Previous Article | Next Article 
J Virol, February 1998, p. 1324-1333, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
The Application of a Homologous Recombination Assay
Revealed Amino Acid Residues in an LTR-Retrotransposon That Were
Critical for Integration
Angela
Atwood,
Jeannie
Choi, and
Henry L.
Levin*
Laboratory of Eukaryotic Gene Regulation,
National Institute of Child Health and Human Development, National
Institutes of Health, Bethesda, Maryland 20892
Received 7 August 1997/Accepted 22 October 1997
 |
ABSTRACT |
Retroviruses and their relatives, the LTR-retrotransposons, possess
an integrase protein (IN) that is required for the insertion of reverse
transcripts into the genome of host cells. Schizosaccharomyces pombe is the host of Tf1, an LTR-retrotransposon with integration activity that can be studied by using techniques of yeast genetics. In
this study, we sought to identify amino acid substitutions in Tf1 that
specifically affected the integration step of transposition. In
addition to seeking amino acid substitutions in IN, we also explored
the possibility that other Tf1 proteins contributed to integration. By
comparing the results of genetic assays that monitored both
transposition and reverse transcription, we were able to seek point
mutations throughout Tf1 that blocked transposition but not the
synthesis of reverse transcripts. These mutant versions of Tf1 were
candidates of elements that possessed defects in the integration step
of transposition. Five mutations in Tf1 that resulted in low levels of
integration were found to be located in the IN protein: two
substitutions in the N-terminal Zn domain, two in the catalytic core,
and one in the C-terminal domain. These results suggested that each of
the three IN domains was required for Tf1 transposition. The potential
role of these five amino acid residues in the function of IN is
discussed. Two of the mutations that reduced integration mapped to the
RNase H (RH) domain of Tf1 reverse transcriptase. The Tf1 elements with
the RH mutations produced high levels of reverse transcripts, as
determined by recombination and DNA blot analysis. These results
indicated that the RH of Tf1 possesses a function critical for
transposition that is independent of the accumulation of reverse
transcripts.
| |
INTRODUCTION |
The reverse transcription of RNA
encoded by retroviruses and retrotransposons generates DNA sequences
that are inserted into the genomes of host cells. Although the
retrotransposons that lack long terminal repeats (LTRs) simply prime
cDNA synthesis, from breaks at insertion sites (34, 54),
retroviruses and their relatives, the LTR-retrotransposons, possess an
integrase protein (IN) that inserts the cDNA into the host genome after the bulk of reverse transcription is complete. The IN proteins of
retroviruses and some LTR-retrotransposons must process the blunt ends
of the reverse transcripts before integration by cleaving two
nucleotides from the 3' termini (18, 24, 44, 53). Some
LTR-retrotransposons such as Ty1 produce reverse transcripts with blunt
ends that do not require 3' processing because the nucleotides that are
joined to the target already exist as 3'-terminal residues (14,
39). Ultimately, the integration of the reverse transcript into
the host genome is a concerted reaction that includes the cleavage of
the insertion site and the joining of the 3' termini of the cDNA to the
5' ends of the cleaved target (3, 4, 18).
The IN proteins of human immunodeficiency virus (HIV), Moloney murine
leukemia virus, Rous sarcoma virus, and Ty1 have been purified and were
found in in vitro reactions with model substrates to be sufficient for
strand transfer activity (6, 9, 23, 38). Although these
results indicate that IN proteins possess the catalytic properties
required for integration, the relative inefficiencies of the reactions,
and in the case of HIV and Ty1, the low levels of two-ended insertions,
suggested that other factors contribute to strand transfer in vivo
(6, 38).
Further biochemical analysis of IN proteins has focused on the function
of three essential domains. The IN proteins of retroviruses and
LTR-retrotransposons contain the amino acid sequence motif HX3-7HX23-32CX2C (HHCC) near the
amino terminus (11, 21, 25). The HHCC motif is reminiscent
of the zinc finger and has been found to bind Zn in the case of HIV IN
(7). A central region of the IN proteins is called the
catalytic core domain and contains the motif
DX39-58DX35E (17, 26, 45). This
motif contains amino acid residues that are critical for catalytic
activity (7, 12, 15, 26, 52). The C-terminal domain of IN
proteins possess DNA binding activity that has equal affinity for both viral and nonspecific double-stranded DNA (35, 41, 46, 51). No motifs that are conserved among LTR-retroelements have been identified in the C-terminal domains of the IN proteins.
Schizosaccharomyces pombe is the host of Tf1, an
LTR-retrotransposon that possesses integration activity in vivo. The
transposition of Tf1 can be readily studied with techniques of yeast
genetics (30, 32). Retrotransposons serve as useful
retrovirus model systems because they are closely related to
retroviruses and use many of the same proteins and mechanisms to
replicate. Tf1 encodes Gag, protease (PR), reverse transcriptase (RT),
and IN proteins that function similarly to the retroviral counterparts
(1, 30, 32). The IN protein of Tf1 contains a Zn domain, a
D,D35E motif, and a C-terminal domain that has not yet been
tested for nonspecific DNA binding activity. The transposition activity
of Tf1 can be measured in a strain of S. pombe that contains
a plasmid copy of Tf1 fused to the inducible promoter from the
nmt1 gene (30). Results from this in vivo assay
demonstrate that Tf1 transposition requires the IN protein
(28). We describe here modifications of the transposition
assay that allowed us to identify Tf1 elements with point mutations
that significantly reduced transposition without causing defects in
reverse transcription. These mutant versions of Tf1 were candidates of
elements that possessed defects in the integration step of
transposition. Five mutations in Tf1 that caused low levels of
integration activity in vivo were found to be substitutions in the IN
protein. DNA blot analysis indicated that these mutations affected
integration at a step after reverse transcription, since each of these
strains produced wild-type levels of reverse transcripts. Two of the
mutations were in the N-terminal domain, two were in the catalytic
core, and one was in the C-terminal domain of IN. These results
suggested that each of the three IN domains was required for Tf1
transposition. Because we randomly mutagenized the entire transposon,
we were also able to identify two mutations in the RNase H (RH) domain
of RT that resulted in low levels of integration. The Tf1 elements with
the RH mutations produced high levels of reverse transcripts as
determined by recombination assays and DNA blots. These results
suggested that the mutations in RH blocked transposition during
integration.
| |
MATERIALS AND METHODS |
Media.
The S. pombe minimal liquid and plate
media were composed of Edinburgh minimal medium (EMM) (40).
Selective plates contained EMM and dropout mix (2 g/liter), a powder
with adenine and all amino acids (43). Each component of the
dropout powder was present in equal gram quantities except for adenine,
which was supplemented to 2.5 times the amount of the other nutrients.
Ten micromolar vitamin B1 (thiamine) was added to EMM when
indicated to repress the nmt1 promoter. The rich medium,
YES, contained 5 g of yeast extract (Difco), 30 g of glucose,
and 2 g of complete dropout mix per liter. YES-5-fluoroorotic
acid (FOA; United States Biologicals, Swampscott, Mass.) plates were
made by adding FOA (1 g/liter) to EMM supplemented with uracil (100 µg/ml). YES-FOA-G418 plates contained the components of YES plus
1 g of FOA and 500 mg (corrected for purity) of Geneticin (Gibco)
per liter.
Strains and plasmids.
The yeast strains used in this study
are listed in Table 1. All yeast strains
were derived from YHL912. Each line in Table 1 represents a strain that
differed from the others only with respect to the version of the Tf1
expression plasmid that it contained. Plasmid pHL449-1 contained the
neoAI-marked version of Tf1 (Tf1-neoAI) that was
used in the transposition and homologous recombination assays. The
structure of pHL449-1 was identical to that of pHL414-2 (31)
except that an artificial intron with a SpeI site
(5'GTAGGTGCTATTTTACTAGTCTAAGCTAATCAATAG3') was inserted into
the NruI site of the neo gene such that this sequence was in the coding strand of the Tf1 transcript and the noncoding strand of the neo transcript. The intron inserted
into neo was modeled after a closely related intron that
showed splicing efficiency in S. pombe of 95%
(19).
Hydroxylamine mutagenesis of Tf1-neoAI.
The plasmid
that contained Tf1-neoAI, pHL449-1, was mutagenized in vitro
by exposure to hydroxylamine with a protocol that was a modified
version of a previously published description (48). A fresh
solution of hydroxylamine was prepared just before use and stored on
ice until needed. The hydroxylamine solution contained 0.35 g of
hydroxylamine hydrochloride (Fluka) and 0.09 g of NaOH in 5 ml of
water; 10 µg of purified pHL449-1 DNA (Qiagen kit; Qiagen Inc.,
Chatsworth, Calif.) was added to 0.5 ml of the hydroxylamine solution,
and 0.1 ml was removed and left on ice as a 0-min time point. The
remainder of the solution was incubated at 65°C, and 0.1-ml aliquots
were placed on ice 15, 30, 60, and 90 min after the incubation was
started. Each aliquot was then dialyzed on 0.025-µm pore-size filter
discs (VSWP 025; Millipore, Bedford, Mass.) against 1 liter of TE (10 mM Tris base [pH 7.9], 1 mM EDTA) for 2 h. The treated DNA was
transformed into Escherichia coli MH5 (trpC9830
pyrF::Tn5 galU galK hsdR strA lac
X74;
provided by M. Hall) by selecting for ampicillin-resistant
(Ampr) colonies. The extent of mutagenesis could be
evaluated for each time point because the URA3 gene in
pHL449-1 complemented the pyrF::Tn5
deficiency in MH5. Approximately 2,000 Ampr colonies from
each time point were replica printed to M9 plates that contained 0.2%
Casamino Acids to identify the fraction of colonies that were
auxotrophic for uracil. We chose to use the DNA from the 30-min sample
because 0.38% of the colonies were auxotrophic for uracil and this low
frequency of mutagenesis would result in few plasmids with double
mutations. The URA3 gene is approximately 1.0 kb, and
Tf1-neoAI is about 6.0 kb; therefore, we expected that
approximately 2.3% of the Tf1 elements would show defects in
transposition function. To amplify the population of DNA in the 30-min
sample, we harvested 40,000 Ampr colonies and grew these
cells for one doubling in liquid medium. Large quantities of plasmid
DNA was isolated from these cells by using Qiagen Megacolumns. This DNA
was then transformed into S. pombe cells by the lithium
acetate procedure (40).
Isolation of plasmid DNA from S. pombe cells.
Plasmid DNA was isolated from S. pombe cells with a modified
version of a previously published protocol (40). S. pombe cells were grown in 5 ml of EMM minus uracil medium until
they reached an optical density at 600 nm (OD600) of 2.0. The cells were resuspended in 1.5 ml of 50 mM citrate-phosphate buffer
(7.1 g of Na2HPO4 and 11.5 g of citric
acid per liter [pH 5.6]) that contained 2 mg of Zymolase-20T
(Seikagaku America, Rockville, Md.) per ml. After the cells were
incubated at 37°C for 1 h, they were resuspended in 300 µl of
TE, and 35 µl of 10% sodium dodecyl sulfate (SDS) was added. The
mixture was incubated at 65°C for 5 min, and 100 µl of 5 M
potassium acetate was mixed in thoroughly. After a 30-min incubation on
ice, the cells were pelleted in a microcentrifuge that was spun at
17,000 × g and 4°C for 10 min. The supernatant was then mixed
with 1.2 ml of binding buffer and 30 µl of matrix from a Prep-A-Gene
kit (Bio-Rad Laboratories, Hercules, Calif.). The mixture was gently
inverted for 10 min, and the matrix was pelleted and washed twice with
1 ml of wash buffer as described in the instructions provided with the
kit. The DNA was eluted with 50 µl of TE, and 10 µl was transformed
into bacteria to isolate plasmids encoding Ampr.
Subcloning of restriction fragments from mutant versions of the
Tf1-neoAI plasmid.
Plasmids that were shown to carry
mutations in Tf1 were Qiagen kit purified and digested with
AvrII and BsrGI or with BsrGI and
BamHI. The 2.3-kb AvrII-BsrGI products
encoding the N terminus of IN and the 3.2-kb
BsrGI-BamHI products encoding the majority of IN
were gel purified from each defective plasmid so that they could be
used to replace the same fragment from the wild-type Tf1-neoAI plasmid. The resulting plasmids were transformed
into our wild-type expression strain, YHL912, and multiple
transformants of each subclone were then analyzed by using our genetic
assays to determine their transposition and recombination phenotypes. Subclones that exhibited high levels of recombination activity and
showed defective transposition activities were sequenced throughout the
length of the subcloned fragment. Sequencing was performed by using
either a cycle protocol and a Applied Biosystems instrument or with
Sequenase 2.0 (Amersham). The resulting sequence data were compared to
the wild-type sequence of the Tf1 in pHL449-1 (32).
Reconstruction of single-base substitutions by fusion PCR.
PCR products termed fusion products that contained single-base
substitutions within the middle of the fragment were templated by two
half-fragments that had 30 bases of overlap positioned at the site of
the mutation. Each of the half-fragments was also generated by PCR. The
final fusion products contained the restriction sites AvrII
and BsrGI at their termini so that they could be readily ligated into the vector fragment of pHL449-1 that resulted from an
AvrII-BsrGI digest. The final plasmids were
sequenced at the position of the mutation to verify the base
substitution.
Transposition assay.
Strains containing a
Tf1-neoAI plasmid were first grown as patches on agar plates
that contained EMM with 10 µM thiamine to repress the nmt1
promoter and dropout powder minus uracil to select for the
Tf1-neoAI plasmid. These patches were then replica printed to similar EMM agar plates that lacked thiamine to induce the nmt1 promoter. During this time, the artificial intron was
spliced out of the Tf1 mRNA, and reverse transcription generated active copies of the neo gene. After 4 days of 32°C incubation,
the plates were replica printed to EMM containing FOA to select against
cells containing the Tf1-neoAI plasmid (2). These
plates were then replica printed to YES medium containing G418 as well
as FOA and incubated at 32°C for 2 days to determine the frequency at
which Tf1-neo inserts into the genome (28, 30).
Quantitative measurements of transposition frequencies were performed
as follows. Strains were grown as patches of cells on EMM agar with
minus uracil dropout powder for 4 days at 32°C. These cells were then
resuspended to an OD600 of 1.0 and diluted approximately
100-fold. About 0.1 ml of the cells was then spread onto FOA plates,
and the resultant colonies (about 7,000/plate) were printed to YES
plates containing FOA and G418 (500 µg/ml) (31). The
transposition frequency was the percentage of the FOAr
colonies that were also G418r.
Homologous recombination assay.
The protocol is similar to
the transposition assay in that strains that contained the
neoAI-marked Tf1 plasmid were first grown as patches on agar
plates that contained EMM (plus 10 µM thiamine and dropout powder)
and then replica printed to similar EMM plates that lacked thiamine.
After 4 days of 32°C incubation, the plates were replica printed
directly to YES medium that contained G418 (500 µg/ml). Recombination
between cDNA and cellular transposon sequences was scored on the G418
plates after 48 h of growth at 32°C. The quantitative version of
this assay differs from the above protocol in that the patches from the
plate lacking thiamine were resuspended to an OD600 of 1.0 and diluted serially before they were plated onto YES and YES-G418
plates. The recombination frequency was the percentage of the colonies
on the YES plates that also grew on YES-G418 plates.
Protein preparations and immunoblots.
Crude protein extracts
were made from 5-ml cultures grown without thiamine in EMM-minus-uracil
dropout medium. The cells were washed first with water and then with
extraction buffer consisting of 15 mM KCl, 10 mM HEPES-KOH (pH 7.8),
and 5 mM EDTA. The cells were then resuspended in 0.4 ml of extraction
buffer plus 5.0 mM dithiothreitol and 2.0 mM phenylmethylsulfonyl
fluoride. Acid-washed glass beads 0.4 mm in diameter were added to the
meniscus, and the sample was vortexed for 5 min; 0.1 ml of extraction
buffer was mixed into the extract, and the liquid was removed. An equal volume of 2× sample buffer was added to the sample, and the mixture was boiled in preparation for SDS-gel electrophoresis.
The material for the immunoblots was loaded onto an SDS-10%
polyacrylamide gel with equal amounts of total protein in each
lane.
Standard electrotransfer techniques were used (
50) with
Immobilon-P (Millipore) as the membrane. The detection method
used was
the ECL system as described by the manufacturer (Amersham)
except that
the secondary antibody, horseradish peroxidase-conjugated
donkey
anti-rabbit immunoglobulin, was used at a dilution of 10,000-fold.
The
primary polyclonal antisera used for each filter were from
the
production bleeds of rabbits 660 (anti-Gag) and 657 (anti-IN)
(
31).
cDNA preparations and blots.
About 109 cells
(100 OD600 units) were resuspended in a 13- by 100-mm glass
tube with 200 µl of EB (0.5 M NaCl, 0.2 M Tris-Cl [pH 7.5], 10 mM
EDTA, 1% SDS), and 200 µl of PICA (1:1 mixture of EB equilibrated
phenol and chloroform that contained 1/24 isoamyl alcohol) was added to
enough acid-washed glass beads to fill past the miniscus. The mixture
was vortexed vigorously for 30 min in a multivortexer (Baxter
Scientific Products), and an additional 400 µl each of EB and PICA
was added before a final 30-s vortex. The supernatant was reextracted
with PICA two more times. The supernatant was ethanol precipitated, and
the pellet was resuspended in 50 µl of TE; 5 µl of this mixture was
restriction digested and subjected to agarose gel electrophoresis for
DNA blot analysis. After transfer, the filters were hybridized with a
1.0-kb neo probe derived from a BamHI digest of
pGH54 (22).
| |
RESULTS |
Recombination assay for measuring the level of Tf1 reverse
transcripts in the nucleus.
Mutations in Tf1 that cause reduced
transposition frequencies could affect any one of a number of processes
that occur during particle formation, reverse transcription, or
integration. Our interest in identifying sequences throughout the Tf1
transposon that contribute specifically to the integration process in
vivo led us to apply a genetic assay for measuring the amount of Tf1 reverse transcripts present in the nucleus. The goal was to isolate a
set of mutations in Tf1 that blocked transposition but nevertheless resulted in the accumulation of normal levels of cDNA in the nucleus. Mutations with these properties were candidates for substitutions that
directly affected the integration process.
The assay used to measure the transposition activity of Tf1 elements
has been previously described (
28-30). The measure of
transposition in
S. pombe is based on the expression of Tf1
by
an inducible
nmt1 promoter from a multicopy vector (Fig.
1A).
The plasmid copy of Tf1 also
contained a bacterial
neo gene that
served as a marker for
transposition. For reasons described below,
this
neo gene,
neoAI, was disrupted by an artificial intron. Intact
copies
of
neo resulted from the reverse transcription of
Tf1-
neoAI mRNA that had been spliced (Fig.
1B). Patches of
cells that were
induced for transcription of Tf1-
neoAI were
subsequently exposed
to FOA to select for cells that no longer
possessed the Tf1-
neoAI plasmid. The presence of transposed
copies of Tf1-
neoAI was identified
by replica printing the
cells from the FOA medium to G418-containing
medium. Figure
2A shows that patches of cells that
contained wild-type
Tf1-
neoAI exhibit sufficient
transposition to produce confluent
growth on the G418 plate. A strain
that contained a copy of Tf1-
neoAI that lacked IN due to a
frameshift exhibited transposition frequencies
18-fold below normal
levels (Fig.
2A and Table
2).
View larger version (27K):
[in this window]
[in a new window]
|
FIG. 1.
Genetic assays for measuring transposition and
homologous recombination of Tf1. (A) Plasmid pHL449-1 was transformed
into S. pombe cells and served as the source of Tf1 mRNA and
protein for the transposition and recombination assays. The LTR
sequences are represented by triangles, the Gag, PR, RT, and IN coding
sequences are indicated by circles, and the neo,
URA3, and intron positions are marked by rectangles. The
arrow indicates that neo transcription proceeds in the
opposite direction from Tf1 transcription. The position of the
nmt1 promoter is indicated by nmt. The
BstXI restriction sites were used for the DNA blot analysis
of cDNA production, and the positions of restriction sites used to
subclone mutations are shown. (B) Role of the artificial intron in the
homologous recombination assay. The neo gene disrupted by
the artificial intron is depicted by two adjacent rectangles. The wavy
lines represent the Tf1 mRNA, and the double straight lines are the
double-stranded cDNA. After splicing and reverse transcription, the
neo gene was functional and was used to detect either the
integration of the cDNA into genomic sequences or the homologous
recombination of the cDNA with other sources of transposon sequences.
The diagram also indicates that the differences in the protocols for
these two assays were the agar media that the cells were grown on after
Tf1 transcription was induced.
|
|
View larger version (28K):
[in this window]
[in a new window]
|
FIG. 2.
Transposition and recombination activities of wild-type
Tf1 and of two versions with frameshift mutations. (A) Results of
transposition assays of S. pombe strains that were either
induced for Tf1 transcription (bottom) or repressed (top). The three
strains tested contained versions of Tf1 that were either wild type
(WT) or contained a frameshift (fs) mutation in IN or PR. The cells
were first induced for transcription on medium that lacked vitamin
B1 (B1). The induced cells were printed to plates that
contained FOA to select against the presence of the
Tf1-neoAI plasmid. The FOA-resistant cells were then replica
printed onto plates that contained FOA and G418 to measure the
frequency of transposition. (B) Results of recombination assays of
S. pombe strains that were either induced for Tf1
transcription (bottom) or repressed (top). The cells were treated as
described in the transposition assay except that after growth on medium
lacking vitamin B1, the cells were replica printed directly
onto medium containing G418.
|
|
The levels of reverse transcripts present in the nucleus were detected
by measuring homologous recombination between Tf1 cDNA
and copies of
transposon sequence present either in an autonomously
replicating
plasmid or in the genome. The method for detecting
recombination of Tf1
cDNA was adapted from a technique developed
to study transposition in
Saccharomyces cerevisiae of a Ty1 element
that contained a
neo gene that was interrupted by an artificial
intron
(
10). It was shown that when Ty1 integration is blocked,
Ty1
cDNA becomes an efficient substrate for homologous recombination
(
47). In our experiments, the cDNA was produced by the same
Tf1 expression plasmid used to generate high levels of transposition
events in vivo (Fig.
1A) (
1,
28). The coding frame of the
neo gene in pHL449-1 was interrupted by an artificial intron
such
that the intron was in the antisense strand of the
neo
transcript
and could therefore not be spliced out to provide
G418
r. Because the
neo gene with the intron
(
neoAI) was present in
the opposite orientation relative to
Tf1 transcription, the intron
could be spliced out of the Tf1
transcript. This configuration
of the artificial intron allowed us to
detect homologous recombination
events that resulted in the
incorporation of reverse transcript
sequences into plasmid or genomic
sites since these products contained
active copies of
neo
(Fig.
1B).
To measure recombination of the Tf1-
neoAI cDNA,
S. pombe cells were induced for Tf1 transcription on agar plates that
lacked
vitamin B
1. After a 4-day induction period, the
patches of cells
were replica printed to rich medium supplemented with
G418 to
measure the levels of homologous recombination. Figure
2B shows
that cells with the wild-type version of Tf1-
neoAI produced
confluent
growth on G418 medium if the induction plates lacked vitamin
B
1.
When the
nmt1 promoter was repressed
(presence of vitamin B
1),
no resistance to G418 was
observed. To test what fraction of the
cells became G418
r
as the result of integration, we measured the level of
G418
r cells produced by a version of Tf1-
neoAI
that lacked IN due to
a frameshift mutation. Immunoblot analysis
indicated that no IN
can be detected in the cells with the IN
frameshift (see Fig.
6B). This strain exhibited high levels of growth
on G418 medium,
indicating that much of the G418 resistance was not the
result
of transposition events. To quantify the fraction of cells that
became G418
r, we harvested patches from medium lacking
vitamin B
1 and plated
dilutions of cells onto rich medium
and G418 plates. Table
2 shows that the IN frameshift resulted in only
a 35% drop in the
number of G418
r cells. In comparison,
cells that contained Tf1-
neoAI with a frameshift
in PR that
blocked expression of RT and IN produced no G418
r cells.
These results indicated that all of the events that resulted
in
G418
r required reverse transcription, and a large fraction
of the cDNA
could be recombined to produce G418
r even in
the absence of integration.
The molecular nature of the events that resulted in G418
r
produced by the Tf1-
neoAI was further examined to determine
if these
events were generated by homologous recombination and to
identify
the type of sequences that participated in the recombination.
Because the goal of these experiments was to develop an assay
to
measure cDNA recombination that was independent of integration,
the
parent strain used to generate this set of independent
G418
r progeny contained Tf1-
neoAI with the IN
frameshift. Sixteen independent
patches of cells were induced for Tf1
expression and then printed
directly to plates that contained G418.
After colonies were purified
from the G418
r patches,
isolates that lacked the Tf1-
neoAI plasmid were generated.
We then tested these strains for G418
r to determine whether
the active
neo genes were associated with
the Tf1 plasmids
or with the
S. pombe genomes. Of the original
sixteen
S. pombe strains, five lost resistance to G418 when their
Tf1 plasmids were absent. This indicated that for 5 of the 16
strains,
the drug resistance was due to alterations in the plasmid
sequences.
The rearrangements in these five plasmids were further
characterized as
representative examples of the processes that
caused G418
r.
Plasmid DNA was extracted from the yeast strains and then transformed
into bacteria. The bacteria transformants that possessed recombinant
copies of
neo were identified by patching cells onto LB
plates
containing kanamycin.
The structures of the plasmids isolated in bacteria were determined by
extensive restriction site analysis. The three different
structures
observed and the relevant restriction sites are shown
in Fig.
3. One of the independently isolated
S. pombe strains
contained a plasmid identical to the
original except that the
intron in the
neoAI was absent
(Fig.
3A). This was likely the
result of homologous recombination
between the Tf1 plasmid and
a segment of cDNA with an intronless
neo. The plasmids isolated
from three other
G418
r strains contained tandem duplications of the Tf1
sequences. Two
of the
S. pombe strains contained plasmids
that possessed tandem
Tf1 copies with an intronless
neo gene
in the upstream copy of
Tf1 and an intron containing
neo in
the downstream Tf1 (Fig.
3B).
These plasmids may have resulted from
full-length cDNA molecules
that recombined with the 5' LTR sequences
found in the parent
plasmid. Another
S. pombe strain that
contained a plasmid with
tandem copies of Tf1 had intronless
neo genes in each of the Tf1
elements (Fig.
3C). This
plasmid may have resulted from the recombination
of two cDNA molecules
within the LTR sequences, thus producing
a tandem cDNA with two
intronless
neo copies that subsequently
recombined with the
Tf1-
neoAI plasmid. The last
S. pombe strain
carried a plasmid with a complex rearrangement that we have not
been
able to identify.
View larger version (20K):
[in this window]
[in a new window]
|
FIG. 3.
Rearranged versions of the Tf1-neoAI plasmid
with the IN frameshift were selected during the recombination assay.
The LTR sequences are represented by triangles, the Gag, PR, RT, and IN
coding sequences are indicated by circles, and the neo,
URA3, and intron positions are marked by rectangles. The
arrow indicates that neo transcription proceeds in the
opposite direction from Tf1 transcription. The position of the
nmt1 promoter is indicated by nmt. Positions of
the restriction sites that were used to reveal the structure of these
plasmids are shown. Enzymes used: A, AvrII; P,
PstI; Bs, BsrGI; C, ClaI; S,
SpeI; B, BamHI. (A) One plasmid isolated from a
G418r strain of S. pombe was identical to the
parent except that the intron was absent. (B) Two other plasmids
isolated from G418r strains of S. pombe were
identical and contained tandem duplications of the transposon. The
downstream copies of the neo genes contained introns, while
the upstream copies lacked introns. (C) Another plasmid isolated from a
G418r strain of S. pombe contained a tandem
duplication of Tf1. Neither copy of neo in this plasmid
contained intron sequence.
|
|
The rearrangements observed in all four plasmids were likely the result
of homologous recombination with Tf1-
neo+ cDNA.
Because the recombination assay produced resistance to
G418 that was
entirely dependent on the expression of RT and only
marginally
dependent on expression of IN (Table
2), high levels
of drug resistance
indicated that reverse transcripts had been
produced and were present
in the nucleus. We were therefore able
to use the homologous
recombination assay to test a large set
of defective Tf1 elements to
determine which were nevertheless
able to deliver significant amounts
of cDNA to the nucleus.
Isolation of an extensive collection of point mutations in Tf1 that
disrupt transposition.
Mutations throughout the
Tf1-neoAI element in the transposition assay plasmid were
created by treating the DNA with hydroxylamine in vitro. The extent of
the mutagenesis reaction was monitored by using the complementation in
E. coli of the pyrF gene by the URA3
gene of S. cerevisiae. After mutagenesis, the plasmid DNA was transformed into bacteria and the resulting colonies were tested
for uracil prototrophy. The mutagenesis conditions selected produced
bacterial transformants that exhibited uracil auxotrophy at a frequency
of 0.4%. Because the URA3 gene is approximately 1.0 kb, we
estimated that the fraction of plasmids that would carry a
loss-of-function mutation in the 5.9 kb of Tf1-neoAI was about 2.4%. The mutagenized plasmid DNA was then transformed into S. pombe, and 4,000 colonies were assayed for transposition.
The number of S. pombe transformants that exhibited obvious
defects in transposition as measured by the patch assay was 147, or
3.7%. This frequency was similar to the predicted level of 2.4% that was based on the uracil prototrophy.
Each of the 147 strains defective for transposition was assayed for
homologous recombination of the Tf1-
neoAI cDNA. The results
of patch tests indicated that 131 of the 147 strains tested showed
significantly reduced recombination compared to wild-type
Tf1-
neoAI.
Of the remaining 16 strains that showed high
levels of homologous
recombination, 6 possessed only minor defects in
transposition.
Therefore, 10 strains that had significant defects in
transposition
activity but nevertheless produced high levels of
recombination
were identified. The 10 strains were further
characterized to
evaluate whether the transposition defects were indeed
associated
with plasmid-encoded mutations.
The 10 candidate strains were extracted for plasmid DNA that was
subsequently transformed into bacteria. The 10 plasmid preparations
were then transformed back into
S. pombe. Seven of the 10 retransformed
strains exhibited the same transposition and
recombination phenotypes
as the original strains (data not shown).
Since the phenotypes
of three strains were not reproduced upon
transformation of plasmid
DNA into new strains, these plasmids were not
characterized further.
Thus, seven plasmids were identified as having
mutations in Tf1
that disrupted transposition but not the participation
of cDNA
in homologous recombination.
Mapping the position of the mutations in Tf1.
To determine the
positions of the mutations responsible for the low transposition
activity, we inserted restriction fragments from the defective Tf1
elements into copies of Tf1 that were otherwise wild type. These
subcloned versions of Tf1 were then analyzed to determine their
transposition and recombination phenotypes.
The majority of the Tf1 IN enzyme is encoded within a 3.2-kb
BamHI-
BsrGI fragment (Fig.
1A). The remaining 5'
end of IN is
encoded within a 2.2-kb
AvrII-
BsrGI
fragment which also contained
sequences encoding RT, PR, and the 3'
half of Gag. The results
summarized in Table
3 indicated that the
transposition-defective
phenotypes of mutants 2, 4, 5, and 9 were
associated with the
AvrII-
BsrGI fragments whereas
mutants 1, 3, and 10 had defects
within the
BamHI-
BsrGI fragments. The defects in
transposition
exhibited by the subcloned versions of Tf1 are shown in
Fig.
4A.
The strains with the subcloned
versions of Tf1 were also found
to show the same high levels of
homologous recombination that
the original strains possessed (Fig.
4B).
View larger version (67K):
[in this window]
[in a new window]
|
FIG. 4.
Transposition and recombination activities of seven
mutated versions of Tf1. (A) Seven versions of Tf1 with mutations and
three control strains were measured for transposition activity. The
plate contained FOA plus G418 so that the level of growth represented
the transposition activity of each strain. Each patch of cells is
labeled with its mutation number or the nature of the control plasmid
that it contained. fs, frameshift. (B) The same strains were also
tested for homologous recombination activity. The plate shown contained
G418, and the level of growth represented the level of cDNA
recombination produced by each strain.
|
|
Each of the restriction fragments that contained transposition
mutations was sequenced to identify all base changes. Five
of the seven
mutants (mutants 1, 3, 4, 9, and 10 in Table
3)
were found to consist
of single base changes within the IN domain.
This finding largely
substantiated our reasoning that elements
which were unable to
transpose but exhibited wild-type cDNA recombination
would possess
defects in integration. These mutations were located
throughout the
entire IN protein including the Zn domain, the
conserved catalytic
core, and the C-terminal domain (Fig.
4C).
Complete sequencing of the
AvrII-
BsrGI fragment
from mutant 5 and partial sequencing from the
AvrII-
BsrGI fragment of mutant
2 identified
single-base changes within the RH domain of the Tf1
RT. This was a
surprising result since data from the recombination
assay suggested
that reverse transcription occurred at wild-type
levels in these
strains. To determine if each of these mutations
in RH was truely the
single mutation responsible for the transposition
defects, we recreated
each single change in the context of wild-type
Tf1 by subcloning into
the assay plasmid two independent PCR fragments
that contained each
mutation. Once the sequence of the mutated
sites was verified, the new
plasmids were transformed into
S. pombe and the
transformants were assayed for transposition and
recombination. The
assays in Fig.
5 verified that the
S. pombe strains expressing the reconstruction of mutation 2 (YHL5282)
had transposition and recombination phenotypes
indistinguishable
from those of the original mutant (YHL2230).
Likewise, the strain
expressing the reconstructed mutant 5 (YHL5274) showed transposition
and recombination phenotypes
indistinguishable from those of the
original mutant strain (YHL2234).
We quantitated the transposition
frequencies of each of these strains
to determine if the activities
of the reconstructed Tf1 elements
matched those of the original
isolates (Table
4). The strains transformed with the
PCR-reconstructed
mutants exhibited transposition defects at
frequencies that were
approximately 10-fold below wild-type
frequencies. These values
were very similar to the transposition
frequencies of the cells
with the original amino acid substitutions.
View larger version (72K):
[in this window]
[in a new window]
|
FIG. 5.
Transposition and recombination activities of the Tf1
elements with the original substitutions in RH, mutations (Mut) 2 and
5, and activities of equivalent elements reconstructed by PCR. The
strains on each plate are identified by the template shown below the
photograph. The plate on the left contained G418 and shows the results
of the recombination assay; the plate on the right contained FOA plus
G418 and shows the results of the transposition assay. fs,
frameshift.
|
|
DNA blot analysis of cDNA produced by mutant copies of Tf1.
To
determine directly the levels of cDNA produced in each of these mutant
strains, we used DNA blot analysis. Total DNA was extracted from
S. pombe strains expressing the mutant copies of Tf1 as well
as from strains expressing wild-type, IN frameshifted, and PR
frameshifted versions of Tf1. These DNAs were restriction digested with
BstXI and subjected to DNA blot analysis with a neo-specific probe. The Tf1 expression plasmid contained two
BstXI sites, one within vector sequence and the other near
the 3' end of the Tf1 element (Fig. 1A). Of the two products resulting
from BstXI digestion of the plasmid, only the 9.5-kb band is
recognized by the neo probe. Since the completed reverse
transcript contained the single BstXI site upstream of
neo, a 2.1-kb band specific to the reverse transcription
product was also detected by the neo probe. The DNA blot in
Fig. 6A showed that all strains tested exhibit similar band intensities of the 9.5-kb plasmid. This indicated that approximately equivalent amounts of total DNA were loaded in each
lane. Lane 2 contained DNA products extracted from a strain that
expressed the IN frameshifted version of Tf1. This strain generated
wild-type levels of cDNA. DNA extracted from the PR frameshifted Tf1
that expressed no RT or IN indicated that this strain produced no
detectable cDNA (lane 3). All five of the mutants that possessed
substitutions in IN produced approximately wild-type levels of reverse
transcripts (Fig. 6A). This result confirmed our expectation that
strains competent for recombination would contain high levels of cDNA.
View larger version (47K):
[in this window]
[in a new window]
|
FIG. 6.
Effects of mutations in Tf1 on the accumulation of IN
protein and cDNA were measured. (A) The results of DNA blot analysis
were used to detect the effects of mutations in RH and IN on the
accumulation of cDNA. Total DNA was extracted from S. pombe
strains induced for Tf1 expression. The DNA was digested with
BstXI and probed with neo-specific sequence. The
9.5-kb band was produced by vector sequence, and the 2.1-kb band was
generated by Tf1 cDNA. The additional band is likely derived from
single-LTR circles; however, this identification has not been
definitively shown. The panel on the left contained DNA from cells
grown in liquid culture, and the panel on the right contained DNA from
cells grown on agar plates. WT, wild type. (B) The levels of Tf1 Gag
and IN accumulated in strains with the Tf1 mutations were determined by
immunoblot analysis. Equal amounts of total protein from each strains
was subjected to immunoblot analysis, and the resulting membrane was
probed simultaneously with anti-Gag and anti-IN antisera.
|
|
The DNA blot analysis of reverse transcripts produced by the Tf1
elements with mutations in RH revealed that the Ser749
Leu
(S749L)
substitution (mutant 5) did not cause a reduction in cDNA
levels.
However, the Pro816
Ser (P816S) substitution (mutant 2)
resulted in a
1.9-fold reduction in the amount of reverse transcripts
detected by
phosphoimager analysis (Fig.
6A). The wild-type levels
of cDNA
generated by the Tf1 with the S749L mutation in RH was
consistent with
the homologous recombination data but was surprising
because RH is not
thought to be required for transposition once
reverse transcription is
complete. In light of this result, we
thought it important to ensure
that the growth conditions of the
cells extracted for DNA match the
conditions used for the transposition
assays. We therefore prepared DNA
from the strains with the mutations
in RH by harvesting patches of
cells that were fully induced for
transposition on agar plates. This
DNA was used in the blot analysis
shown in Fig.
6A. In this way, we
were able to show that wild-type
levels of cDNA were produced by the
very same patch of cells that
exhibited low transposition due to the
S749L mutation.
Immunoblot analysis of IN accumulation.
The finding that the
transposition-defective mutants produced wild-type levels of reverse
transcription products suggested that the principal defect in these
mutants was in their ability to complete the integration step of the
transposition pathway. To investigate whether the integration defects
were a manifestation of decreased stability of the IN or Gag protein,
we performed immunoblot analysis with antibodies raised against the Tf1
IN and Gag. Total cell proteins were extracted from log-phase cultures of strains expressing the wild-type, the IN frameshifted, the RT
frameshifted, and the seven integration-defective versions of Tf1.
Equal amounts of total protein were loaded in each lane of an
SDS-polyacrylamide gel that was transferred to an Immobilon-P membrane
and probed with both IN- and Gag-specific antibodies. From previous
results, it is known that the Tf1 Gag and IN proteins are expressed at
equal levels from within a single primary translation product and that
during the log-to-stationary-phase transition of the culture, the IN
protein is specifically targeted for degradation (1). Figure
6B indicated that all seven of the mutant versions of Tf1 produced
detectable levels of IN protein in log phase and adjusted their
Gag-to-IN ratios during the log-to-stationary-phase transition (data
not shown). Decreased IN signal was observed for vegetative cells with
the Ser1009Leu (S1009L), Pro903Leu (P903L), and Glu1142Lys
(E1142K) substitutions. In multiple experiments, these three strains
showed decreased although variable levels of stable IN protein relative
to the IN levels of the strain expressing wild-type Tf1.
| |
DISCUSSION |
The presence of the Zn domain and the D,D35E motif
(26) in Tf1 IN as well as the highly conserved TG...CA
nucleotides at the termini of the Tf1 LTRs indicated that the mechanism
of Tf1 integration is closely related to the mechanisms of the other
LTR-elements. To evaluate this conclusion and to extend our
understanding of LTR-retroelement integration, we sought to develop an
in vivo method for identifying mutations that specifically blocked
integration. This approach was designed to allow us to determine which
amino acids within any of the transposon proteins were critical for integration. Our test for defects in integration was based on genetic
measurements of Tf1 cDNA levels. By measuring homologous recombination
between Tf1 cDNA and plasmid copies of Tf1-neoAI, we were
able to identify mutations in Tf1 that had little effect on the
accumulation of cDNA but nevertheless resulted in low levels of
transposition. The version of Tf1 that contained a frameshift in the
beginning of the IN sequence served as an initial example of this type
of mutation. Although the IN frameshift resulted in an 18-fold drop in
transposition activity, only a 35% decrease in the level of
G418r was detected with the recombination assay. The
relatively high level of recombination observed correlated well with
the results of DNA blots that showed the strain with the IN frameshift
produced wild-type levels of Tf1 cDNA. The 35% reduction caused by the IN frameshift indicated that when IN was present, about a third of the
events detected by the recombination assay were due to transposition.
To understand how recombination of Tf1 cDNA caused G418r,
we examined the structure of five Tf1-neoAI plasmids that
encoded G418r as the result of rearrangements that occurred
during the recombination assay. Although the parent plasmid contained a
neo gene disrupted by an artificial intron, each recombinant
plasmid possessed active copies of neo that lacked the
intron. These plasmids either acquired intron-free versions of
neo either in the context of a complete Tf1 duplication or
were identical to the parent except that the intron was absent from
neo. In either case, the structures were consistent with
parent plasmids that homologously recombined with Tf1-neo
cDNA that lacked the artificial intron. The relatively high frequency
(2.9%) of the recombination events that generate G418r may
be due to the linear structure of the Tf1 cDNA.
The recombinant events that we isolated were similar to those obtained
in a study of cDNA recombination of Ty1 sequences in S. cerevisiae (47). Although we characterized only the
recombination events that resulted in plasmid-encoded
G418r, tandem duplications of Ty1 were found to form both
in plasmid sequences and in the S. cerevisiae genome.
Whereas the recombination produced in S. cerevisiae was
found to be dependent on a gene required for homologous recombination,
RAD52, we were unable to demonstrate a similar dependence on
cellular recombination factors because no gene in S. pombe
that has the high mitotic activity of RAD52 has been
identified. Nevertheless, the high frequencies of G418r
produced by versions of Tf1 that lack IN allowed us to use this assay
as a measure of cDNA levels.
Mutations in IN reduce transposition.
The homologous
recombination assay was used to screen 147 strains that exhibited low
transposition activity. The seven isolates that had severe defects in
transposition but produced high frequencies of G418r in the
recombination assay were thought to possess low integration activity.
This reasoning was supported by the finding that the defects in five of
these strains were caused by single amino acid substitutions in IN.
Three of the five mutations in IN were positioned at or near highly
conserved residues that are known to be required for IN
activity in
other retroelements. The mutation P903L is located
14 residues upstream
of the first conserved histidine in the HHCC
Zn domain of the amino
terminus of Tf1 IN. Immunoblotting of this
mutant indicated that a
destabilized IN protein may be the cause
of the integration defect
exhibited by strains expressing this
mutant version of Tf1. The
mutation Leu929
Phe (L929F) is just
five residues downstream from the
second conserved histidine in
the Zn domain. Results from
immunoblotting showed that the defective
IN from this strain was stable
and therefore lacked activity due
to a loss of function. Since the two
conserved histidines in the
Zn domain of HIV IN are required for DNA
strand transfer activity
(
15), it was possible that the
L929F mutation disrupted the
essential function of the histidine
residues in the Zn domain
of Tf1. This interpretation is complicated by
results showing
that in the context of live HIV, the histidines in the
Zn domain
are required for reverse transcription (
36). Since
the L929F
mutation had no observable effect on reverse transcription,
this
substitution may have only disrupted the function of the Zn domain
in the integration reaction.
The mutation in IN, S1009L, was located at a position highly conserved
among retroviruses that is 21 residues downstream of
the first D in the
D,D
35E motif of the central core domain (
15).
The immunoblot results indicated that the S1009L mutation greatly
destabilized the Tf1 IN protein. This finding is consistent with
studies of HIV IN with mutations at the analogous residue, serine
81. The substitution of serine 81 caused HIV IN to become insoluble
when
expressed either from yeast or bacteria (
27,
52). The
position of serine 81 in the crystal structure of HIV IN is at
the top
of a turn between beta strands 2 and 3. This location
appears to bisect
the center of the IN protein in a way that may
tether the two domains
of alpha helices together (
13).
The two other single substitutions in Tf1 IN were located in regions
that possess no similarity to other IN proteins. The
E1142K mutation
was positioned approximately at the end of the
core domain, 59 residues
downstream of the glutamic acid in the
core motif D,D
35E.
The results from immunoblot analysis suggested
that the E1142K mutation
greatly reduced the stability of the
IN protein. The significant
destabilization caused by this substitution
may have resulted from the
change of a negatively charged residue
to a positive amino acid.
Another mutation in Tf1 IN, Ala1311
Thr
(A1311T), was located 20 residues from the C terminus and had
little effect on the stability of
the protein. The 248 residues
in Tf1 IN downstream of the
D,D
35E motif have little homology
to other IN proteins and
is much larger than the C-terminal domains
of retroviruses. The
significant reduction in transposition caused
by the A1311T mutation
represents the first indication that the
C-terminal domain in Tf1 IN is
required for function.
Mutations in RT reduce transposition.
The finding that two of
the seven mutations were located in RT was very surprising as all of
the mutations were isolated on the basis of recombination results that
indicated cDNA levels were normal. That both of these mutations were
found specifically in the RH domain of RT was no less surprising since
the RH activity of retroviruses is required during several stages of
reverse transcription (8). The primary role of retroviral RH
in reverse transcription is the degradation of the RNA template as it
is copied into DNA. This releases newly synthesized minus-strand
strong-stop DNA so that it can reanneal to the 3' LTR in the mRNA and
prime synthesis of the full-length minus strand. The primer of
plus-strand DNA synthesis is generated by a specialized activity of RH
that recognizes and cleaves the 3' end of the polypurine tract (PPT).
In addition, mutations in two catalytic residues of RH in Tf1 indicated
that RH activity is required for the initiation of reverse
transcription (29).
One of the substitutions in Tf1 RH that we isolated, P816S (mutant 2),
resulted in a version of the element that exhibited
low levels of
transposition despite the high frequencies of G418
r
colonies generated in the homologous recombination assay. The
results
of immunoblots showed that the P816S mutation did not
affect the levels
of IN protein expressed by Tf1 and DNA blots
indicated that the levels
of cDNA that accumulated were reduced
1.9-fold. Taken together with the
result that a twofold reduction
in double-stranded reverse transcripts
can result in a fivefold
drop in transposition (
33), this
finding indicates that it is
possible that the P816S mutation caused a
significant loss of
transposition because of a relatively minor defect
in RH function.
If the defect in RH activity specifically affected the
cleavage
of the PPT, the lack of plus-strand cDNA would be expected to
lower transposition without greatly reducing the frequency of
homologous recombination. The recombination events of Ty1 cDNA
have
been shown to occur efficiently even if only minus-strand
reverse
transcripts are produced (
47). Low levels of plus-strand
cDNA would also result in a reduced signal on a DNA blot as was
produced by the strain with the P816S mutation. Interestingly,
the
position of the P816S mutation is eight residues upstream
from a highly
conserved aspartic acid that in HIV (Asp549) has
been shown to
contribute to the ability of RH to recognize the
PPT (
42).
The other substitution in RH, S749L (mutant 5), was located three
residues upstream of the highly conserved E752 that corresponds
to E478
in HIV RT. Our DNA blots demonstrated that Tf1 with the
S749L
substitution produced quantities of double-stranded cDNA
that were
indistinguishable from that of wild-type Tf1. The immunoblots
showed
that Tf1 with the S749L mutation accumulated wild-type
levels of IN
protein. These results indicated that the low level
of Tf1 integration
caused by the S749L mutation was not due to
the lack of IN protein or
its DNA substrate. Another function
of retroviral RH that has been
described is the degradation of
the tRNA and the PPT once they have
served as the primers of DNA
synthesis. It is possible that the S749L
substitution did reduce
the specific degradation of the minus-strand
and or plus-strand
primers. It is also possible that the presence of
the minus-strand
or the plus-strand primers at the 5' ends of the
otherwise completed
double-stranded reverse transcripts inhibited the
function of
IN. An additional possibility is that other aspects of
replication
such as virus-like particle (VLP) assembly or localization
of
the VLP to the nucleus has been affected by this mutation in RT.
We
have shown that VLPs produced by this mutant strain are
indistinguishable
from VLPs produced by strains expressing wild-type
Tf1 as determined
by sucrose gradient analysis (
1a). If
there is a subtle defect
in particle assembly in this mutant, it may
result in a reduced
import of a protein component of the preintegration
complex (PIC).
An alternative is the possibility that the mutation S749L inhibited
transposition because the substitution disrupted an unidentified
function of RH that may contribute directly to the integration
reaction. One compelling hypothesis is that the strong structural
similarity observed between the IN core domain and the RH domain
of HIV
(
13) could lead to a heterodimerization of these proteins
that could be important for robust integration activity. Consistent
with this possibility is the report that the large nucleoprotein
complex termed the PIC purified from HIV-infected cells contains
RT
(
5,
37), and the HIV PIC produces double-ended insertions
in
vitro with significantly greater efficiency than purified IN
(
16). Interestingly, interactions between RT and IN of other
retroviruses have been reported. The immunoprecipitation of murine
leukemia virus particles that are boiled or treated with
2-mercaptoethanol
indicates that disulfide bonds exists between RT and
IN (
20).
Another example of an interaction between a
retroviral IN and
RT is the heterodimeric RT of avian sarcoma-leukosis
virus. One
of the polypeptides contains both RT and IN domains
(
49). The
importance of the IN domain in the avian
sarcoma-leukemia virus
RT is not yet understood. Whether the S749L
mutation in Tf1 disrupted
an RH function specifically required for
integration or affected
a previously described function of RH, further
analysis will be
required to reveal how a mutation in RH can block
transposition
without affecting the levels of cDNA.
| |
FOOTNOTES |
*
Corresponding author. Mailing address: Laboratory of
Eukaryotic Gene Regulation, National Institute of Child Health and
Human Development, NIH, Bethesda, MD 20892. Phone: (301) 402-4281. Fax: (301) 496-8576. E-mail: Henry_Levin{at}nih.gov.
| |
REFERENCES |
| 1.
|
Atwood, A.,
J. Lin, and H. Levin.
1996.
The retrotransposon Tf1 assembles virus-like particles with excess Gag relative to integrase because of a regulated degradation process.
Mol. Cell. Biol.
16:338-346[Abstract].
|
| 1a.
| Atwood, A. Unpublished data.
|
| 2.
|
Boeke, J. D.,
J. Trueheart,
G. Natsoulis, and G. R. Fink.
1987.
5-Fluoro-orotic acid as a selective agent in yeast molecular genetics.
Methods Enzymol.
154:164-175[Medline].
|
| 3.
|
Brown, P. O.,
B. Bowerman,
H. E. Varmus, and J. M. Bishop.
1987.
Correct integration of retroviral DNA in vitro.
Cell
49:347-356[Medline].
|
| 4.
|
Brown, P. O.,
B. Bowerman,
H. E. Varmus, and J. M. Bishop.
1989.
Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein.
Proc. Natl. Acad. Sci. USA
86:2525-2529[Abstract/Free Full Text].
|
| 5.
|
Bukrinsky, M. I.,
N. Sharova,
T. L. McDonald,
T. Pushkarskaya,
W. G. Tarpley, and M. Stevenson.
1993.
Association of integrase, matrix, and reverse transcriptase antigens of human immunodeficiency virus type 1 with viral nucleic acids following acute infection.
Proc. Natl. Acad. Sci. USA
90:6125-6129[Abstract/Free Full Text].
|
| 6.
|
Bushman, F. D., and R. Craigie.
1991.
Activities of human immunodeficiency virus (HIV) integration protein in vitro: specific cleavage and integration of HIV DNA.
Proc. Natl. Acad. Sci. USA
88:1339-1343[Abstract/Free Full Text].
|
| 7.
|
Bushman, F. D.,
A. Engelman,
I. Palmer,
P. Wingfield, and R. Craigie.
1993.
Domains of the integrase protein of human immunodeficiency virus type 1 responsible for polynucleotidyl transfer and zinc binding.
Proc. Natl. Acad. Sci. USA
90:3428-3432[Abstract/Free Full Text].
|
| 8.
|
Champoux, J.
1993.
Roles of ribonuclease H in reverse transcription, p. 103-117. In
A. Skulka, and S. Goff (ed.), Reverse transcriptase.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
|
| 9.
|
Craigie, R.,
T. Fujiwara, and F. Bushman.
1990.
The IN protein of Moloney murine leukemia virus processes the viral DNA ends and accomplishes their integration in vitro.
Cell
62:829-837[Medline].
|
| 10.
|
Curcio, M. J., and D. J. Garfinkel.
1991.
Single-step selection for Ty1 element retrotransposition.
Proc. Natl. Acad. Sci. USA
88:936-940[Abstract/Free Full Text].
|
| 11.
|
Doolittle, R. F.,
D. F. Feng,
M. S. Johnson, and M. A. McClure.
1989.
Origins and evolutionary relationships of retroviruses.
Q. Rev. Biol.
64:1-30[Medline].
|
| 12.
|
Drelich, M.,
R. Wilhelm, and J. Mous.
1992.
Identification of amino acid residues critical for endonuclease and integration activities of HIV-1 IN protein in vitro.
Virology
188:459-468[Medline].
|
| 13.
|
Dyda, F.,
A. B. Hickman,
T. M. Jenkins,
A. Engelman,
R. Craigie, and D. R. Davies.
1994.
Crystal structure of the catalytic domain of HIV-1 integrase: similarity to other polynucleotidyl transferases.
Science
266:1981-1986[Abstract/Free Full Text].
|
| 14.
|
Eichinger, D. J., and J. D. Boeke.
1990.
A specific terminal structure is required for Ty1 transposition.
Genes Dev.
4:324-330[Abstract/Free Full Text].
|
| 15.
|
Engelman, A., and R. Craigie.
1992.
Identification of conserved amino acid residues critical for human immunodeficiency virus type 1 integrase function in vitro.
J. Virol.
66:6361-6369[Abstract/Free Full Text].
|
| 16.
|
Farnet, C. M., and F. D. Bushman.
1997.
HIV-1 cDNA integration: requirement of HMG I(Y) protein for function of preintegration complexes in vitro.
Cell
88:483-492[Medline].
|
| 17.
|
Fayet, O.,
P. Raymond,
P. Polard,
M. F. Prère, and M. Chandler.
1990.
Functional similarities between retroviruses and the IS3 family of bacterial insertion sequences?
Mol. Microbiol.
4:1771-1777[Medline].
|
| 18.
|
Fujiwara, T., and K. Mizuuchi.
1988.
Retroviral DNA integration: structure of an integration intermediate.
Cell
54:497-504[Medline].
|
| 19.
|
Gatermann, K. B.,
A. Hoffmann,
G. H. Rosenberg, and N. F. Kaufer.
1989.
Introduction of functional artificial introns into the naturally intronless ura4 gene of Schizosaccharomyces pombe.
Mol. Cell. Biol.
9:1526-1535[Abstract/Free Full Text].
|
| 20.
|
Hu, S. C.,
D. L. Court,
M. Zweig, and J. G. Levin.
1986.
Murine leukemia virus pol gene products: analysis with antisera generated against reverse transcriptase and endonuclease fusion proteins expressed in Escherichia coli.
J. Virol.
60:267-274[Abstract/Free Full Text].
|
| 21.
|
Johnson, M. S.,
M. A. McClure,
D. F. Feng,
J. Gray, and R. F. Doolittle.
1986.
Computer analysis of retroviral pol genes: assignment of enzymatic functions to specific sequences and homologies with nonviral enzymes.
Proc. Natl. Acad. Sci. USA
83:7648-7652[Abstract/Free Full Text].
|
| 22.
|
Joyce, C. M., and N. Grindley.
1984.
Method for determining whether a gene of Escherichia coli is essential: application to the polA gene.
J. Bacteriol.
158:636-643[Abstract/Free Full Text].
|
| 23.
|
Katz, R. A.,
G. Merkel,
J. Kulkosky,
J. Leis, and A. M. Skalka.
1990.
The avian retroviral IN protein is both necessary and sufficient for integrative recombination in vitro.
Cell
63:87-95[Medline].
|
| 24.
|
Katz, R. A., and A. M. Skalka.
1994.
The retroviral enzymes.
Annu. Rev. Biochem.
63:133-173[Medline].
|
| 25.
|
Khan, E.,
J. P. Mack,
R. A. Katz,
J. Kulkosky, and A. M. Skalka.
1991.
Retroviral integrase domains: DNA binding and the recognition of LTR sequences.
Nucleic Acids Res.
19:851-860[Abstract/Free Full Text]. (Erratum, 25:1358.)
|
| 26.
|
Kulkosky, J.,
K. S. Jones,
R. A. Katz,
J. P. Mack, and A. M. Skalka.
1992.
Residues critical for retroviral integrative recombination in a region that is highly conserved among retroviral/retrotransposon integrases and bacterial insertion sequence transposases.
Mol. Cell. Biol.
12:2331-2338[Abstract/Free Full Text].
|
| 27.
|
Leavitt, A. D.,
L. Shiue, and H. E. Varmus.
1993.
Site-directed mutagenesis of HIV-1 integrase demonstrates differential effects on integrase functions in vitro.
J. Biol. Chem.
268:2113-2119[Abstract/Free Full Text].
|
| 28.
|
Levin, H. L.
1995.
A novel mechanism of self-primed reverse transcription defines a new family of retroelements.
Mol. Cell. Biol.
15:3310-3317[Abstract].
|
| 29.
|
Levin, H. L.
1996.
An unusual mechanism of self-primed reverse transcription requires the RNase H domain of reverse transcriptase to cleave an RNA duplex.
Mol. Cell. Biol.
16:5645-5654[Abstract].
|
| 30.
|
Levin, H. L., and J. D. Boeke.
1992.
Demonstration of retrotransposition of the Tf1 element in fission yeast.
EMBO J.
11:1145-1153[Medline].
|
| 31.
|
Levin, H. L.,
D. C. Weaver, and J. D. Boeke.
1993.
Novel gene expression mechanism in a fission yeast retroelement: Tf1 proteins are derived from a single primary translation product.
EMBO J.
12:4885-4895[Medline]. (Erratum, 13:1494, 1994.)
|
| 32.
|
Levin, H. L.,
D. C. Weaver, and J. D. Boeke.
1990.
Two related families of retrotransposons from Schizosaccharomyces pombe.
Mol. Cell. Biol.
10:6791-6798[Abstract/Free Full Text].
|
| 33.
|
Lin, J., and H. Levin.
1997.
A complex structure in the mRNA of Tf1 is recognized and cleaved to generate the primer of reverse transcription.
Genes Dev.
11:270-285[Abstract/Free Full Text].
|
| 34.
|
Luan, D. D.,
M. H. Korman,
J. L. Jakubczak, and T. H. Eickbush.
1993.
Reverse transcription of R2Bm RNA is primed by a nick at the chromosomal target site: a mechanism for non-LTR retrotransposition.
Cell
72:595-605[Medline].
|
| 35.
|
Lutzke, R. A.,
C. Vink, and R. H. Plasterk.
1994.
Characterization of the minimal DNA-binding domain of the HIV integrase protein.
Nucleic Acids Res.
22:4125-4131[Abstract/Free Full Text].
|
| 36.
|
Masuda, T.,
V. Planelles,
P. Krogstad, and I. S. Chen.
1995.
Genetic analysis of human immunodeficiency virus type 1 integrase and the U3 att site: unusual phenotype of mutants in the zinc finger-like domain.
J. Virol.
69:6687-6696[Abstract].
|
| 37.
|
Miller, M. D.,
C. M. Farnet, and F. D. Bushman.
1997.
Human immunodeficiency virus type 1 preintegration complexes: studies of organization and composition.
J. Virol.
71:5382-5390[Abstract].
|
| 38.
|
Moore, S. P., and D. J. Garfinkel.
1994.
Expression and partial purification of enzymatically active recombinant Ty1 integrase in Saccharomyces cerevisiae.
Proc. Natl. Acad. Sci. USA
91:1843-1847[Abstract/Free Full Text].
|
| 39.
|
Moore, S. P.,
M. Powers, and D. J. Garfinkel.
1995.
Substrate specificity of Ty1 integrase.
J. Virol.
69:4683-4692[Abstract].
|
| 40.
|
Moreno, S.,
A. Klar, and P. Nurse.
1991.
Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.
Methods Enzymol.
194:795-823[Medline].
|
| 41.
|
Mumm, S. R., and D. P. Grandgenett.
1991.
Defining nucleic acid-binding properties of avian retrovirus integrase by deletion analysis.
J. Virol.
65:1160-1167[Abstract/Free Full Text].
|
| 42.
|
Rausch, J. W., and S. F. Le Grice.
1997.
Substituting a conserved residue of the ribonuclease H domain alters substrate hydrolysis by retroviral reverse transcriptase.
J. Biol. Chem.
272:8602-8610[Abstract/Free Full Text].
|
| 43.
|
Rose, M. D.,
F. Winston, and P. Hieter.
1990.
.
Methods in yeast genetics: a laboratory course manual.
Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
|
| 44.
|
Roth, M. J.,
P. L. Schwartzberg, and S. P. Goff.
1989.
Structure of the termini of DNA intermediates in the integration of retroviral DNA: dependence on IN function and terminal DNA sequence.
Cell
58:47-54[Medline].
|
| 45.
|
Rowland, S. J., and K. G. Dyke.
1990.
Tn552, a novel transposable element from Staphylococcus aureus.
Mol. Microbiol.
4:961-975[Medline].
|
| 46.
|
Schauer, M., and A. Billich.
1992.
The N-terminal region of HIV-1 integrase is required for integration activity, but not for DNA-binding.
Biochem. Biophys. Res. Commun.
185:874-880[Medline].
|
| 47.
|
Sharon, G.,
T. J. Burkett, and D. J. Garfinkel.
1994.
Efficient homologous recombination of Ty1 element cDNA when integration is blocked.
Mol. Cell. Biol.
14:6540-6551[Abstract/Free Full Text].
|
| 48.
|
Sikorski, R. S., and J. D. Boeke.
1990.
In vitro mutagenesis and plasmid shuffling: from cloned gene to mutant yeast.
Methods Enzymol.
194:302-318.
|
| 49.
|
Skalka, A. M., and S. P. Goff (ed.).
1993.
.
Reverse transcriptase.
Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
|
| 50.
|
Towbin, H.,
T. Staehelin, and J. Gordon.
1979.
Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.
Proc. Natl. Acad. Sci. USA
76:4350-4354[Abstract/Free Full Text].
|
| 51.
|
van Gent, D. C.,
Y. Elgersma,
M. W. Bolk,
C. Vink, and R. H. Plasterk.
1991.
DNA binding properties of the integrase proteins of human immunodeficiency viruses types 1 and 2.
Nucleic Acids Res.
19:3821-3827[Abstract/Free Full Text].
|
| 52.
|
van Gent, D. C.,
A. A. Groeneger, and R. H. Plasterk.
1992.
Mutational analysis of the integrase protein of human immunodeficiency virus type 2.
Proc. Natl. Acad. Sci. USA
89:9598-9602[Abstract/Free Full Text].
|
| 53.
|
Varmus, H., and P. Brown (ed.).
1989.
.
Retroviruses.
American Society for Microbiology, Washington, D.C.
|
| 54.
|
Zimmerly, S.,
H. Guo,
P. S. Perlman, and A. M. Lambowitz.
1995.
Group II intron mobility occurs by target DNA-primed reverse transcription.
Cell
82:545-554[Medline].
|
J Virol, February 1998, p. 1324-1333, Vol. 72, No. 2
0022-538X/98/$04.00+0
Copyright © 1998, American Society for Microbiology. All rights reserved.
This article has been cited by other articles:
-
Chatterjee, A. G., Leem, Y. E., Kelly, F. D., Levin, H. L.
(2009). The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection. J. Virol.
83: 2675-2685
[Abstract]
[Full Text]
-
Ebina, H., Chatterjee, A. G., Judson, R. L., Levin, H. L.
(2008). The GP(Y/F) Domain of TF1 Integrase Multimerizes when Present in a Fragment, and Substitutions in This Domain Reduce Enzymatic Activity of the Full-length Protein. J. Biol. Chem.
283: 15965-15974
[Abstract]
[Full Text]
-
Atwood-Moore, A., Yan, K., Judson, R. L., Levin, H. L.
(2006). The Self Primer of the Long Terminal Repeat Retrotransposon Tf1 Is Not Removed during Reverse Transcription.. J. Virol.
80: 8267-8270
[Abstract]
[Full Text]
-
Atwood-Moore, A., Ejebe, K., Levin, H. L.
(2005). Specific Recognition and Cleavage of the Plus-Strand Primer by Reverse Transcriptase. J. Virol.
79: 14863-14875
[Abstract]
[Full Text]
-
Hizi, A., Levin, H. L.
(2005). The Integrase of the Long Terminal Repeat-Retrotransposon Tf1 Has a Chromodomain That Modulates Integrase Activities. J. Biol. Chem.
280: 39086-39094
[Abstract]
[Full Text]
-
Kim, M.-K., Claiborn, K. C., Levin, H. L.
(2005). The Long Terminal Repeat-Containing Retrotransposon Tf1 Possesses Amino Acids in Gag That Regulate Nuclear Localization and Particle Formation. J. Virol.
79: 9540-9555
[Abstract]
[Full Text]
-
Huang, Y., Intine, R. V., Mozlin, A., Hasson, S., Maraia, R. J.
(2005). Mutations in the RNA Polymerase III Subunit Rpc11p That Decrease RNA 3' Cleavage Activity Increase 3'-Terminal Oligo(U) Length and La-Dependent tRNA Processing. Mol. Cell. Biol.
25: 621-636
[Abstract]
[Full Text]
-
Teysset, L., Dang, V.-D., Kim, M. K., Levin, H. L.
(2003). A Long Terminal Repeat-Containing Retrotransposon of Schizosaccharomyces pombe Expresses a Gag-Like Protein That Assembles into Virus-Like Particles Which Mediate Reverse Transcription. J. Virol.
77: 5451-5463
[Abstract]
[Full Text]
-
Singleton, T. L., Levin, H. L.
(2002). A Long Terminal Repeat Retrotransposon of Fission Yeast Has Strong Preferences for Specific Sites of Insertion. Eukaryot Cell
1: 44-55
[Abstract]
[Full Text]
-
Dang, V.-D., Levin, H. L.
(2000). Nuclear Import of the Retrotransposon Tf1 Is Governed by a Nuclear Localization Signal That Possesses a Unique Requirement for the FXFG Nuclear Pore Factor Nup124p. Mol. Cell. Biol.
20: 7798-7812
[Abstract]
[Full Text]
-
Balasundaram, D., Benedik, M. J., Morphew, M., Dang, V.-D., Levin, H. L.
(1999). Nup124p Is a Nuclear Pore Factor of Schizosaccharomyces pombe That Is Important for Nuclear Import and Activity of Retrotransposon Tf1. Mol. Cell. Biol.
19: 5768-5784
[Abstract]
[Full Text]
-
Dang, V. D., Benedik, M. J., Ekwall, K., Choi, J., Allshire, R. C., Levin, H. L.
(1999). A New Member of the Sin3 Family of Corepressors Is Essential for Cell Viability and Required for Retroelement Propagation in Fission Yeast. Mol. Cell. Biol.
19: 2351-2365
[Abstract]
[Full Text]
-
Steele, S. J. S., Levin, H. L.
(1998). A Map of Interactions between the Proteins of a Retrotransposon. J. Virol.
72: 9318-9322
[Abstract]
[Full Text]
-
Hoff, E. F., Levin, H. L., Boeke, J. D.
(1998). Schizosaccharomyces pombe Retrotransposon Tf2 Mobilizes Primarily through Homologous cDNA Recombination. Mol. Cell. Biol.
18: 6839-6852
[Abstract]
[Full Text]
Top
Abstract
Introduction
