. D. Douglas. 1992. Infection of cord blood monocyte-derived macrophages with human immunodeficiency virus type 1. J. Virol. 66:573-579[Abstract/Free Full Text].
31. Holland, D. J., D. E. Dwyer, N. K. Saksena, H. Naif, D. R. Packham, J. Downie, and A. L. Cunningham. 1996. Dementia and pancytopenia in a patient who died of AIDS within one year of primary human immunodeficiency virus infection. Clin. Infect. Dis. 22:1121-1122[Medline].
32. Hollinger, F. B. (ed.). 1993. . ACTG virology manual for HIV laboratories, version 2.0. Division of AIDS, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Md.
33. Hwang, S. S., T. J. Boyle, H. K. Lyerly, and B. R. Cullen. 1991. Identification of the envelope V3 loop as the primary determinant of cell tropism in HIV-1. Science 253:71-74[Abstract/Free Full Text].
34. Innocenti, P., M. Ottmann, P. Morand, P. Leclercq, and J.-M. Seigneurin. 1992. HIV-1 in blood monocytes: frequency of detection of proviral DNA using PCR and comparison with the total CD4 count. AIDS Res. Hum. Retroviruses 8:261-268[Medline].
35. Kazazi, F. 1992. . Ph.D. thesis. University of Sydney, Sydney, Australia.
36. Kazazi, F., J.-M. Mathijs, P. Foley, and A. L. Cunningham. 1989. Variation in CD4 expression by human monocytes and macrophages and their relationship to infection with the human immunodeficiency virus. J. Gen. Virol. 70:2661-2672[Abstract/Free Full Text].
37. Kesson, A. M., W. R. Fear, F. Kazazi, J.-M. Mathijs, J. Chang, N. J. C. King, and A. L. Cunningham. 1993. Human immunodeficiency virus type 1 infection of placental macrophages. J. Infect. Dis. 168:571-579[Medline].
38. Kilani, R. T., L.-J. Chang, M. I. Garcia-Lloret, D. Hemmings, B. Winkler-Lowen, and L. J. Guilbert. 1997. Placental trophoblasts resist infection by multiple human immunodeficiency virus (HIV) type 1 variants even with cytomegalovirus coinfection but support HIV replication after provirus transfection. J. Virol. 71:6359-6372[Abstract].
39. Koenig, S., H. E. Gendelman, J. M. Orenstein, M. C. Dal-Canto, G. H. Pezeshkpour, M. Yungbluth, F. Janotta, A. Aksamit, M. A. Martin, and A. S. Fauci. 1986. Detection of AIDS virus in macrophages in brain tissue from AIDS patients with encephalopathy. Science 233:1089-1093[Abstract/Free Full Text].
40. Kozak, S. L., E. J. Platt, N. Madani, F. E. Ferro, Jr., K. Peden, and D. Kabat. 1997. CD4, CXCR-4, and CCR-5 dependencies for infections by primary patient and laboratory-adapted isolates of human immunodeficiency virus type 1. J. Virol. 71:873-882[Abstract].
41. Krogstad, P. A., J. A. Zack, and I. S. Y. Chen. 1994. HIV-1 reverse transcription in cord blood lymphocytes: implications for infection of newborns. AIDS Res. Hum. Retroviruses 10:143-147[Medline].
42. Kwok, S., and R. Higuchi. 1989. Avoid false positives with PCR. Nature 339:237-238[Medline].
43. Loetscher, M., T. Geiser, T. O'Reilly, R. Zwahlen, M. Baggiolini, and B. Moser. 1994. Cloning of a human seven-transmembrane domain receptor, LESTR, that is highly expressed in leukocytes. J. Biol. Chem. 269:232-237[Abstract/Free Full Text].
44. Mano, H., and J. C. Chermann. 1991. Replication of human immunodeficiency virus type 1 in primary cultured placental cells. Res. Virol. 142:95-104[Medline].
45. Matheson, P. B., E. J. Abrams, P. A. Thomas, M. A. Hernan, D. M. Thea, G. Lambert, K. Krasinski, M. Bamji, M. F. Rogers, and M. Heagerty. 1995. Efficacy of antenatal zidovudine in reducing perinatal transmission of human immunodeficiency virus type 1. The New York City Perinatal HIV Transmission Collaborative Study Group. J. Infect. Dis. 172:353-358[Medline].
46. McElrath, M. J., R. M. Steinman, and Z. A. Cohn. 1991. Latent HIV-1 infection in enriched populations of blood monocytes and T cells from seropositive patients. J. Clin. Invest. 87:27-30.
47. McGann, K. A., R. Collman, D. L. Kolson, F. Gonzalez-Scarano, G. Coukos, C. Coutifaris, J. F. Strauss, and N. Nathanson. 1994. Human immunodeficiency virus type 1 causes productive infection of macrophages in primary placental cell cultures. J. Infect. Dis. 169:746-753[Medline].
48. McKnight, A., D. Wilkinson, G. Simmons, S. Talbot, L. Picard, M. Ahuja, M. Marsh, J. A. Hoxie, and P. R. Clapham. 1997. Inhibition of human immunodeficiency virus fusion by a monoclonal antibody to a coreceptor (CXCR4) is both cell type and virus strain dependent. J. Virol. 71:1692-1696[Abstract].
49. Mikovits, J. A., N. C. Lohrey, R. Schulof, J. Courtless, and F. W. Ruscetti. 1992. Activation of infectious virus from latent human immunodeficiency virus infection of monocytes in vivo. J. Clin. Invest. 90:1486-1491.
50. Naif, H. M., S. Li, M. Alali, A. Sloane, L. Wu, M. Kelly, G. Lynch, A. Lloyd, and A. L. Cunningham. 1998. CCR5 expression correlates with susceptibility of maturing monocytes to human immunodeficiency virus type 1 infection. J. Virol. 72:830-836[Abstract/Free Full Text].
51. Nara, P. L., L. Smit, N. Dunlop, W. Hatch, M. Merges, D. Waters, J. Kelliher, R. C. Gallo, P. J. Fischinger, and J. Goudsmit. 1990. Emergence of viruses resistant to neutralization by V3-specific antibodies in experimental human immunodeficiency virus type 1 IIIB infection of chimpanzees. J. Virol. 64:3779-3791[Abstract/Free Full Text].
52. Peuchmaur, M., J. F. Delfaissy, J. C. Pons, D. Emilie, R. Vaseux, C. Rouzioux, Y. Brossard, and E. Papiernik. 1991. HIV proteins absent from the placentas of 75 HIV positive women studied by immunochemistry. AIDS 5:741-745[Medline].
53. Ponath, P. D., S. Qin, T. W. Post, J. Wang, L. Wu, N. P. Gerard, W. Newman, C. Gerard, and C. R. Mackay. 1996. Molecular cloning and characterization of a human eotaxin receptor expressed selectively on eosinophils. J. Exp. Med. 183:2437-2448[Abstract/Free Full Text].
54. Potts, B. J., W. Maury, and M. A. Martin. 1990. Replication of HIV-1 in primary monocyte cultures. Virology 175:465-476[Medline].
55. Rana, S., G. Besson, D. G. Cook, J. Rucker, R. J. Smyth, Y. Yi, J. D. Turner, H. H. Guo, J. G. Du, S. C. Peiper, E. Lavi, M. Samson, F. Libert, C. Liesnard, G. Vassart, R. W. Doms, M. Parmentier, and R. G. Collman. 1997. Role of CCR5 in infection of primary macrophages and lymphocytes by macrophage-tropic strains of human immunodeficiency virus: resistance to patient-derived and prototype isolates resulting from the delta CCR5 mutation. J. Virol. 71:3219-3227[Abstract].
56. Ratner, L., W. Haseltine, R. Patarca, K. J. Livak, B. Starcich, S. Josephs, E. Doran, J. Rafalski, E. Whitehorn, K. Baumeister, L. Ivanoff, S. Petteway, M. Pearson, J. Lautenberger, T. S. Papas, J. Ghrayeb, N. Chang, R. Gallo, and F. Wong-Staal. 1985. Complete nucleotide sequence of the AIDS virus, HTLV-III. Nature 313:277-284[Medline].
57. Reinhardt, P. P., B. Reinhardt, J. L. Lathey, and S. A. Spector. 1995. Human cord blood mononuclear cells are preferentially infected by non-syncytium-inducing, macrophage-tropic human immunodeficiency virus type 1 isolates. J. Clin. Microbiol. 33:292-297[Abstract].
58. Rich, E. A., I. S. Y. Chen, J. A. Zack, M. L. Leonard, and W. A. O'Brien. 1992. Increased susceptibility of differentiated mononuclear phagocytes to productive infection with human immunodeficiency virus-1 (HIV-1). J. Clin. Invest. 89:176-183.
59. Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, R. Higuchi, G. T. Horn, K. B. Mullins, and H. A. Erlich. 1988. Primer-directed enzyme amplification of DNA with thermostable DNA polymerase. Science 239:487-491[Abstract/Free Full Text].
60. Sala, M., G. Zamburno, J. P. Vartanian, and A. Marconi. 1994. Spatial discontinuities in human immunodeficiency virus type 1 quasispecies derived from epidermal langerhans cells of a patient with AIDS. J. Virol. 68:5280-5283[Abstract/Free Full Text].
61. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. . Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
62. Samson, M., O. Labbe, C. Mollereau, G. Vassart, and M. Parmentier. 1996. Molecular cloning and functional expression of a new human CC-chemokine receptor gene. Biochemistry 35:3362-3367[Medline].
63. Schrier, R. D., J. A. McCutchan, and C. A. Wiley. 1993. Mechanisms of immune activation of human immunodeficiency virus in monocytes/macrophages. J. Virol. 67:5713-5720[Abstract/Free Full Text].
64. Schuitemaker, H., N. A. Koostra, M. H. G. M. Koppleman, S. M. Bruisten, H. G. Huisman, M. Tersmette, and F. Miedema. 1992. Proliferation-dependent HIV-1 infection of monocytes occurs during differentiation into macrophages. J. Clin. Invest. 89:1154-1160.
65. Sharer, L. R. 1992. Pathology of HIV-1 infection of the central nervous system. A review. J. Neuropathol. Exp. Neurol. 51:3-11[Medline].
66. Sonza, S., A. Maerz, N. Deacon, J. Meanger, J. Mills, and S. Crowe. 1996. Human immunodeficiency virus type 1 replication is blocked prior to reverse transcription and integration in freshly isolated peripheral blood monocytes. J. Virol. 70:3863-3869[Abstract].
67. Spencer, L. T., M. T. Ogino, W. M. Dankner, and S. A. Spector. 1994. Clinical significance of human immunodeficiency virus type 1 phenotypes in infected children. J. Infect. Dis. 169:491-495[Medline].
68. Sperduto, A. R., Y. J. Bryson, and I. S. Y. Chen. 1993. Increased susceptibility of neonatal monocytes/macrophages to HIV-1 infection. AIDS Res. Hum. Retroviruses 9:1277-1285[Medline].
69. Spira, A. I., and D. D. Ho. 1995. Effect of different donor cells on human immunodeficiency virus type 1 replication and selection in vitro. J. Virol. 69:422-429[Abstract].
70. Spira, A. I., P. A. Marx, B. K. Patterson, J. Mahoney, R. A. Koup, S. M. Wolinsky, and D. D. Ho. 1996. Cellular targets of infection and route of viral dissemination after an intravaginal inoculation of simian immunodeficiency virus into rhesus macaques. J. Exp. Med. 183:215-225[Abstract/Free Full Text].
71. Trkola, A., T. Dragic, J. Arthos, J. M. Binley, W. C. Olson, G. P. Allaway, C. Cheng-Mayer, J. Robinson, P. J. Maddon, and J. P. Moore. 1996. CD4-dependent, antibody-sensitive interactions between HIV-1 and its coreceptor CCR-5. Nature 384:184-187[Medline].
72. Weinberg, J. B., T. J. Matthews, B. R. Cullen, and M. H. Malim. 1991. Productive human immunodeficiency virus type 1 (HIV-1) infection of nonproliferating human monocytes. J. Exp. Med. 174:1477-1482[Abstract/Free Full Text].
73. Wilfert, C. M., C. Wilson, K. Luzuriaga, and L. Epstein. 1994. Pathogenesis of pediatric human immunodeficiency virus type 1 infection. J. Infect. Dis. 170:286-292[Medline].
74. Wilson, C. B., J. E. Haas, and W. M. Weaver. 1983. Isolation, purification and characteristics of mononuclear phagocytes from human placentas. J. Immunol. Methods 56:305-317[Medline].
75. Wofsy, C. B., J. B. Cohen, L. B. Hauer, N. S. Padian, B. A. Michaelis, L. A. Evans, and L. A. Levy. 1986. Isolation of AIDS-associated retrovirus from genital secretions of women with antibodies to the virus. Lancet i:527-529.
76. Wu, L., N. P. Gerard, R. Wyatt, H. Choe, C. Parolin, N. Ruffing, A. Borsetti, A. A. Cardoso, E. Desjardin, W. Newman, C. Gerard, and J. Sodroski. 1996. CD4-induced interaction of primary HIV-1 gp120 glycoproteins with the chemokine receptor CCR-5. Nature 384:179-183[Medline].
77. Yamashita, A., N. Yamamoto, J. Matsuda, and Y. Koyanagi. 1994. Cell type-specific heterogeneity of the HIV-1 V3 loop in infected individuals: selection of virus in macrophages and plasma. Virology 204:170-179[Medline].
78. Zack, J. A., S. J. Arrigo, S. R. Weitsman, A. S. Go, A. Haislip, and I. S. Y. Chen. 1990. HIV-1 entry into quiescent primary lymphocytes: molecular analysis reveals a labile, latent structure. Cell 61:213-222[Medline].
79. Zhu, T., H. Mo, N. Wang, D. S. Nam, Y. Cao, R. A. Koup, and D. D. Ho. 1993. Genotypic and phenotypic characterisation of HIV-1 patients with primary infection. Science 261:1179-1181.

J Virol, February 1998, p. 1334-1344, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.


This article has been cited by other articles:

  • Cassol, E., Cassetta, L., Rizzi, C., Alfano, M., Poli, G. (2009). M1 and M2a Polarization of Human Monocyte-Derived Macrophages Inhibits HIV-1 Replication by Distinct Mechanisms. J. Immunol. 182: 6237-6246 [Abstract] [Full Text]  
  • Ellery, P. J., Tippett, E., Chiu, Y.-L., Paukovics, G., Cameron, P. U., Solomon, A., Lewin, S. R., Gorry, P. R., Jaworowski, A., Greene, W. C., Sonza, S., Crowe, S. M. (2007). The CD16+ Monocyte Subset Is More Permissive to Infection and Preferentially Harbors HIV-1 In Vivo. J. Immunol. 178: 6581-6589 [Abstract] [Full Text]  
  • Sundaravaradan, V., Saxena, S. K., Ramakrishnan, R., Yedavalli, V. R. K., Harris, D. T., Ahmad, N. (2006). Differential HIV-1 replication in neonatal and adult blood mononuclear cells is influenced at the level of HIV-1 gene expression. Proc. Natl. Acad. Sci. USA 103: 11701-11706 [Abstract] [Full Text]  
  • Rogez, C., Martin, M., Dereuddre-Bosquet, N., Martal, J., Dormont, D., Clayette, P. (2003). Anti-Human Immunodeficiency Virus Activity of Tau Interferon in Human Macrophages: Involvement of Cellular Factors and {beta}-Chemokines. J. Virol. 77: 12914-12920 [Abstract] [Full Text]  
  • Vermeire, K., Schols, D. (2003). Specific CD4 down-modulating compounds with potent anti-HIV activity. J. Leukoc. Biol. 74: 667-675 [Abstract] [Full Text]  
  • Perez-Bercoff, D., David, A., Sudry, H., Barre-Sinoussi, F., Pancino, G. (2003). Fc{gamma} Receptor-Mediated Suppression of Human Immunodeficiency Virus Type 1 Replication in Primary Human Macrophages. J. Virol. 77: 4081-4094 [Abstract] [Full Text]  
  • Lin, Y.-L., Mettling, C., Portales, P., Reynes, J., Clot, J., Corbeau, P. (2002). Cell surface CCR5 density determines the postentry efficiency of R5 HIV-1 infection. Proc. Natl. Acad. Sci. USA 99: 15590-15595 [Abstract] [Full Text]  
  • Obert, L. A., Hoover, E. A. (2002). Early Pathogenesis of Transmucosal Feline Immunodeficiency Virus Infection. J. Virol. 76: 6311-6322 [Abstract] [Full Text]  
  • Turville, S. G., Arthos, J., Mac Donald, K., Lynch, G., Naif, H., Clark, G., Hart, D., Cunningham, A. L. (2001). HIV gp120 receptors on human dendritic cells. Blood 98: 2482-2488 [Abstract] [Full Text]  
  • Cunningham, A. L., Li, S, Juarez, J, Lynch, G, Alali, M., Naif, H. (2000). The level of HIV infection of macrophages is determined by interaction of viral and host cell genotypes. J. Leukoc. Biol. 68: 311-317 [Abstract] [Full Text]  
  • Dejucq, N. (2000). HIV-1 replication in CD4+ T cell lines: the effects of adaptation on co-receptor use, tropism, and accessory gene function. J. Leukoc. Biol. 68: 331-337 [Abstract] [Full Text]  
  • Fantuzzi, L., Conti, L., Gauzzi, M. C., Eid, P., Del Corno, M., Varano, B., Canini, I., Belardelli, F., Gessani, S. (2000). Regulation of chemokine/cytokine network during in vitro differentiation and HIV-1 infection of human monocytes: possible importance in the pathogenesis of AIDS. J. Leukoc. Biol. 68: 391-399 [Abstract] [Full Text]  
  • Grant, R. S., Naif, H., Thuruthyil, S. J., Nasr, N., Littlejohn, T., Takikawa, O., Kapoor, V. (2000). Induction of Indolamine 2,3-Dioxygenase in Primary Human Macrophages by Human Immunodeficiency Virus Type 1 Is Strain Dependent. J. Virol. 74: 4110-4115 [Abstract] [Full Text]  
  • Hariharan, D., Ho, W., Cutilli, J., Campbell, D. E., Douglas, S. D. (2000). C-C chemokine profile of cord blood mononuclear cells: selective defect in RANTES production. Blood 95: 715-718 [Abstract] [Full Text]  
  • Li, S., Juarez, J., Alali, M., Dwyer, D., Collman, R., Cunningham, A., Naif, H. M. (1999). Persistent CCR5 Utilization and Enhanced Macrophage Tropism by Primary Blood Human Immunodeficiency Virus Type 1 Isolates from Advanced Stages of Disease and Comparison to Tissue-Derived Isolates. J. Virol. 73: 9741-9755 [Abstract] [Full Text]  
  • Westmoreland, S. V., Williams, K. C., Simon, M. A., Bahn, M. E., Rullkoetter, A. E., Elliott, M. W., deBakker, C. D., Knight, H. L., Lackner, A. A. (1999). Neuropathogenesis of Simian Immunodeficiency Virus in Neonatal Rhesus Macaques. Am. J. Pathol. 155: 1217-1228 [Abstract] [Full Text]  
  • Dejucq, N., Simmons, G., Clapham, P. R. (1999). Expanded Tropism of Primary Human Immunodeficiency Virus Type 1 R5 Strains to CD4+ T-Cell Lines Determined by the Capacity To Exploit Low Concentrations of CCR5. J. Virol. 73: 7842-7847 [Abstract] [Full Text]  
  • Hariharan, D., Douglas, S. D., Lee, B., Lai, J.-P., Campbell, D. E., Ho, W.-Z. (1999). Interferon-gamma Upregulates CCR5 Expression in Cord and Adult Blood Mononuclear Phagocytes. Blood 93: 1137-1144 [Abstract] [Full Text]  
  • Gordon, C. J., Muesing, M. A., Proudfoot, A. E. I., Power, C. A., Moore, J. P., Trkola, A. (1999). Enhancement of Human Immunodeficiency Virus Type 1 Infection by the CC-Chemokine RANTES Is Independent of the Mechanism of Virus-Cell Fusion. J. Virol. 73: 684-694 [Abstract] [Full Text]  
  • Simmons, G., Reeves, J. D., McKnight, A., Dejucq, N., Hibbitts, S., Power, C. A., Aarons, E., Schols, D., De Clercq, E., Proudfoot, A. E. I., Clapham, P. R. (1998). CXCR4 as a Functional Coreceptor for Human Immunodeficiency Virus Type 1 Infection of Primary Macrophages. J. Virol. 72: 8453-8457 [Abstract] [Full Text]  

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowReprints and Permissions
Right arrow Copyright Information
Right arrow Books from ASM Press
Right arrow MicrobeWorld
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fear, W. R.
Right arrow Articles by Cunningham, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fear, W. R.
Right arrow Articles by Cunningham, A. L.

Copyright © 2009 by the American Society for Microbiology.   For an alternate route to Journals.ASM.org, visit: http://intl-journals.asm.org | More Info»